ORCID Profile
0000-0002-3652-2068
Current Organisation
University of Queensland - Gatton Campus
Does something not look right? The information on this page has been harvested from data sources that may not be up to date. We continue to work with information providers to improve coverage and quality. To report an issue, use the Feedback Form.
Publisher: Elsevier BV
Date: 06-2022
Publisher: Elsevier BV
Date: 06-2023
Publisher: Elsevier BV
Date: 06-2023
Publisher: Oxford University Press (OUP)
Date: 09-01-2018
Publisher: Elsevier BV
Date: 06-2022
Publisher: Public Library of Science (PLoS)
Date: 14-11-2014
Publisher: Elsevier BV
Date: 06-2020
Publisher: Elsevier BV
Date: 09-2016
DOI: 10.1016/J.THERIOGENOLOGY.2016.03.040
Abstract: The low efficiency of interspecies somatic cell nuclear transfer (iSCNT) makes it necessary to investigate new strategies to improve embryonic developmental competence. Embryo aggregation has been successfully applied to improve cloning efficiency in mammals, but it remains unclear whether it could also be beneficial for iSCNT. In this study, we first compared the effect of embryo aggregation over in vitro development and blastocyst quality of porcine, bovine, and feline zona-free (ZF) parthenogenetic (PA) embryos to test the effects of embryo aggregation on species that were later used as enucleated oocytes donors in our iSCNT study. We then assessed whether embryo aggregation could improve the in vitro development of ZF equine iSCNT embryos after reconstruction with porcine, bovine, and feline ooplasm. Bovine- and porcine-aggregated PA blastocysts had significantly larger diameters compared with nonaggregated embryos. On the other hand, feline- and bovine-aggregated PA embryos had higher blastocyst cell number. Embryo aggregation of equine-equine SCNT was found to be beneficial for embryo development as we have previously reported, but the aggregation of three ZF reconstructed embryos did not improve embryo developmental rates on iSCNT. In vitro embryo development of nonaggregated iSCNT was predominantly arrested around the stage when transcriptional activation of the embryonic genome is reported to start on the embryo of the donor species. Nevertheless, independent of embryo aggregation, equine blastocyst-like structures could be obtained in our study using domestic feline-enucleated oocytes. Taken together, these results reported that embryo aggregation enhance in vitro PA embryo development and embryo quality but effects vary depending on the species. Embryo aggregation also improves, as expected, the in vitro embryo development of equine-equine SCNT embryos however, we did not observe positive effects on equine iSCNT embryo development. Among oocytes from domestic animals tested in our study, the feline ooplasm might be the most appropriate recipient to partially allow preimplantation embryo development of iSCNT equine embryos.
Publisher: Public Library of Science (PLoS)
Date: 19-02-2016
Publisher: Elsevier BV
Date: 06-2020
Publisher: Wiley
Date: 07-2016
DOI: 10.1002/MRD.22677
Publisher: CSIRO Publishing
Date: 2013
DOI: 10.1071/RDV25N1AB35
Abstract: Somatic donor cells play a major role during the NT procedure. In vitro culture conditions may affect the capability of these cells to be reprogrammed and to allow embryo development. The aim of this study was to evaluate the effect of in vitro culture at low (5%) or atmospheric (20%) oxygen tension in somatic donor cells for cloned equine embryo production. Adult fibroblasts were obtained through culture of minced tissue from neck biopsies of one horse skin. They were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and 1% antibiotics in 2 groups: (1) 5% CO2 and (2) 5% CO2 and 5% O2, both groups in humidified air at 39°C. Quiescence of donor cells was induced by growth to confluency for 3 to 5 days prior to NT. Oocyte collection, maturation, cloning, and activation procedures were performed as described by Gambini et al. (2012 Biol. Reprod. 87, 1–9.). After activation, reconstructed embryos (RE) were cultured in DMEM/F12 supplemented with 5% FBS in the well of the well system as 3 reconstructed embryos per well. Cleavage and blastocyst formation (7–8 days) of the experimental groups were assessed. In vitro development, on a per-well and RE basis, was compared using the chi-square test. No statistical differences were observed in cleavage [(1): 48/84, 57% (2): 54/87, 62%). No difference was observed in blastocyst rates on a per-well basis [(1): 5/28, 18% (2): 4/29, 14%] or on a per-RE basis [(1): 5/84, 6% (2): 4/87, 5%]. This work suggests that the oxygen tension during the in vitro culture of somatic donor cells does not affect the quantity of the cloned equine blastocyst produced. Further studies are required to determine if these conditions would affect in vivo embryo development.
Publisher: CSIRO Publishing
Date: 2011
DOI: 10.1071/RDV23N1AB123
Abstract: Development of cloned equine embryo is still inefficient. The aim of our study was to assess the aggregation of zona-free genetically identical cloned embryos as a strategy to improve in vitro and in vivo development. Oocyte collection, maturation, cloning, and activation procedures were performed as described by (Lagutina et al. 2007 Theriogenology 67, 90–98). After activation, reconstructed embryos (RE) were cultured in DMEM/F12 with 5% of FBS in the well of well system in 3 different groups: I, only one RE per well II, two RE per well and III, three RE per well. Cleavage and blastocyst formation (7 to 8 days) of all experimental groups was assessed. At day 8, some embryos of each group were either fixed to determine Oct-4 expression by immunocytochemistry or transferred transcervically to a synchronized mare. Pregnancies were assessed by ultrasound from 7 days after embryo transfer until day 45 to 50 of pregnancy every 7 to 10 days, and sizes of vesicles and embryos were measured. In advanced pregnant mares, combined thickness of the uterus and the placenta (CTUP) and serum progesterone levels were also determined. The remaining embryos obtained from each group were maintained in culture from day 7 until day 15. Blastocysts growth was determined every 24 h. In vitro development, on a per-well and RE basis, was compared using the chi-square test. Statistical differences were observed in cleavage among groups I and II (P = 0.0088) and groups I and III (P = 0.0004): (I: 91/111, 82% II: 74/78, 95% III: 62/62, 100%). Blastocyst rates differed between groups I and III (I: 10/111, 9% III: 23/62, 37%) no difference was observed with group II (11/78, 14%). There was no difference on blastocyst rates based on the number of aggregated RE (I: 10/111, 9% II: 11/156, 7% III: 23/184, 12.5%). The highest pregnancy rate was obtained in group III (I: 1/3, 33% II: 2/5, 40% III: 3/4, 75%). Sizes of vesicles and embryos did not differ statistically in such groups. The CTUP and serum progesterone levels were considered normal ( .2 cm ng mL–1, respectively) in ongoing pregnancies. We did not observe any differences in Oct-4 expression patterns among groups. Even though statistical differences were found, surprisingly all embryos grew in vitro until day 15 with good rates and the biggest embryo reached 4.25 mm. Embryo aggregation improved in vitro development of equine cloned embryos until day 7, and pregnancies rates were higher. The in vivo sizes of vesicles and embryos were normal for all groups, and in vitro development beyond day 7 showed the high viability of embryos. To conclude, aggregation of cloned equine embryo does not imply extra oocytes because there is no statistical difference in the number of blastocysts obtained per oocytes used to achieve RE. It is also a good strategy to improve in vitro embryo development without alterations on in vivo progress. This is the first report of pregnancies from aggregated equine cloned embryos, and the first healthy cloned foal from South America, confirmed by STR analysis, was born recently derived from group II. Stumpo, Ignacio, Paola Barboza, and Don Antonio staff.
Publisher: CSIRO Publishing
Date: 2019
DOI: 10.1071/RD19239
Abstract: Epigenetic perturbations during the reprogramming process have been described as the primary cause of the low efficiency of somatic cell nuclear transfer (SCNT). In this study, we tested three strategies targeting nuclear reprogramming to investigate effects on equine SCNT. First, we evaluated the effect of treating somatic cells with chetomin, a fungal secondary metabolite reported to inhibit the trimethylation on histone 3 lysine 9 (H3K9 me3). Second, caffeine was added to the culture medium during the enucleation of oocytes and before activation of reconstructed embryos as a protein phosphatase inhibitor to improve nuclear reprogramming. Third, we tested the effects of the histone deacetylase inhibitor trichostatin A (TSA) added during both activation and early embryo culture. Although none of these treatments significantly improved the developmental rates of the invitro aggregated cloned equine embryos, the first equine cloned foal born in Australia was produced with somatic cells treated with chetomin. The present study describes the use of chetomin, caffeine and TSA for the first time in horses, serving as a starting point for the establishment of future protocols to target epigenetic reprogramming for improving the efficiency of equine cloning. Cloning is an expensive and inefficient process, but has gained particular interest in the equine industry. In this study we explored different strategies to improve cloning efficiency and produced the first cloned foal born in Australia. Our data serve as a starting point for the establishment of future protocols for improving equine cloning efficiency.
Publisher: CSIRO Publishing
Date: 2012
DOI: 10.1071/RDV24N1AB203
Abstract: Intracytoplasmic sperm injection (ICSI) is an alternative method for producing in vitro-fertilized embryos in horses. Some authors have suggested that using the piezo drill to inject the spermatozoon is required to obtain acceptable blastocyst rates after ICSI. In order to avoid the use of this equipment, the aim of our study was to evaluate 4 different chemical activation protocols and their effect on embryo development. Cumulus–oocyte complexes were recovered from ovaries of slaughtered mares. The maturation medium was DMEM/F12 supplemented with 10% fetal bovine serum (FBS), 1 μL mL–1 of insulin-transferrin-selenium, 1 mM sodium pyruvate, 100 mM cysteamine and 0.1 mg mL–1 of FSH at 39°C in a humidified atmosphere of 6.5% CO2 in air for 24 h. The ICSI was carried out in 20-μL droplets of TALP-HEPES with a 9-μm pipette, using frozen-thawed spermatozoa from 1 stallion. Spermatozoa were held separate in 100-μL droplets of Modified Whittens. Motile spermatozoa were aspirated and transferred to a 5-μL drop of 7% (v/v) polyvinylpyrrolidone, where 1 sperm was immobilized by swiping the injection pipette across its tail then, the sperm was injected into the oocyte. All injected oocytes were subjected to 8.7 μM ionomycin for 4 min, followed by 1 of 3 further activation treatments: (1) 4-h culture in 1 mM 6-DMAP and 10 mg mL–1 of cycloheximide, starting 3 h after ionomycin (2) 5-h culture in 10 mg mL–1 of cycloheximide, starting 10 min after ionomycin (3) An extra incubation with 5 mM ionomycin for 4 min, starting 3 h after ionomycin. Some injected oocytes were left without a further activation protocol (group 4). After activation, injected oocytes were cultured in 100-μL droplets of DMEM/F12 with 5% of FBS at 39°C in a humidified atmosphere of 5% O2, 5% CO2 and 90% N2. Cleavage (48 h after activation) and blastocyst formation (7–8 days) of all experimental groups were assessed. Culture medium was renewed on Day 3 with fresh DMEM/F12 with 5% of FBS. At Day 9, the zona pellucida of some blastocysts was removed and the blastocysts were maintained in culture until Day 15. Blastocyst growth was determined every 24 h. Statistical differences (using chi-square analysis) were observed in cleavage with treatments 1 and 3 when compared to the other groups (1: 30/52, 58% 2: 8/40, 20% 3: 9/25, 36% and 4: 10/38, 26%). There was no difference on blastocyst rates based on injected oocytes (1: 5/52, 9.6% 2: 2/40, 5% 3: 1/25, 4% and 4: 2/38, 5.3%). On Day 7, blastocyst quality did not differ among treatments and on Day 15, blastocysts from groups 3 and 4 reached 1130 μm and 4300 μm, respectively. Despite the difference observed in cleavage, this work suggests that equine blastocysts could be obtained with all of the activation protocols, without the use of the piezo drill. Further studies are required to assess the effect of chemical activation on in vivo development of produced blastocysts to confirm that they are not parthenogenetic. We are grateful to Mr. Willem Melchior, La Vanguardia Polo Club for some financial support and encouragement to undertake this project.
Publisher: Elsevier BV
Date: 06-2023
Publisher: CSIRO Publishing
Date: 2010
DOI: 10.1071/RDV22N1AB53
Abstract: The availability of viable equine oocytes is a limiting factor on in vitro embryo production therefore, it is necessary to assess some of the variables that affect oocyte viability. The aim of our study was to evaluate one of those variables: the effect of time between the collection of the ovary and oocyte in vitro maturation. Ovaries of slaughtered mares were collected during the breeding season (Argentine, Southern hemisphere). They were separated in bags every half hour and treated separately after arriving at the laboratory. COCs were recovered by a combination of scraping and washing of all visible follicles with a syringe filled with DMEM supplemented with 1 mM sodium pyruvate and 15 IU mL-1 heparin. COCs were matured for 24 to 26 h in 3 groups, according to time interval: 4 to 7 (group I), 7 to 10 (II), and 10 to 12 (III) hours. The medium for maturation was TCM-199 supplemented with 10% fetal bovine serum (FBS), 1 μL mL-1 insulin-transferrin-selenium, 1 mM sodium pyruvate, 100 mM cysteamine, and 0.1 mg mL-1 of FSH at 39°C in a humidified atmosphere of 5% CO2 in air. The cumulus was removed by a trypsin treatment and vortexing in hyaluronidase (1 mg mL-1). Cloning and fusion procedures were performed following the zona-free technique described by Lagutina et al. (2007 Theriogenology 67, 90-98). Two experiments were carried out by using different activation protocols. In experiment 1, the activation process was 22 mM ionomycin in H-TALP for 4 min followed by 3h culture in 1.9 mM 6-DMAP in SOF, whereas in experiment 2, we used 8.7 mM ionomycin in H-TALP for 4 min followed by 4 h culture in 1 mM 6-DMAP and 10 mg mL-1 cycloheximide in SOF. Embryos were cultured in wells of well (WOW) system. Half of the medium was renewed on Day 3 with fresh SOF and on Day 5 with DMEM/F12 with 10% FBS. Cleavage was assessed 48 h after activation the rate of blastocyst formation was recorded at Days 8 and 9. Results were compared using chi-square test (P 0.05). In experiment 1, maturation rates were significantly different between group I (n = 135, 54.1%) and III (n = 94, 40.4%), group II did not differ from them (n = 138, 53%). Cleavage rates differed statistically between II (n = 44, 75%) and III (n = 27, 40.7%), but not with group I (n = 53, 98%). No significant differences were found in blastocyst development however, we observed a certain tendency towards an increase in the blastocyst rate as the time interval was lower (I: 3/53, 5.7% II: 1/44, 2.3% III: 0/27, 0%). In experiment 2, there were no significant differences between group I and II in rates of maturation (n = 56, 59% v. n = 111, 44.5%), cleavage (n = 22, 91% v. n = 34, 82%) or blastocyst rates (1/22, 4.5% v. 7/34, 20.6%). We conclude that cloned equine embryo development, using the two activation protocols tested, is not affected when the time interval between ovary collection and oocyte IVM is within 4 to 10 h.
Publisher: CSIRO Publishing
Date: 2018
DOI: 10.1071/RD17374
Abstract: Interest in equine somatic cell nuclear transfer technology has increased significantly since the first equid clones were produced in 2003. This is demonstrated by the multiple commercial equine cloning companies having produced numerous cloned equids to date worldwide, more than 370 cloned horses have been produced in at least six different countries. Equine cloning can be performed using several different approaches, each with different rates of success. In this review we cover the history and applications of equine cloning and summarise the major scientific advances in the development of this technology in horses. We explain the advantages and disadvantages of different procedures to produce cloned equine embryos and describe the current status of equine clone commercialisation, along with observations of differences in regional breed association registration regulations.
Publisher: MDPI AG
Date: 30-08-2023
DOI: 10.3390/ANI13172761
Abstract: We are delighted to present this Special Issue, which is dedicated to the paramount subject of gametes and embryo selection and conservation for improving Assisted Reproductive Technologies (ARTs) [...]
Publisher: CSIRO Publishing
Date: 2013
DOI: 10.1071/RDV25N1AB151
Abstract: Commercial horse embryo transfer centers in certain parts of the world are in need of different procedures to streamline their production, for instance, by transferring only sexed embryos. A possible method to do so is PCR sex determination of biopsied embryos. The aim of this study was to (1) evaluate the impact of embryo biopsy on pregnancy rates with regard to embryo size and (2) assess the feasibility of determining the sex of the embryo with that s le. Horse embryos were produced by artificial insemination. Embryos were recovered by transcervical uterine flush on day 7 after ovulation, packaged in a warm insulated container in holding medium and shipped for a 1-hour transit to the laboratory. Upon arrival, embryos were measured using an eyepiece. Embryos were classified into three different groups based on their size: I, 150–350 µm II, 350–550 µm III, µm (the largest being 1316 µm). Biopsy was performed on the lid of a 60-mm petri dish filled with 4 mL of TALP-H on an inverted microscope. Embryos were held with a holding pipette and biopsied with a 15 ± 5 µm pipette with a 45° angle and a spike. Trophoblastic cells were aspirated (5–15 cells) and then placed in a 5-µL drop of TALP-H. S les were placed in a 0.5-mL tube and frozen for PCR sex determination analysis. Biopsied embryos were shipped back to the center in 1-mL equilibrated DMEM/F12 with 10% FBS and 1% antiobiotic-antimycotic. Each embryo was immediately transferred transcervically to a synchronized recipient mare. Pregnancies were evaluated by transrectal ultrasound 7 days post-transfer and reassessed at Day 60. A nested PCR was performed using primers for sex-determining region Y (SRY, 1F ACATACCGTTCTCGGCTCTG, 4R CTTCCGACGAGGTCGATATT, 2R TCTGTGCCTCCTCGAAGAAT, and 3F ATCCCTACTTTGGACGAGCA) and amelogenin (AME, 1F CTTGCAGCCTCATCACCATA, 4R GAGGCAGGTCAGGAAGCATA, 2R GAATATCGGAGGCAGAGGTG, and 3F AACCAATGATGCCACTTCCT) to determine the sex of the embryo. The PCR products were evaluated by agarose gel. The presence of both products indicated that the embryo was male and the presence of amelogenin only that was female. No differences in amelogenin licon size between both sexes were detected. Results were compared using chi-square test (P 0.05). No statistical differences were observed in pregnancy rates among groups (I: 13/22, 59.1% II: 15/20, 75% III: 10/19, 52.6%), although a slight tendency was observed towards an increase in the pregnancy rate when group II embryos were biopsied compared to group III (P = 0.14). Successful sex determination showed statistical differences between group II and the others (I: 10/22, 45.5% II: 16/20, 80% III: 8/19, 42.1%), given that more embryos from group II could be sexed. This work suggests that horse embryo viability after damaging the capsule is independent of the size of the embryo before the biopsy, although it might be easier to collect a proper s le of trophoblastic cells from embryos between 350 and 550 µm to determine their sex since smaller embryos collapsed rapidly during aspiration, and trophoblastic cells are tightly attached to one another in larger embryos.
Publisher: CSIRO Publishing
Date: 2012
DOI: 10.1071/RDV24N1AB14
Abstract: The low number of horse slaughterhouses is one of the reasons for the limited availability of horse oocytes for research in cloning. The aim of our study was to assess the capability of equine, bovine, porcine, or feline ooplast to produce cloned embryos when equine cells are used as donor nuclei and to evaluate if embryo aggregation improves their development. Oocytes from mentioned species were collected from ovaries derived from slaughterhouses, except for cat ovaries that were obtained from ovariectomized queens. Oocytes were matured in TCM199 supplemented following standard protocols for each species. After maturation, cumulus and zona pellucida were removed. Enucleation was performed by aspiration of the metaphase plate under ultraviolet light. Donor cell and ooplast were attached by phytohemagglutinin treatment and then electrofused. Activation protocols were ionomycin for 4 min, except for porcine, which were electrically activated, followed by culture in 1.9 mM 6-DMAP for bovine, feline and porcine, except for equine: 1 mM 6-DMAP with 5 mg mL–1 of cycloheximide. Reconstructed embryos (RE) were cultured in SOF in the well of well system in 2 different groups: only one RE per well (1X) and three RE per well (3X, aggregated embryos, AE). Blastocysts derived from homospecific clones were transferred to synchronized mares. Cleavage and maximum development stage achieved of all experimental groups were assessed. In vitro development was compared using the chi-square test. In group 1X, a total of 64, 49, 38 and 145 RE were performed for porcine, bovine, feline and equine, respectively and in group 3X, 88, 48, 48 and 195 RE. Cleavage of cloned embryos ranged from 67 to 87%. Aggregated of homospecific equine clones showed the highest blastocyst rates (1X: 5.5%, 3X: 34%) and after embryo transfer (4 recipients for each group), an ongoing pregnancy (day 300, at the time of submission) was only achieved with aggregated embryo confirming the positive effect of embryo aggregation in these clones. The stages with higher developmental arrest of heterospecific nonaggregated embryos were 2 to 4 cells for porcine ooplast (23/64, 36%) and 4 to 8 cells for bovine and feline ooplast (37/49, 75% and 18/38, 47%, respectively). Blastocyst stage was only reached using feline ooplast (group I: 2/38, 5.26% and group II: 2/16, 12.5%). Heterospecific aggregated clones were able to achieve 16-cell stage, showing statistic differences compared with group 1X. As we reported previously, embryo aggregation shows benefits for homospecific equine clones, although more studies are needed to clarify if aggregation of heterospecific clones has the same effect. All heterospecific ooplasm was able to support embryo development. The stage of major developmental arrests was similar to embryonic genomic activation stage. Our results suggest that cat oocyte seems to be the best receptor to support equine cloned embryo development.
Publisher: Oxford University Press (OUP)
Date: 07-2012
DOI: 10.1095/BIOLREPROD.112.098855
Abstract: The production of cloned equine embryos remains highly inefficient. Embryo aggregation has not yet been tested in the equine, and it might represent an interesting strategy to improve embryo development. This study evaluated the effect of cloned embryo aggregation on in vitro and in vivo equine embryo development. Zona-free reconstructed embryos were in idually cultured in microwells (nonaggregated group) or as 2- or 3-embryo aggregates (aggregated groups). For in vitro development, they were cultured until blastocyst stage and then either fixed for Oct-4 immunocytochemical staining or maintained in in vitro culture where blastocyst expansion was measured daily until Day 17 or the day on which they collapsed. For in vivo assays, Day 7-8 blastocysts were transferred to synchronized mares and resultant vesicles, and cloned embryos were measured by ultrasonography. Embryo aggregation improved blastocyst rates on a per well basis, and aggregation did not imply additional oocytes to obtain blastocysts. Embryo aggregation improved embryo quality, nevertheless it did not affect Day 8 and Day 16 blastocyst Oct-4 expression patterns. Equine cloned blastocysts expanded and increased their cell numbers when they were maintained in in vitro culture, describing a particular pattern of embryo growth that was unexpectedly independent of embryo aggregation, as all embryos reached similar size after Day 7. Early pregnancy rates were higher using blastocysts derived from aggregated embryos, and advanced pregnancies as live healthy foals also resulted from aggregated embryos. These results indicate that the strategy of aggregating embryos can improve their development, supporting the establishment of equine cloned pregnancies.
Publisher: Bioscientifica
Date: 05-2021
DOI: 10.1530/REP-20-0589
Abstract: Heterospecific embryo transfer of an endangered species has been carried out using recipients from related domestic females. Aggregation of an embryo from an endangered species with a tetraploid embryo from the species to be transferred could improve the development of pregnancy to term. The main objective of the present study was to analyze embryo aggregation in domestic cat model using hybrid embryos. For this purpose, we compared in vitro development of synchronic (Sync) or asynchronic (Async) and asynchronic with a tetraploid (Async4n) aggregation of domestic cat IVF embryos. Furthermore, aggregated blastocyst quality was analyzed by evaluation of the total cell number, cell allocation by mitotrackers staining of embryonic cells, expression of Oct4 , Nanog , Sox2 , Cdx2 genes, number of OCT4+ nuclei, and presence of DNA fragmentation. Additionally, the developmental rates of Async4n aggregation of domestic cat with Leopardus geoffroyi hybrid ( hLg ) embryos were evaluated. Async aggregation increased blastocyst cell number and the number of OCT4+ nuclei as compared to non-aggregated diploid (2n) and tetraploid (4n) embryos. Moreover, blastocysts produced by Async4n aggregation showed reduced rates of fragmented DNA. No differences were found in the expression of the pluripotent genes, with exception of the Cdx2 expression, which was higher in 4n and aggregated embryos as compared to the control group. Interestingly, hybrids embryos derived by Async4n aggregation with domestic cat embryos had similar rates of blastocysts development as the control. Altogether, the findings support the use of two-cell-fused embryos to generate tetraploid blastomeres and demonstrate that Async4n aggregation generates good quality embryos.
Publisher: Wiley
Date: 05-2022
DOI: 10.1002/MRD.23615
Abstract: The transfer of nuclear genomic DNA from a cell to a previously enucleated oocyte or zygote constitutes one of the main tools for studying epigenetic reprogramming, nucleus–cytoplasm compatibility, pluripotency state, and for genetic preservation or edition in animals. More than 50 years ago, the first experiences in nuclear transfer began to reveal that factors stored in the cytoplasm of oocytes could reprogram the nucleus of another cell and support the development of an embryo with new genetic information. Furthermore, when the nuclear donor cell is an oocyte, egg, or a zygote, the implementation of these technologies acquires clinical relevance for patients with repeated failures in ART associated with poor oocyte quality or mitochondrial dysfunctions. This review describes the current state, scope, and future perspectives of nuclear transfer techniques currently available for assisting mammal reproduction.
Publisher: MDPI AG
Date: 16-12-2022
DOI: 10.3390/ANI12243560
Abstract: After sperm-oocyte fusion, intracytoplasmic rises of calcium (Ca) induce the release of zinc (Zn) out of the oocyte (Zn sparks). Both phenomena are known to play an essential role in the oocyte activation process. Our work aimed to explore different protocols for activating bovine and porcine oocytes using the novel zinc chelator 1,10-phenanthroline (PHEN) and to compare developmental rates and quality to bovine IVF and parthenogenetic ionomycin-induced embryos in both species. Different incubation conditions for the zinc chelator were tested, including its combination with ionomycin. Embryo quality was assessed by immunofluorescence of SOX2, SOX17, OCT4, and CDX2 and total cell number at the blastocyst stage. Even though blastocyst development was achieved using a zinc chelator in bovine, bypassing calcium oscillations, developmental rates, and blastocyst quality were compromised compared to embryos generated with sperm-induced or ionomycin calcium rise. On the contrary, zinc chelation is sufficient to trigger oocyte activation in porcine. Additionally, we determined the optimal exposure to PHEN for this species. Zinc chelation and artificial induction of calcium rise combined did not improve developmental competence. Our results contribute to understanding the role of zinc during oocyte activation and preimplantation embryo development across different mammalian species.
Publisher: Oxford University Press (OUP)
Date: 02-2014
Abstract: The current limitations for obtaining ovaries from slaughterhouses and the low efficiency of in vivo follicular aspiration necessitate a complete understanding of the variables that affect oocyte developmental competence in the equine. For this reason, we assessed the effect on equine oocyte meiotic competence and the subsequent in vitro cloned embryo development of 1) the time interval between ovary collection and the onset of oocyte in vitro maturation (collection-maturation interval time) and 2) the pregnancy status of the donor mares. To define the collection-maturation interval time, collected oocytes were classified according to the slaughtering time and the pregnancy status of the mare. Maturation rate was recorded and some matured oocytes of each group were used to reconstruct zona free cloned embryos. Nuclear maturation rates were lower when the collection-maturation interval time exceeded 10 h as compared to 4 h (32/83 vs. 76/136, respectively P = 0.0128) and when the donor mare was pregnant as compared to nonpregnant (53/146 vs. 177/329, respectively P = 0.0004). Low rates of cleaved embryos were observed when the collection-maturation interval time exceeded 10 h as compared to 6 to 10 h (11/27 vs. 33/44, respectively P = 0.0056), but the pregnancy status of donor mares did not affect cloned equine blastocyst development (3/49 vs. 1/27 for blastocyst rates of nonpregnant and pregnant groups, respectively P = 1.00). These results indicate that, to apply assisted reproductive technologies in horses, oocytes should be harvested within approximately 10 h after ovary collection. Also, even though ovaries from pregnant mares are a potential source of oocytes, they should be processed at the end of the collection routine due to the lower collection and maturation rate in this group.
Publisher: Public Library of Science (PLoS)
Date: 11-09-2020
Publisher: Elsevier BV
Date: 2023
DOI: 10.1016/J.THERIOGENOLOGY.2022.10.030
Abstract: Equus members exhibit very ergent karyotype, genetic plasticity, and significant differences in their reproductive physiology. Despite the fact that somatic cell nuclear transfer and intracytoplasmic sperm injection (ICSI) has gained relevance in the last few years in horses, few reports have been published exploring ovum pick up (OPU) and in vitro maturation (IVM) of cumulus-oocyte complexes (COCs) in donkeys. Yet, some donkey species and breeds are considered endangered, and these assisted-reproductive technologies could help to preserve the genetic of valuable in iduals. In this study, we tested the hypothesis that supplementation with jenny preovulatory follicular fluid (PFF) during IVM could improve oocyte developmental competence in the donkey. For this, in vitro nuclear maturation rates, cumulus cell expansion, and embryo development after ICSI of donkey COCs matured in culture media supplemented with fetal bovine serum (FBS) or donkey PFF, with a known metabolomic profile, were assessed. Time-lapse imagining was performed after ICSI of horse and donkey oocytes. Eight OPU sessions were done in five jennies with an average recovery rate of 69.2% (n = 45 COCs). Although lower cumulus cells expansion was observed in oocytes of PFF group (P = 0.0010), no significant differences were described in nuclear maturation rates and preimplantation embryo development between groups. Donkey ICSI embryos showed similar morphokinetics to horse ICSI embryos. Our study shows that supplementing IVM media with FBS or donkey PFF supports nuclear maturation and early preimplantation embryo development after ICSI in donkeys. To our knowledge, the present study is the first report of ICSI, time-lapse imaging and in vitro blastocyst production in donkey.
Publisher: CSIRO Publishing
Date: 2019
DOI: 10.1071/RD19248
Abstract: Assisted reproduction techniques (ARTs) have become widespread in the equine breeding industry. In particular, the combination of oocyte recovery from live mares followed by IVM and intracytoplasmic sperm injection (ICSI) has increased markedly among the ARTs used with valuable or low-fertility animals. There is currently no consensus among research groups regarding the optimal oocyte maturation period to produce high-quality embryos. In this study, we report the maturation dynamics of equine oocytes at different time points, from 20 to 40h (Experiment 1). In addition, in Experiment 2, equine ICSI blastocysts were produced from oocytes that exhibited early (up to 24h) or late (28–30h) extrusion of the first polar body (PB). Blastocyst rates and diameter were recorded and embryo quality was assessed by analysing the number of apoptotic cells and Yes-associated protein 1 (YAP1) expression. By 20h of IVM, 42% of oocytes were mature, and the remaining oocytes matured within the next 17h of IVM. Although no differences were found in cell apoptosis or the number of YAP1-positive cells between groups exhibiting early and late PB extrusion, embryos from the early group (Group I) exhibited an improved total cell number and blastocyst rate compared to embryos from the late group (Group II) (18.60% vs 10.17% respectively).
Location: Argentina
Start Date: 2019
End Date: 2022
Funder: Secretaria de Ciencia y Tecnología - Universidad Nacional de Córdoba
View Funded ActivityStart Date: 2020
End Date: 2023
Funder: Agencia Nacional de Promoción Científica y Tecnológica
View Funded ActivityStart Date: 2019
End Date: 2022
Funder: Agencia Nacional de Promoción Científica y Tecnológica
View Funded Activity