ORCID Profile
0000-0002-5940-4769
Current Organisation
University of Queensland
Does something not look right? The information on this page has been harvested from data sources that may not be up to date. We continue to work with information providers to improve coverage and quality. To report an issue, use the Feedback Form.
Publisher: American Chemical Society (ACS)
Date: 20-07-2018
Abstract: The use of emerging nanotechnologies, such as plasmonic nanoparticles in diagnostic applications, potentially offers opportunities to revolutionize disease management and patient healthcare. Despite worldwide research efforts in this area, there is still a dearth of nanodiagnostics which have been successfully translated for real-world patient usage due to the predominant sole focus on assay analytical performance and lack of detailed investigations into clinical performance in human s les. In a bid to address this pressing need, we herein describe a comprehensive clinical verification of a prospective label-free surface-enhanced Raman scattering (SERS) nanodiagnostic assay for prostate cancer (PCa) risk stratification. This contribution depicts a roadmap of (1) designing a SERS assay for robust and accurate detection of clinically validated PCa RNA targets (2) employing a relevant and proven PCa clinical biomarker model to test our nanodiagnostic assay and (3) investigating the clinical performance on independent training ( n = 80) and validation ( n = 40) cohorts of PCa human patient s les. By relating the detection outcomes to gold-standard patient biopsy findings, we established a PCa risk scoring system which exhibited a clinical sensitivity and specificity of 0.87 and 0.90, respectively [area-under-curve of 0.84 (95% confidence interval: 0.81-0.87) for differentiating high- and low-risk PCa] in the validation cohort. We envision that our SERS nanodiagnostic design and clinical verification approach may aid in the in idualized prediction of PCa presence and risk stratification and may overall serve as an archetypical strategy to encourage comprehensive clinical evaluation of nanodiagnostic innovations.
Publisher: Springer Science and Business Media LLC
Date: 20-01-2015
DOI: 10.1038/CR.2015.8
Publisher: Wiley
Date: 08-1981
DOI: 10.1038/ICB.1981.44
Abstract: A human melanoma cell line (MM253) was found to be sensitive to ultraviolet (UV) radiation, having a Do of 1.0 J/M2 when cloned on plastic culture dishes and a Do of 2.3 J/m2 when cloned in agar. These figures are much lower than those obtained for all other human melanoma cell lines studied in this laboratory (Do of 32-40 J/m2) and demonstrate that MM253 is unusually UV sensitive. The increased level of UV sensitivity in MM253 is not due to a reduced capacity for excision of pyrimidine dimers, repair of DNA single-strand breaks or elongation of newly-synthesized DNA strands when comparison is made with a UV-resistant melanoma cell line.
Publisher: Oxford University Press (OUP)
Date: 1981
DOI: 10.1093/NAR/9.6.1395
Abstract: The effect of increasing dose of gamma-radiation on DNA synthesis in an ataxia telangiectasia lymphoblastoid cell line and a number of control lymphoblastoid cell lines was investigated. No significant inhibition of low molecular weight DNA synthesis was observed in the AT cell line at doses which resulted in considerable inhibition in the control cell lines. At higher doses, 600 to 800 rad, low molecular weight DNA synthesis and chain elongation were enhanced in the AT cell line. At time course study of DNA synthesis after 200 rads of gamma-radiation, revealed no appreciable inhibition of low and high molecular weight DNA synthesis up to 60 minutes postirradiation. However, in control cell lines, overall DNA synthesis was depressed to a level 50% of that shown by the unirradiated cells.
Publisher: Elsevier BV
Date: 11-1989
DOI: 10.1016/0378-1135(89)90015-1
Abstract: DNA-slot hybridization and immuno-slot blot analyses were compared for the detection of Chlamydia psittaci in crude swab material from free-ranging koalas. Immuno-slot blot analysis detected chlamydiae in 43 out of 68 koalas, with the sensitivity of the assay varying from 52 to 73% depending on the site of infection. Gene probe analysis was also used employing a genus-specific probe pCKO-10 isolated from a koala chlamydial gene library (ocular strain) and a plasmid probe pCKU cloned from a urogenital strain. The sensitivity of these two assays was comparable and they were considerably more efficient than the immuno-slot blot method for the detection of chlamydiae. Comparison of these data with a cell-culture method of detection, previously used with the same s les, demonstrated that gene probe analysis detected more positives than observed with cell culture. However, this appears to reflect more on the condition of the swab material rather than the sensitivity of the method.
Publisher: Springer New York
Date: 2017
DOI: 10.1007/978-1-4939-6955-5_2
Abstract: During S-phase the cell replicates its DNA which is critical to maintaining the integrity of the genome and cell survival amidst damaging events. The cell is equipped with a series of checkpoints to slow progress throughout the cycle and facilitate DNA repair. Ataxia telangiectasia mutated (ATM), defective in the human genetic disorder ataxia-telangiectasia (A-T), is the key to initiating a signaling cascade activating the intra-S-phase checkpoint. This was first identified in A-T cells as radioresistant DNA synthesis using
Publisher: Informa UK Limited
Date: 10-1990
Abstract: DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.
Publisher: Elsevier BV
Date: 12-2002
DOI: 10.1016/S0300-483X(02)00462-6
Abstract: Several members of the phosphatidylinositol 3-kinase family play key roles in recognising and responding to damage in DNA, induced by a variety of chemicals and other agents. One of these, ATM, the product of the gene mutated in the human genetic disorder ataxia-telangiectasia (A-T), recognises double strand breaks in DNA caused by ionizing radiation and radiomimetic chemicals. In order to study DNA damage recognition and the abnormalities of genome instability and cancer predisposition that occur in A-T patients, we generated a mouse model expressing a mutant form of Atm corresponding to a common human mutation. In this model, a 9 nucleotide in-frame deletion was introduced into the Atm gene and has been designated Atm-Delta SRI. These animals had a longer lifespan than Atm gene disrupted mice (Atm(-/-)) and they developed less thymic lymphomas. A characteristic of the lymphomas appearing in Atm-Delta SRI mice was an increased rate of apoptosis compared to the corresponding tumours in Atm(-/-) mice. Increased expression of FasL in these tumours may account for the higher levels of apoptosis. These results demonstrate that expression of mutant Atm in mice gives rise to phenotypic differences compared to Atm(-/-) mice and has implications for heterogeneity described in the human syndrome.
Publisher: Elsevier BV
Date: 02-1989
DOI: 10.1016/0006-291X(89)92785-X
Abstract: Anomalies in DNA replication, repair and recombination in ataxia-telangiectasia (A-T) point to a defect in structure or function of chromatin. In this study we have compared DNA-protein binding in nuclear extracts from control and A-T cells using two assay systems, filter-binding and DNA-accessibility. Interestingly, the extent of DNA protein binding over a range of protein concentration was significantly lower in A-T extracts. In addition the accessibility of the restriction enzyme Eco R1 to protein-bound plasmid was greater when A-T extracts were used. This is in keeping with the reduced binding observed in the filter-binding assay.
Publisher: Spandidos Publications
Date: 22-03-2012
Abstract: Glioblastoma multiforme (GBM) is the most common primary brain tumour and extirpation followed by radio- and chemotherapy has had minimal impact on the median survival of patients which is still less than one year. Hence, a novel therapeutic modality is required if the survival of patients with this disease is to be improved. ATM, mutated in the human genetic disorder ataxia-telangiectasia (A-T), plays a central role in the response to DNA double strand breaks and patients with this disorder are characterised by extreme sensitivity to radiation, increased risk of cancer and neurodegeneration. Thus, ATM represents a potential target for radiosensitization of brain tumour cells. A safe, non-replicating lentivirus is used to abrogate ATM in GBM through the antisense and RNAi approaches for radiosensitization. With either techniques, ATM protein was reduced by >90% and there was a 3‑fold sensitization of GBM cells to radiation. ATM protein activation as well as ATM pS1981 foci formation were defective and downstream signalling determined by Ser15 phosphorylation on p53 was reduced. Success in the approaches provides a novel and exciting strategy for the treatment of GBM and thus improving the survival of patients with these tumours.
Publisher: Elsevier BV
Date: 1991
DOI: 10.1016/0034-5288(91)90059-W
Abstract: The early diagnosis of bovine leukosis virus (BLV) infection, the aetiological agent in enzootic bovine leukosis, is important for the implementation of control measures. BLV infection is currently assessed by the detection of circulating antibodies against the viral envelope protein, gp51. However, this approach has shortcomings in the time taken to detect anti-BLV antibodies (three to four weeks after infection), and in the failure to detect antibodies in some animals. Clearly a technique such as the polymerase chain reaction (PCR), which directly detects the presence of viral DNA, has advantages over methods designed to measure host antibodies. The use of PCR for the detection of proviral DNA in an affected DNA s le with as little as 10(-5) micrograms of host DNA using agarose gel electrophoresis followed by ethidium bromide staining is described here. It was possible to improve the sensitivity of this assay by using hybridisation analysis with a BLV gene probe. PCR used in combination with hybridisation analysis will provide a sensitive diagnostic assay to detect BLV when antibody tests give weakly positive or equivocal results.
Publisher: Elsevier BV
Date: 07-1998
DOI: 10.1016/S0360-3016(98)00171-0
Abstract: Severe acute toxicity limits the effective use of radiotherapy in patients who are radiosensitive, and it is not usually possible to identify these radiohypersensitive (R-H) in iduals before treatment commences. Five such R-H patients were detected over a 3-year period. We undertook this study to determine whether the severe acute radiohypersensitivity of these five in iduals showed any correlation with cellular and molecular parameters known to be abnormal in radiosensitivity-related syndromes such as ataxia-telangiectasia (A-T). Lymphoblastoid cells were isolated from fresh blood from the 5 R-H in iduals who had previously demonstrated clinical R-H at least 9 months prior to s ling. Lymphoblastoid cell lines (LCLs) were established to determine the extent of postradiation chromosomal aberrations, cell cycle delay, cell proliferation, and tumor suppressor p53 protein stabilization. The polymerase chain reaction (PCR) and protein truncation (PTT) assays were used to test for the possibility of mutations in the gene mutated in A-T, termed ATM. LCLs derived from R-H subjects retained a significantly higher degree of radiation-induced chromosomal aberrations when compared to normal control LCLs. p53 stabilization by ionizing radiation appeared normal in all but one R-H subject. There was no evidence of A-T gene truncation mutations in any of the R-H subjects tested. All R-H subjects in this study had their cellular radiosensitivity confirmed by the chromosomal aberration assay. Delayed p53 stabilization at 4 hours postirradiation in one R-H subject suggested that different etiologies may apply in the radiohypersensitivity investigated in this study.
Publisher: Wiley
Date: 09-1988
DOI: 10.1111/J.1751-0813.1988.TB16146.X
Abstract: Substance abuse is linked to many new cases of HIV infection. Barriers such as the myth that drug users cannot adhere to HIV/AIDS treatment block progress in curbing the spread of HIV in that population. In this article we explain the need to aggressively seek out high-risk, hard-to-reach substance abusers and to offer them HIV testing, access to treatment, and the necessary support to remain in treatment--both for HIV and for substance abuse. We summarize evidence showing that injection drug users can successfully undergo HIV treatment that many substance abusers adhere to antiretroviral therapy as well as do people who don't inject drugs and that injection drug users who undergo substance abuse treatment are more likely to obtain and stay in treatment for their HIV infection. This evidence makes a strong case for integrating substance abuse treatment with HIV treatment programs and providing substance abusers with universal access to HIV treatment. But an integrated strategy will require changes in the health care system to overcome lingering obstacles that inhibit the merging of substance abuse treatment with HIV programs.
Publisher: Elsevier BV
Date: 1993
DOI: 10.1016/0027-5107(93)90053-I
Abstract: The genetic ersity of a clinically heterogeneous group of ionizing radiation-sensitive human mutants has been examined. In this group, the relationship between ataxia telangiectasia (A-T), Alzheimer's disease (AD) and Down's syndrome (DS) was studied, on the basis of their cellular radiosensitivity. Cell-fusion analysis was used to determine the presence of different complementation groups. In a series of 4A-T, 5AD and 4DS cell lines, 8 complementation groups were documented. These findings suggest that this group of primary neuronal degenerative disorders might have some overlap in their genetic defects.
Publisher: Springer Science and Business Media LLC
Date: 12-2008
DOI: 10.1038/NRM2598
Publisher: Public Library of Science (PLoS)
Date: 17-03-2014
Publisher: Elsevier BV
Date: 06-1996
DOI: 10.1016/S0140-6736(96)91114-9
Abstract: The COVID-19 pandemic has significantly changed the way we treat patients and educate healthcare professionals (HCPs). In summer 2020, the International League against Epilepsy (ILAE) implemented a virtual CME program with three integrated program elements addressing challenges in patient treatment as well as challenges caused by the forced transition to a virtual environment. Despite the highly competitive environment with exponential increase of webinars offered to HCPs, the program achieved high participation and satisfaction rates. Over 60% of participants indicated a change in their clinical practice after the interventions. With our outcomes evaluation, we aimed to better understand how well such an integrated program resonates with the learner and if it can make a difference in a highly competitive environment by supporting educators to become more adaptive and responsive to learner needs. Our pilot project was shown to be well accepted, achieving high satisfaction and perceived impact by the learner. In the light of an upcoming "digital fatigue" and a wish to return to face-to-face, we reiterate the value of the digital approach and recommend continuing along this successful path as we believe that taking a learner on a digital educational journey has been successful in a highly competitive and challenging environment.
Publisher: Informa UK Limited
Date: 1987
DOI: 10.3109/00498258709047181
Abstract: The effects of N-hydroxyphenacetin on DNA function and structure were investigated to elucidate the involvement of phenacetin in analgesic nephropathy and transitional cell carcinoma. N-Hydroxyphenacetin or a metabolite inhibited synthesis of DNA, RNA and protein DNA inhibition was greater at higher pH. No single-strand breaks were detectable in DNA after N-hydroxyphenacetin treatment and no appreciable effect on cell viability was observed at concentrations up to 5 mM. N-Hydroxyphenacetin-induced alteration to chromatin structure was detected using nucleoid sedimentation analysis. Direct binding to plasmid DNA was not observed. These observations are consistent with a role for phenacetin metabolites in renal disease.
Publisher: Elsevier BV
Date: 04-1998
Abstract: The gene mutated in the human genetic disorder ataxia-telangiectasia, ATM, is implicated in the response to radiation-induced DNA damage and to a more widespread signalling defect. The ATM protein is predominantly a nuclear protein where it interacts with p53 and c-Abl as part of a radiation signal transduction pathway(s). We describe here the cloning of full-length ATM cDNA in a baculovirus vector to produce recombinant protein. Expression of ATM, as a soluble protein, was observed by 36 h post-infection using immunoblotting with anti-ATM antibody. The presence of a hexahistidine tag on ATM was used as the basis for purification of the protein by affinity chromatography. The protein yield was only 20 ng/100 ml of infected cells, presumably because of the size of the protein and adverse effects on cell growth when overexpressed. ATM was found to have autophosphorylation activity in immunoprecipitates with antibodies directed against the hexahistidine tag sequence. These results demonstrate that ATM can be expressed inefficiently in baculovirus infected insect cells and the data suggest that it phosphorylates itself.
Publisher: Elsevier BV
Date: 1994
Abstract: In addition to inducing differentiation in several cell types sodium butyrate is cytotoxic to lymphoid cells and causes apoptosis in HL-60 cells. We report here that butyrate treatment of the Burkitt's lymphoma cell line BL-30 causes cell death by apoptosis, as established by nuclear changes and DNA fragmentation. The kinetics of induction of apoptosis by butyrate revealed a considerably delayed response in comparison to that observed with heat treatment. At 4 h after heat (43.5 degrees C) exposure, 50% of the cells were undergoing apoptosis whereas that level of apoptosis was only reached after 16 h of treatment with butyrate (5 mM). Apoptosis induced by both treatments was accompanied by a marked increase in hsp70 mRNA. The maximum response in mRNA preceded a rapid onset of apoptosis in both cases, and the response was transient. There was a corresponding increase in the level of hsp70 protein after exposure to both heat and butyrate which coincided with the pattern of increase in mRNA but protein levels remained high during the onset of apoptosis. The results obtained here provide further evidence for a relationship between differentiation and apoptosis.
Publisher: Elsevier BV
Date: 12-1986
DOI: 10.1016/0165-2427(86)90023-1
Abstract: Epithelial sheets from the limbus, cornea, and third eyelid of Hereford and non-Hereford cattle were examined for the presence of Langerhans cells (LC) using the membrane enzyme ATPase as a marker for LC. The aim of the study was to test the hypothesis that differences in LC density exist between the various ocular epithelia of these animals producing depressed immune surveillance in the case of Hereford cattle. The presence of LC in ocular tissues was confirmed by parallel studies which detected epithelial cells bearing T6, an antigen expressed by human LC. Studies using serial sections demonstrated that T6+ cells also reacted with an anti-human HLA-DR monoclonal antibody. The detection of T6+, DR+ and ATPase+ cells in ocular epithelium in the absence of infiltrating macrophages suggested that LC are present in these tissues. While there were no significant differences in the density of T6+ cells between non-Hereford and Hereford cattle, in the latter ATPase+ cells were significantly fewer in the lateral, medial, and upper limbus.
Publisher: Elsevier BV
Date: 04-1983
DOI: 10.1016/0167-8817(83)90011-1
Abstract: A marked increase in sensitivity to bleomycin was observed in two ataxia telangiectasia (AT) lymphoblastoid cell lines compared to that in cell lines from two normal in iduals. This sensitivity was obtained at two different concentrations of bleomycin. While normal cells showed a rapid recovery of ability to ide, there was no indication of such a recovery in AT cells up to 120 h after bleomycin treatment. A similar level of breakage of DNA occurred in both cell types after incubation with bleomycin. The rate of repair of these breaks was also the same. DNA synthesis was found to be more resistant to bleomycin in AT cells than in control cells. The latter data are in keeping with results previously obtained using ionizing radiation.
Publisher: Hindawi Limited
Date: 10-1989
DOI: 10.1017/S0016672300028524
Abstract: Amongst the four common Ha- ras alleles in both controls and cancer patients, we detected the presence of a polymorphic Xho I site associated specifically with the 6·6 and 7·7 kb Bam HI fragments but absent from the 7·1 and 8·2 kb alleles, as recently reported by others. We have extended this study and report here, the consistent appearance of this Xho I site in unusual alleles close in size to the two common alleles of 6·6 and 7·7 kb, in control lymphoblastoid DNA s les in a variety of tumor DNAs. Unusual alleles grouped around the 7·1 and 8·2 kb common alleles on the other hand, did not possess the Xho I site. The consistent presence of the Xho I site polymorphism, in the unusual Ha- ras alleles surrounding the 6·6 and 7·7 kb common alleles and its absence in alleles around the 7·1 and 8·2 kb common alleles, suggests that the unusual ones are derived from the corresponding common alleles to which they are closest in size.
Publisher: American Society of Hematology
Date: 15-09-1999
DOI: 10.1182/BLOOD.V94.6.1998.418K01_1998_2006
Abstract: Patients with the human genetic disorder ataxia-telangiectasia (A-T) are characterized by immunodeficiency and a predisposition to develop lymphoid malignancies. The gene mutated in A-T patients, ATM, codes for a high molecular weight protein that is implicated in DNA damage recognition and cell cycle control. The ATM protein does not change in amount or cellular distribution throughout the cell cycle or in response to DNA damaging agents. Because peripheral blood mononuclear cells (PBMCs) are largely in a state of quiescence and can be readily stimulated to enter a proliferative phase and because A-T cells exhibit growth abnormalities and senescence, indicative of a general intracellular defect in signalling, we chose PBMCs to examine the relationship of ATM to the proliferative status of the cell. We show here that ATM protein is present at low levels in freshly isolated PBMCs and increases approximately 6-fold to 10-fold in response to a mitogenic stimulus, reaching a maximum after 3 to 4 days. A similar, but delayed response, was evident in the presence of serum only. This increase in ATM protein was accompanied by an increase in ATM kinase activity. While expression of ATM protein increased during proliferation, ATM mRNA expression was unchanged in stimulated and unstimulated cells and there was no evidence for increased ATM protein stability in the phytohemagglutinin (PHA)-treated cells. In keeping with the reduced levels of ATM in quiescent cells, the extent of radiation-induction of the p53 pathway was significantly lower than in mitogen-stimulated cells. Basal levels of p21 were elevated in quiescent cells, and the response to radiation was negligible or reduced compared with proliferating cells over a 2-hour period. Overall, the data suggest that the increase in ATM protein in proliferating cells is due to posttranscriptional regulation and points to a role for ATM in more general signalling.
Publisher: Oxford University Press (OUP)
Date: 1980
Abstract: The effect of ionizing radiation on DNA synthesis in control and ataxia telangiectasia (AT) lymphoblastoid cell lines was determined. A dose dependent decrease in DNA synthesis was observed in control cells, and the rate and extent of thi decrease in synthesis increased with time after irradiation. No decrease in DNA synthesis was obtained in AT cells, immediately following irradiation, at doses up to 400 rads. At longer times postirradiation, inhibition of synthesis increased but the extent of inhibition was less in AT cell than controls at all doses used. An immediate depression of DNA synthesis was evident in control cells after a radiation dose of 200 rads reaching a maximum at 90 min postirradiation. Little or no decrease in DNA synthesis was evident in AT cells up to 60 min after the same radiation dose, but a decrease occurred between 60 and 90 min after irradiation. The rate of recovery of DNA synthesis to normal levels was more rapid in AT cells than in controls.
Publisher: Oxford University Press (OUP)
Date: 1988
Abstract: Considerable evidence supports a defect at the level of chromatin structure or recognition of that structure in cells from patients with the human genetic disorder ataxia-telangiectasia. Accordingly, we have investigated the activities of enzymes that alter the topology of DNA in Epstein Barr Virus-transformed lymphoblastoid cells from patients with this syndrome. Reduced activity of DNA topoisomerase II, determined by unknotting of P4 phage DNA, was observed in partially purified extracts from 5 ataxia-telangiectasia cell lines. The levels of enzyme activity was reduced substantially in 4 of these cell lines and to a lesser extent in the other cell line compared to controls. DNA topoisomerase I, assayed by relaxation of supercoiled DNA, was found to be present at comparable levels in both cell types. Reduced activity of topoisomerase II in ataxia-telangiectasia is compatible with the molecular, cellular and clinical changes described in this syndrome.
Publisher: Informa UK Limited
Date: 1996
Abstract: The molecular basis of radiosensitivity was studied using a cDNA complementation approach to correct radiosensitivity in cells. Four cDNAs of sizes 1.6, 2.0, 2.2 and 2.5 kb were isolated that corrected several aspects of the phenotype of cells from patients with the human genetic disorder ataxia-telangiectasia, characterized by hypersensitivity to ionizing radiation. The criteria used to assess correction included cell viability, induced chromosome aberrations, G2 phase delay and induction of p53 after exposure to radiation. One cDNA (2.5 kb) was identified as the complete sequence of the RNA helicase p68, which was capable of correcting radiosensitivity based on two of the above four criteria, with p53 induction post irradiation being partially corrected. The 2.2 kb cDNA was shown to correspond to the complete sequence of arginyl tRNA synthetase and the other two cDNAs were identical to the 3' untranslated regions (UTR) of the transcription factor TFIIS (1.6 kb) and phospholipase A2 (2.0 kb) respectively. Additional transfections with the 3'UTR (198 nucleotides) of p68 RNA helicase and its inverse sequence revealed that the 3'UTR had the same complementation capacity as the full-length cDNA, whereas the inverse construct failed to complement radiosensitivity. These data provide additional support for a novel role for 3'UTRs in the regulation of gene expression.
Publisher: No publisher found
Date: 2003
Publisher: Springer Science and Business Media LLC
Date: 02-1992
DOI: 10.1007/BF00296522
Publisher: Wiley
Date: 04-1990
DOI: 10.1111/J.1464-410X.1990.TB14752.X
Abstract: A group of 65 patients with superficial bladder carcinoma was followed for 2 years and tumour recurrence rate was correlated both with transferrin receptor status of the initial primary tumour and with the results of voided urine cytology. Nine of 24 patients with transferrin receptor negative tumours had recurrences compared with 30 of 41 patients with transferrin receptor positive tumours. This difference was highly significant. Urine cytology at presentation was also predictive of further tumour formation: of 30 patients who were transferrin receptor positive and had positive urine cytology, 25 developed recurrences.
Publisher: Springer Science and Business Media LLC
Date: 18-01-2001
Abstract: Cells from patients with the genetic disorder ataxia-telangiectasia (A-T) are hypersensitive to ionizing radiation and radiomimetic agents, both of which generate reactive oxygen species capable of causing oxidative damage to DNA and other macromolecules. We describe in A-T cells constitutive activation of pathways that normally respond to genotoxic stress. Basal levels of p53 and p21(WAF1/CIP1), phosphorylation on serine 15 of p53, and the Tyr15-phosphorylated form of cdc2 are chronically elevated in these cells. Treatment of A-T cells with the antioxidant alpha-lipoic acid significantly reduced the levels of these proteins, pointing to the involvement of reactive oxygen species in their chronic activation. These findings suggest that the absence of functional ATM results in a mild but continuous state of oxidative stress, which could account for several features of the pleiotropic phenotype of A-T.
Publisher: Wiley
Date: 04-2001
DOI: 10.1002/DDR.1156
Publisher: Oxford University Press (OUP)
Date: 06-2005
Abstract: A key component of the venom of many Australian snakes belonging to the elapid family is a toxin that is structurally and functionally similar to that of the mammalian prothrombinase complex. In mammals, this complex is responsible for the cleavage of prothrombin to thrombin and is composed of factor Xa in association with its cofactors calcium, phospholipids, and factor Va. The snake prothrombin activators have been classified on the basis of their requirement for cofactors for activity. The two major subgroups described in Australian elapid snakes, groups C and D, are differentiated by their requirement for mammalian coagulation factor Va. In this study, we describe the cloning, characterization, and comparative analysis of the factor X- and factor V-like components of the prothrombin activators from the venom glands of snakes possessing either group C or D prothrombin activators. The overall domain arrangement in these proteins was highly conserved between all elapids and with the corresponding mammalian clotting factors. The deduced protein sequence for the factor X-like protease precursor, identified in elapids containing either group C or D prothrombin activators, demonstrated a remarkable degree of relatedness to each other (80%-97%). The factor V-like component of the prothrombin activator, present only in snakes containing group C complexes, also showed a very high degree of homology (96%-98%). Expression of both the factor X- and factor V-like proteins determined by immunoblotting provided an additional means of separating these two groups at the molecular level. The molecular phylogenetic analysis described here represents a new approach for distinguishing group C and D snake prothrombin activators and correlates well with previous classifications.
Publisher: Elsevier BV
Date: 08-2004
Publisher: Wiley
Date: 06-02-2015
DOI: 10.1111/JPC.12828
Abstract: Ataxia-telangiectasia (A-T) is a rare genomic syndrome resulting in severe disability. Chronic childhood disorders can profoundly influence growth and development. Nutrition-related issues in A-T are not well described, and there are no nutritional guidelines. This study investigated the nutrition-related characteristics and behaviours of Australian A-T patients attending a national clinic. A cross-sectional analysis of 13 A-T patients (nine females aged: 4-23 years): nutritional status was assessed by anthropometric and body cell mass (BCM) calculations. Parents reported their child's diet history and physical and behavioural factors that affect nutrition including fatigue and need for assistance. Ten (77%) had short stature (height for age z scores <-1), and seven (54%) were underweight for height (weight/height z scores <-1). Significant malnutrition (BCM z scores <-2) was detected in nine (69%) including the one adult who was severely malnourished. Malnutrition increased significantly with age (BCM for height z scores and age, r = -0.937, P < 0.001). Eight (62%) patients ate poorly compared with estimated energy requirement for weight. Poor diet quality was characterised by high fat and sugar choices. Parents reported significant nutritional barriers as chronic tiredness and the need for care giver assistance with meals. This study confirms profound malnutrition in Australian A-T patients. Poor intakes and diet quality suggest the need for early nutrition intervention. Ongoing support for families and early discussions on tube feeding are required to address changing needs in childhood and likely nutritional decline into adulthood. A prospective study is required to assess feasibility and effectiveness of nutrition interventions in young people with A-T.
Publisher: Wiley
Date: 12-1995
DOI: 10.1111/J.1365-2052.1995.TB02693.X
Abstract: A s le of 52 mixed-breed dairy cattle (Holstein Friesian and Jersey) and 51 beef cattle (Hereford) from south-east Queensland was studied. The second exon of BoLA-DRB3 was lified by polymerase chain reaction (PCR), and polymorphisms were detected by heteroduplex analysis. A large number of different heteroduplex patterns indicated extensive sequence polymorphism. Direct sequencing of PCR products from 17 homozygotes and cloning and sequencing of PCR product from two heterozygotes resulted in the identification and characterization of four novel alleles. The previously described allele BoLA-DRB3*2A is characterized by an amino acid deletion at position 65. We have identified three animals that are homozygous for this amino acid deletion, indicating that the deletion is unlikely to result in loss of function. Two of these animals had allele BoLA-DRB3*2A, and one had a novel allele with codon 65 deleted but differing from BoLA-DRB3*2A at a number of other amino acid positions. In conclusion, heteroduplex analysis allows rapid discrimination between homozygotes and heterozygotes, and enables rapid identification of new BoLA-DRB3 alleles.
Publisher: Proceedings of the National Academy of Sciences
Date: 22-01-2002
Abstract: The human genetic disorder ataxia-telangiectasia (A-T) is characterized by hypersensitivity to ionizing radiation and an elevated risk of malignancy. Epidemiological data support an increased risk for breast and other cancers in A-T heterozygotes. However, screening breast cancer cases for truncating mutations in the ATM (A-T mutated) gene has failed largely to reveal an increased incidence in these patients. It has been hypothesized that ATM missense mutations are implicated in breast cancer, and there is some evidence to support this. The presence of a large variety of rare missense variants in addition to common polymorphisms in ATM makes it difficult to establish such a relationship by association studies. To investigate the functional significance of these changes we have introduced missense substitutions, identified in either A-T or breast cancer patients, into ATM cDNA before establishing stable cell lines to determine their effect on ATM function. Pathogenic missense mutations and neutral missense variants were distinguished initially by their capacity to correct the radiosensitive phenotype in A-T cells. Furthermore missense mutations abolished the radiation-induced kinase activity of ATM in normal control cells, caused chromosome instability, and reduced cell viability in irradiated control cells, whereas neutral variants failed to do so. Mutant ATM was expressed at the same level as endogenous protein, and interference with normal ATM function seemed to be by multimerization. This approach represents a means of identifying genuine ATM mutations and addressing the significance of missense changes in the ATM gene in a variety of cancers including breast cancer.
Publisher: Hindawi Limited
Date: 19-03-2020
DOI: 10.1155/2020/5637507
Abstract: Benzene (BZ) is an important occupational and environmental pollutant. Exposure to BZ may cause aplastic anemia which is characterized as bone marrow hematopoietic failure. In order to reduce the harmful effects of this pollutant, it is necessary to identify additional preventative measures. In this study, we investigated the protective effects of epimedium polysaccharide (EPS), a natural compound with antioxidant and immune-enhancing potency, on aplastic anemia induced by benzene exposure in mice. Male CD-1 mice were randomly ided into five groups including control, BZ (880 mg/kg), LE (EPS low-dose, 20 mg/kg + BZ), ME (EPS middle-dose, 100 mg/kg + BZ), and HE (EPS high-dose, 200 mg/kg + BZ) groups. Animals were exposed to BZ by subcutaneous injection in the presence or absence of EPS via oral administration. All mice were treated 3 times a week for 8 consecutive weeks to develop a mouse model of benzene-induced aplastic anemia (BIAA). Results showed that BZ induced a significant decrease in both white and red blood cells, platelet counts, and hemoglobin level compared with that in the control group ( p 0.01 ). Treatment of EPS led to a protective effect against these changes particularly in the highest-dose group (HE, p 0.01 ). EPS also recovered the decreased number of nucleated cells in peripheral blood cell smears and femur biopsies by BZ exposure. The increased level of reactive oxygen species (ROS) in bone marrow mononuclear cells (BMMNCs) in mice from the BZ group was significantly lower ( p 0.01 ) in the mice from the highest concentration of EPS (HE) group when compared with that from the control group. In addition, BZ exposure led to a significant increase in the apoptosis rate in BMMNCs which was prevented by EPS in a dose-dependent manner ( p 0.01 ). The antiapoptosis effect of EPS was through reversing apoptotic proteins such as BAX, Caspase-9 and Caspase-3, and Bcl-2. Finally, EPS treatment partially restored the levels of T cells and the different subtypes except CD80 + and CD86 + compared with the BZ group (HE, p 0.05 ). These results suggest that EPS has protective effects against BIAA via antioxidative stress, immune modulation, and antiapoptosis mechanisms.
Publisher: Elsevier BV
Date: 05-2006
Publisher: Wiley
Date: 09-2000
DOI: 10.1046/J.1464-410X.2000.00835.X
Abstract: To measure free : total prostate specific antigen (PSA) ratios in ejaculate from men with suspected and known prostate cancer, and in young control men, to determine if this ratio might be useful in discriminating benign from malignant prostatic conditions. Patients, subjects and methods Forty-seven men with prostate cancer (positive biopsies), 52 men with suspected prostate cancer but who had negative biopsies and 28 young men (< 30 years old) and with no family history of cancer, provided either a single ejaculate specimen (total 59) or multiple specimens (total 193) on subsequent occasions. Free and total PSA were measured using appropriate assays. All specimens were diluted in a PSA-negative female serum pool. The median free : total PSA ratios were 0.76-0.81 among the patient groups and control men, and there was no statistical difference between the groups. These data presumably only reflect the inactive component of free PSA, given that any alpha2-macroglobulin or alpha1-antichymotrypsin in the assay serum diluent was likely to have bound the active free PSA component in these s les. Similar results were obtained from those providing single and multiple s les, suggesting that a single specimen is sufficient to reflect the seminal plasma free : total PSA ratio over that period. There was no relationship between seminal plasma free : total PSA ratio and age for the controls or the positive biopsy group, although there was a negative relationship (i.e. a decline with age) that almost reached significance in those with negative biopsies (P = 0.058, R2 = 0.07). This is the first report of free : total PSA ratios in the ejaculate of men with suspected and known prostate cancer compared with young control men. Although no significant changes were detected in the free : total PSA ratios in ejaculate, these results may be confounded by differences in ratios with age, as is the case for serum PSA or different molecular forms of PSA. Indeed, these data suggest that a large proportion of free PSA in seminal plasma may be inactive. Further studies are needed to determine the potential utility of measuring free : total PSA, or other candidate markers, in ejaculate to better discriminate benign from malignant prostate disease.
Publisher: Springer Science and Business Media LLC
Date: 25-01-2001
Abstract: p73 has recently been identified as a structural and functional homolog of the tumor suppressor protein p53. Overexpression of p53 activates transcription of p53 effector genes, causes growth inhibition and induced apoptosis. We describe here the effects of a tumor-derived truncated transcript of p73alpha (p73Deltaexon2) on p53 function and on cell death. This transcript, which lacks the acidic N-terminus corresponding to the transactivation domain of p53, was initially detected in a neuroblastoma cell line. Overexpression of p73Deltaexon2 partially protects lymphoblastoid cells against apoptosis induced by anti-Fas antibody or cisplatin. By cotransfecting p73Deltaexon2 with wild-type p53 in the p53 null line Saos 2, we found that this truncated transcript reduces the ability of wild-type p53 to promote apoptosis. This anti-apoptotic effect was also observed when p73Deltaexon2 was co-transfected with full-length p73 (p73alpha). This was further substantiated by suppression of p53 transactivation of the effector gene p21/Waf1 in p73Deltaexon2 transfected cells and by inhibition of expression of a reporter gene under the control of the p53 promoter. Thus, this truncated form of p73 can act as a dominant-negative agent towards transactivation by p53 and p73alpha, highlighting the potential implications of these findings for p53 signaling pathway. Furthermore, we demonstrate the existence of a p73Deltaexon2 transcript in a very significant proportion (46%) of breast cancer cell lines. However, a large spectrum of normal and malignant tissues need to be surveyed to determine whether this transdominant p73 variant occurs in a tumor-specific manner.
Publisher: Elsevier BV
Date: 05-1998
DOI: 10.1016/S0167-8140(98)00027-9
Abstract: Radiosensitivity is a major hallmark of the human genetic disorder ataxia telangiectasia. This hypersensitivity to ionizing radiation has been demonstrated in vivo after exposure of patients to therapeutic doses of radiation and in cells in culture. Clearly an understanding of the nature of the molecular defect in ataxia telangiectasia will be of considerable assistance in delineating additional pathways that determine cellular radiosensitivity/radioresistance. Furthermore, since patients with this syndrome are also predisposed to developing a number of leukaemias and lymphomas, the possible connection between radiosensitivity and cancer predisposition is of interest. Now that the gene (ATM) responsible for this genetic disease has been cloned and identified, progress is being made in determining the role of the ATM protein in mediating the effects of cellular exposure to ionizing radiation and other forms of redox stress. Proteins such as the product of the tumour suppressor gene p53 and the proto-oncogene c-Abl (a protein tyrosine kinase) have been shown to interact with ATM. Since several intermediate steps in both the p53 and c-Abl pathways, activated by ionizing radiation, are known it will be possible to map the position of ATM in these pathways and describe its mechanism of action. What are the clinical implications of understanding the molecular basis of the defect in ataxia telangiectasia (A-T)? As outlined above, since radiosensitivity is a universal characteristic of A-T, understanding the mechanism of action of ATM will provide additional information on radiation signalling in human cells. With this information it may be possible to sensitize tumour cells to radiation and thus increase the therapeutic benefit of radiotherapy. This might involve the use of small molecules that would interfere with the normal ATM-controlled pathways and thus sensitize cells to radiation or alternatively it might involve the efficient introduction of ATM anti-sense cDNA constructs into tumours to achieve the same end-point.
Publisher: Wiley
Date: 09-06-2022
Abstract: Uncontrolled bleeding from traumatic injury remains the leading cause of preventable death with loss of balance between blood clotting (coagulation) and blood clot breakdown (fibrinolysis). A major limitation of existing hemostatic agents is that they require a functioning clotting system to control the bleeding and are largely based on gauze delivery scaffolds. Herein, a novel rapid wound sealant, composed of two recombinant snake venom proteins, the procoagulant ecarin, to rapidly initiate blood clotting and the antifibrinolytic textilinin, to prevent blood clot breakdown within a synthetic thermoresponsive hydrogel scaffold is developed. In vitro, it is demonstrated that clotting is rapidly initiated with only nanomolar concentrations of venom protein and clot breakdown is effectively inhibited by textilinin. A stable clot is formed within 60 s compared to normal clot formation in 8 min. In vivo studies reveal that the snake venom hydrogel rapidly controls warfarin-induced bleeding, reducing the bleed volume from 48% to 12% and has demonstrated immune compatibility. A new class of hemostatic agents that achieve formation of rapid and stable blood clots even in the presence of blood thinners is demonstrated here.
Publisher: The Korean Urological Association
Date: 2011
Publisher: MDPI AG
Date: 04-04-2018
DOI: 10.3390/MA11040554
Publisher: Springer Science and Business Media LLC
Date: 25-05-2012
Publisher: Elsevier BV
Date: 03-1996
DOI: 10.1016/0165-1218(95)00097-6
Abstract: Bistratene A, a toxin isolated from the colonial ascidian Lissoclinum bistratum causes a decrease in mitotic index and retardation of lymphocyte proliferation kinetics when it is added at 48 h to 72-h human lymphocyte cultures. In the same cultures, the incidence of sister chromatid exchanges was not altered by this compound. We also observed an increase in the number of polyploid cells in the cultures, and alterations of the beta-tubulin organization by immunocytochemistry with an antibody against beta-tubulin. Bistratene A induces DNA damage in a dose-dependent fashion in leukocytes, as measured by the alkaline single cell gel electrophoresis assay. These results show that bistratene A interferes with microtubule assembly, is cytotoxic and cytostatic, and that it causes DNA damage.
Publisher: Elsevier BV
Date: 11-1989
DOI: 10.1016/0165-2427(89)90106-2
Abstract: Haematological parameters and reactivity of lymphocyte antigens to monoclonal antibodies were studied over a 10-month period in sheep experimentally infected with bovine leukaemia virus (BLV). BLV-inoculated animals seroconverted within 1 month and showed a significant lymphocytosis 2-6 weeks after infection. Control animals inoculated with BLV-free lymphocytes showed a stronger and more immediate neutrophil response than those inoculated with BLV-positive lymphocytes. One month after infection, BLV-inoculated sheep showed a relative increase of cells bearing antigens T4, T6, T8 and T19, and 10 months into the trial, MHC II lymphocytes increased, T6 remained elevated, but T4 helper cells were significantly decreased in number. Lymphoma tissue showed the presence of T8 cells, and lymph nodes from seroconverted sheep had areas of concentrated T4 staining cells. These results demonstrate responses in cellular immune mechanisms to infection with BLV.
Publisher: Elsevier
Date: 2003
Publisher: Wiley
Date: 08-1994
DOI: 10.1111/J.1440-1673.1994.TB00178.X
Abstract: An overview is provided of several recent advances in our understanding of the molecular events that occur when cells are exposed to ionizing radiation. A basic knowledge of molecular radiobiology is necessary so that the radiation oncologist can (i) screen cancer patients for an abnormally reduced or exaggerated response to radiotherapy and (ii) devise novel ways to counter the molecular pathways that sustain malignant progression.
Publisher: Elsevier BV
Date: 04-1997
Publisher: Elsevier BV
Date: 04-2011
DOI: 10.1016/J.BIOCHI.2010.12.008
Abstract: Snake venoms contain a complex mixture of polypeptides that modulate prey homeostatic mechanisms through highly specific and targeted interactions. In this study we have identified and characterised cystatin-like cysteine-protease inhibitors from elapid snake venoms for the first time. Novel cystatin sequences were cloned from 12 of 13 elapid snake venom glands and the protein was detected, albeit at very low levels, in a total of 22 venoms. One highly conserved isoform, which displayed close sequence identity with family 2 cystatins, was detected in each elapid snake. Crude Austrelaps superbus (Australian lowland copperhead) snake venom inhibited papain, and a recombinant form of A. superbus cystatin inhibited cathepsin L ≅ papain > cathepsin B, with no inhibition observed for calpain or legumain. While snake venom cystatins have truncated N-termini, sequence alignment and structural modelling suggested that the evolutionarily conserved Gly-11 of family 2 cystatins, essential for cysteine protease inhibition, is conserved in snake venom cystatins as Gly-3. This was confirmed by mutagenesis at the Gly-3 site, which increased the dissociation constant for papain by 10(4)-fold. These data demonstrate that elapid snake venom cystatins are novel members of the type 2 family. The widespread, low level expression of type 2 cystatins in snake venom, as well as the presence of only one highly conserved isoform in each species, imply essential housekeeping or regulatory roles for these proteins.
Publisher: Springer Science and Business Media LLC
Date: 07-04-2006
Abstract: A number of proteins are activated by stress stimuli but none so spectacularly or with the degree of complexity as the tumour suppressor p53 (human p53 gene or protein). Once stabilized, p53 is responsible for the transcriptional activation of a series of proteins involved in cell cycle control, apoptosis and senescence. This protein is present at low levels in resting cells but after exposure to DNA-damaging agents and other stress stimuli it is stabilized and activated by a series of post-translational modifications that free it from MDM2 (mouse double minute 2 but used interchangeably to denote human also), a ubiquination ligase that ubiquitinates it prior to proteasome degradation. The stability of p53 is also influenced by a series of other interacting proteins. In this review, we discuss the post-translational modifications to p53 in response to different stresses and the consequences of these changes.
Publisher: Springer Science and Business Media LLC
Date: 14-11-2018
Publisher: Oxford University Press (OUP)
Date: 17-03-2004
DOI: 10.1093/HMG/DDH122
Publisher: Informa UK Limited
Date: 1994
DOI: 10.1080/09553009414550211
Abstract: A number of anomalies have been described in the progression of ataxia-telangiectasia (AT) cells through the cell cycle post-irradiation. Some uncertainty still exists as to whether AT cells show increased or reduced ision delay after exposure to ionizing radiation. We have attempted to resolve the apparent inconsistencies that exist by investigating the effects of radiation on AT cells at various stages of the cell cycle. Specific labelling of S phase cells with 5-bromodeoxyuridine (BrdU) followed by irradiation caused a prolonged accumulation of these cells in G2/M phase with only 2-7% of AT cells progressing through to G1 24h post-irradiation. In contrast, 23-28% of control cells irradiated in S phase reached G1 by 24 h after irradiation. As observed previously with AT fibroblasts, AT lymphoblastoid cells irradiated in G1 phase did not experience a delay in entering S phase. After progressing through S phase these cells also were delayed in G2/M, but not to the same extent as irradiated S phase cells. On the other hand, when AT cells were irradiated in G2 phase they showed less delay initially in entry to mitosis and the subsequent G1 phase than did irradiated control cells. The overall results demonstrate that AT cells fail to show an initial delay in transitions between the G1/S and G2/M phases of the cell cycle and in progression through these phases post-irradiation, but in the long-term, after passage through S phase, they experience a prolonged delay in G2/M. Since several AT complementation groups are represented in this study, the cell cycle anomalies appear to be universal in AT. These results implicate deficiencies in control of cell cycle progression in the increased radiosensitivity and cancer predisposition in AT.
Publisher: Public Library of Science (PLoS)
Date: 15-01-2013
Publisher: Elsevier BV
Date: 06-2000
DOI: 10.1016/S0304-3835(99)00444-9
Abstract: The molecular pathogenesis of various categories of breast cancer (BC) has been well described, but surprisingly few reports have appeared on analysis of somatic mutations in bilateral BC. We have performed a polymerase chain reaction (PCR)-driven investigation of chromosomal regions showing common loss of heterozygosity (LOH) in 23 cases (46 tumors) from patients diagnosed with bilateral BC. LOH was observed in 15/46 (33%) informative tumors for chromosome 1p, 5/32 (16%) for 5q, 12/44 (27%) for 11q, 15/40 (38%) for 13q and 4/24 (17%) for 17p. These values are within the range of interlaboratory variations reported for unilateral BC. There was no strong evidence for concordance of LOH within the same patient for any of the chromosomal loci tested. Atypical for breast carcinomas, 7/46 (15%) tumors accumulated a high frequency (ranging from 11 to 29%) of shortened dinucleotide CA repeats, implying microsatellite instability (MI). Further analysis with the highly informative BAT-26 marker allowed for the classification of two of these tumors as having a replication error positive (RER(+)/MSI-H) phenotype, whereas the remaining five carcinomas harbored so-called borderline MI. Thus an involvement of both RER(+) and borderline MI appears to be a distinct feature of bilateral breast carcinomas compared to unilateral lesions.
Publisher: American Chemical Society (ACS)
Date: 04-07-2007
DOI: 10.1021/PR0701613
Abstract: Included among the more than 300 species of elapid snakes worldwide is the Australian genus Demansia, or whip snakes. Despite evidence to suggest adverse clinical outcomes from envenomation by these snakes, together with confusion on their true phylogenetic relationship to other Australian elapids, not a single toxin sequence has previously been reported from the venom of a Demansia species. We describe here a combined proteomic and transcriptomic approach characterizing the venom from the black whip snake, Demansia vestigiata. A total of 13 distinct toxin families were identified, including homologues of all of the major toxic components previously reported from the venom of other Australian elapids, such as factor X-like prothrombin activators, neurotoxins, phospholipases, cysteine rich secretory proteins, textilinin-like molecules, nerve growth factors, l-amino acid oxidases, vespryns, 5' nucleotidases, metalloproteinases, and C-type lectins as well as a novel dipeptidyl peptidase family. Phylogenetic analysis of these sequences revealed an early evolutionary split of the black whip snake from all other characterized Australian snakes, with a low degree of sequence identity between D. vestigiata and the other snakes, across all toxin families. The results of this study have important implications not only for the further characterization of venom from whip snakes, but also for our understanding of the evolutionary relationship of Australian snake species.
Publisher: Elsevier BV
Date: 09-1989
DOI: 10.1016/0147-619X(89)90018-8
Abstract: Two 7.4-kb plasmids from Chlamydia psittaci have been cloned and characterized. These plasmids are quite distinct from the 6.2-kb C. psittaci and the C. trachomatis plasmids when compared by restriction endonuclease analysis. The plasmids show considerable cross-hybridization, with only a small region highly conserved and identified as a 4 X 22-bp tandemly repeated region. This sequence is identical in the two size categories of C. psittaci plasmids and differs from C. trachomatis plasmids by only 2 bp in the 22-bp motif. AT-rich clusters 5' to the repeat region which are present in C. trachomatis and Escherichia coli plasmids were absent from both classes of C. psittaci plasmids. Extensive regions are less highly conserved but show a sufficient degree of cross-hybridization to suggest that the plasmids are homologous.
Publisher: Springer Science and Business Media LLC
Date: 12-08-1999
Abstract: Loss of heterozygosity (LOH) involving the distal part of the short arm of chromosome 1 occurs frequently in ovarian adenocarcinomas but the tumour suppressor gene(s) targeted by this event is unknown. We have used five microsatellite markers in a panel of 56 ovarian adenocarcinomas to determine which part of 1p34 - 36 is the focus of this LOH. LOH was considerably more common at 1p36 (43%) than at 1p34 - 35 (18%), and 11 tumours showed LOH at 1p36 but not at 1p34 - 35. These data strongly suggest the presence of a tumour suppressor gene inactivated in ovarian adenocarcinoma at 1p36. The p53 homologue, p73, has recently been isolated and mapped to 1p36 and therefore is a candidate for this tumour suppressor gene. However, RT - PCR and Western analyses revealed strong expression of p73 in ovarian adenocarcinoma cell lines but very low or undetectable levels in normal ovarian surface epithelial cells. Immunohistochemical analysis of primary ovarian tumours showed that only 3/22 (14%) contained p73 expressing cells. There was no association between 1p36 LOH and p73 expression in ovarian tumours, nor between p73 and p53 expression. These findings strongly suggest that p73 is not the target of 1p36 LOH in ovarian adenocarcinomas but indicate the presence of an, as yet unidentified, tumour suppressor gene in this region that plays an important role in ovarian tumorigenesis.
Publisher: Elsevier BV
Date: 2015
Publisher: Informa UK Limited
Date: 11-2011
DOI: 10.1128/MCB.05987-11
Publisher: Elsevier BV
Date: 12-1991
DOI: 10.1016/0378-1119(91)90616-J
Abstract: Using 32P-labelled random primed ribosomal DNA (rDNA) from the ascidian, Herdmania momus, multiple and large-scale filter-binding assays were performed to identify cis-regulatory sequences interacting with H. momus oocyte germinal vesicle protein. A vacublot apparatus was used to isolate DNA-protein complexes, providing a means of filtering multiple binding reactions simultaneously and for isolating sufficient amounts of bound DNA for further investigations. DNA bound to the filter was used to identify unknown cis-elements in the rDNA by Southern-blot analysis. The trapped rDNA hybridized specifically to the intergenic spacer, a region which contains cis-regulatory sequences that interact with rDNA transcription factors in several other species. Gel shift analysis of intergenic spacer fragments and native Southwestern blots confirmed that cis-elements were localized in the rDNA intergenic spacer. In principle, this method allows for the rapid identification of cis-regulatory sequences within any large, cloned DNA fragment which interact with nuclear extract.
Publisher: Springer Science and Business Media LLC
Date: 22-07-2008
Publisher: Springer Science and Business Media LLC
Date: 19-04-2018
Publisher: Elsevier BV
Date: 08-1996
Publisher: The Company of Biologists
Date: 15-06-2004
DOI: 10.1242/DEV.01120
Abstract: Hemps, a novel epidermal growth factor (EGF)-like protein, is expressed during larval development and early metamorphosis in the ascidian Herdmania curvata and plays a direct role in triggering metamorphosis. In order to identify downstream genes in the Hemps pathway we used a gene expression profiling approach, in which we compared post-larvae undergoing normal metamorphosis with larval metamorphosis blocked with an anti-Hemps antibody. Molecular profiling revealed that there are dynamic changes in gene expression within the first 30 minutes of normal metamorphosis with a significant portion of the genome (approximately 49%) being activated or repressed. A more detailed analysis of the expression of 15 of these differentially expressed genes through embryogenesis, larval development and metamorphosis revealed that while there is a ersity of temporal expression patterns, a number of genes are transiently expressed during larval development and metamorphosis. These and other differentially expressed genes were localised to a range of specific cell and tissue types in Herdmania larvae and post-larvae. The expression of approximately 24%of the genes that were differentially expressed during early metamorphosis was affected in larvae treated with the anti-Hemps antibody. Knockdown of Hemps activity affected the expression of a range of genes within 30 minutes of induction, suggesting that the Hemps pathway directly regulates early response genes at metamorphosis. In most cases, it appears that the Hemps pathway contributes to the modulation of gene expression, rather than initial gene activation or repression. A total of 151 genes that displayed the greatest alterations in expression in response to anti-Hemps antibody were sequenced. These genes were implicated in a range of developmental and physiological roles, including innate immunity, signal transduction and in the regulation of gene transcription. These results suggest that there is significant gene activity during the very early stages of H. curvata metamorphosis and that the Hemps pathway plays a key role in regulating the expression of many of these genes.
Publisher: Wiley
Date: 14-11-2018
DOI: 10.1111/IMCB.1001
Abstract: The phosphoinositide-3-kinase like kinases are a family of very large protein kinases. These PI3-kinase like kinase (PIKK) proteins have well-established roles in detection and repair of damage to the genome, regulation of the transcriptome and cellular metabolism. Recently there has emerged, evidence for links between these proteins and inflammation. While some of these links come from an increased understanding of the impacts of damage to the cell on inflammatory responses, others suggest that PIKK proteins also have direct roles in regulation of immune responses. Particularly evident is the link between DNA damage and innate immune response pathways. Here, we review recent findings on the PIKK family of proteins and how they impact on inflammation, particularly activation of the innate immune system.
Publisher: Wiley
Date: 15-03-1984
Abstract: In this study Epstein-Barr virus-transformed lymphoblastoid cells were shown to contain fibronectin. A marked difference in the number of fibronectin-positive cells was observed in control and ataxia-telangiectasia lymphoblastoid cells. Three control cell lines varied between 60% and 80% in the number of cells containing fibronectin. Only a small percentage of ataxia-telangiectasia cells (1-5%) had fibronectin present. Control and ataxia-telangiectasia fibroblasts had similar amounts and distributions of fibronectin. An asymmetric distribution of fibronectin was evident in many control and ataxia-telangiectasia lymphoblastoid cells. The increased frequency of fibronectin-containing cells in the control populations cannot be accounted for by different growth rates or variation in the various phases of the cell cycle in the two cell types.
Publisher: Portland Press Ltd.
Date: 09-1970
DOI: 10.1042/BJ1190025P
Abstract: Bacterial serine dipeptide lipids are known to promote inflammatory processes and are detected in human tissues associated with periodontal disease or atherosclerosis. Accurate quantification of bacterial serine lipid, specifically lipid 654 [((S)-15-methyl-3-((13-methyltetradecanoyl)oxy)hexadecanoyl)glycyl-l-serine, (3S)-l-serine] isolated from Porphyromonas gingivalis, in biological s les requires the preparation of a stable isotope internal standard for s le supplementation and subsequent mass spectrometric analysis. This report describes the convergent synthesis of a deuterium-substituted serine dipeptide lipid, which is an isotopically labeled homologue that represents a dominant form of serine dipeptide lipid recovered in bacteria.
Publisher: Ovid Technologies (Wolters Kluwer Health)
Date: 04-1999
Publisher: Wiley
Date: 02-1989
DOI: 10.1111/J.1445-2197.1989.TB01491.X
Abstract: Inflammatory cell infiltration was characterized in five classical seminomatous testicular tumours using immunohistochemical techniques. These cells of immunological lineage were sited mostly around vessels. Lymphocytes were the most numerous, T cells outnumbering B cells in all sections studied. The helper/inducer subgroup predominated in the T cell family with suppressor cells more common than cytotoxic cells. Plasma cells constituted only a small percentage of this population as did natural killer cells. No Langerhans cells were identified. Phagocytic macrophages were twice as common as antigen-presenting macrophages yet T lymphocytes were 15 times more common than these antigen-presenting macrophages.
Publisher: Elsevier BV
Date: 1984
DOI: 10.1016/0027-5107(84)90038-1
Abstract: Although ataxia telangiectasia (AT) cells are more sensitive than normal cells to killing by ionizing radiation, their DNA synthesis is more resistant to inhibition by radiation. It was thought that this anomaly in DNA synthesis was likely to perturb cell cycle progression. Flow cytometry and the fraction of labelled mitoses (FLM) were used to investigate effects of irradiation in normal and AT cell lines. The FLM indicated that radiation apparently induced a longer G2 delay in normal cells than in AT cells. However, flow cytometry showed that radiation induced much larger and more prolonged increases in the proportion of G2 cells in AT than in normals. AT populations also showed much larger postirradiation decreases in viable cell numbers. These data suggest that a large proportion of the radiosensitive AT cells are not reversibly blocked in G2 but die there, and never proceed through mitosis. The less radiosensitive normal cells are delayed in G2 and then proceed through mitosis. We suggest that the apparently shorter radiation-induced mitotic delay seen in AT cells by FLM is not real but is an artifact arising from perturbation of steady state conditions by selective elimination of a particular cohort of AT cells. Accumulation of AT cells in G2 is compatible with radiosensitivity of these cells and may arise from a defect in DNA repair or an anomaly in DNA replication.
Publisher: Springer Science and Business Media LLC
Date: 11-2005
DOI: 10.1007/S00018-005-5384-9
Abstract: Australian terrestrial elapid snakes contain amongst the most potently toxic venoms known. However, despite the well-documented clinical effects of snake bite, little research has focussed on in idual venom components at the molecular level. To further characterise the components of Australian elapid venoms, a complementary (cDNA) microarray was produced from the venom gland of the coastal taipan (Oxyuranus scutellatus) and subsequently screened for venom gland-specific transcripts. A number of putative toxin genes were identified, including neurotoxins, phospholipases, a pseudechetoxin-like gene, a venom natriuretic peptide and a nerve growth factor together with other genes involved in cellular maintenance. Venom gland-specific components also included a calglandulin-like protein implicated in the secretion of toxins from the gland into the venom. These toxin transcripts were subsequently identified in seven other related snake species, producing a detailed comparative analysis at the cDNA and protein levels. This study represents the most detailed description to date of the cloning and characterisation of different genes associated with envenomation from Australian snakes.
Publisher: Springer Science and Business Media LLC
Date: 05-2000
DOI: 10.1038/75508
Abstract: Mutations in the gene ATM are responsible for the genetic disorder ataxia-telangiectasia (A-T), which is characterized by cerebellar dysfunction, radiosensitivity, chromosomal instability and cancer predisposition. Both the A-T phenotype and the similarity of the ATM protein to other DNA-damage sensors suggests a role for ATM in biochemical pathways involved in the recognition, signalling and repair of DNA double-strand breaks (DSBs). There are strong parallels between the pattern of radiosensitivity, chromosomal instability and cancer predisposition in A-T patients and that in patients with Nijmegen breakage syndrome (NBS). The protein defective in NBS, nibrin (encoded by NBS1), forms a complex with MRE11 and RAD50 (refs 1,2). This complex localizes to DSBs within 30 minutes after cellular exposure to ionizing radiation (IR) and is observed in brightly staining nuclear foci after a longer period of time. The overlap between clinical and cellular phenotypes in A-T and NBS suggests that ATM and nibrin may function in the same biochemical pathway. Here we demonstrate that nibrin is phosphorylated within one hour of treatment of cells with IR. This response is abrogated in A-T cells that either do not express ATM protein or express near full-length mutant protein. We also show that ATM physically interacts with and phosphorylates nibrin on serine 343 both in vivo and in vitro. Phosphorylation of this site appears to be functionally important because mutated nibrin (S343A) does not completely complement radiosensitivity in NBS cells. ATM phosphorylation of nibrin does not affect nibrin-MRE11-RAD50 association as revealed by radiation-induced foci formation. Our data provide a biochemical explanation for the similarity in phenotype between A-T and NBS.
Publisher: Elsevier BV
Date: 11-2016
Publisher: Wiley
Date: 22-09-2006
DOI: 10.1002/GCC.20267
Abstract: While ATM, the protein defective in the human genetic disorder ataxia-telangiectasia (A-T), is primarily activated as a preexisting protein by radiation, there is also evidence that expression of the protein can be regulated at the transcriptional level. Activation of the ATM promoter by ionizing radiation has been reported only in quiescent cells in culture. To investigate how the Atm promoter is regulated in vivo, we generated transgenic mice that express the luciferase reporter gene under the control of the murine Atm promoter. Using a biophotonic imaging system luciferase activity was monitored in vivo. Strong promoter activity was detected throughout the transgenic animals with particularly high signals from the thymus, abdominal region, and reproductive organs. This activity further increased in response to both ionizing radiation and heat stress in a time dependent manner. Luciferase activity, measured in vitro in extracts from different tissues, showed highest activities in testes, ovaries, and cerebellum. Subjecting these mice to a single dose of 4 Gy total body radiation led to a time-dependent activation of the promoter with the strongest response observed in the peritoneal membrane, skin, and spleen. For most tissues tested, maximal promoter activity was reached 8 hr after radiation. The observed changes in promoter activity largely correlated with levels and activity of Atm protein in tissue extracts. These results demonstrate that, in addition to activation by autophosphorylation, Atm can also be regulated in vivo at the transcriptional level possibly ensuring a more sustained response to radiation and other stimuli.
Publisher: MDPI AG
Date: 23-10-2015
DOI: 10.3390/BIOM5042877
Publisher: Wiley
Date: 08-05-2009
DOI: 10.1111/J.1742-4658.2009.07034.X
Abstract: Textilinin-1 is a Kunitz-type serine protease inhibitor isolated from the venom of the Australian common brown snake, Pseudonaja textilis. This molecule binds to and blocks the activity of a range of serine proteases, including plasmin and trypsin. Textilinin-1's ability to inhibit plasmin, a protease involved in fibrinolysis, has raised the possibility that it could be used as an alternative to aprotinin (Trasylol) as a systemic antibleeding agent in surgery. Here, the crystal structure of free recombinant textilinin-1 has been determined to 1.63 A, with three molecules observed in the asymmetric unit. All of these have a similar overall fold to aprotinin, except that the canonical loop for one of the molecules is inverted such that the side chain of the P1' residue, Val18, is partially buried by intramolecular contacts to Pro15, Thr13, and Ile36. In aprotinin, the P1' residue is Ala16, whose side chain is too small to form similar contacts. The loop inversion in textilinin-1 is facilitated by changes in backbone dihedral angles for the P1 and P2' residues, such that they alternate between values in the beta-sheet and alpha-helical regions of the Ramachandran plot. In a comparison with the structures of all other known Kunitz-type serine protease inhibitors, no such conformational variability has been observed. The presence of the bulkier valine as the P1' residue in textilinin-1 appears to be a major contributor to reducing the binding affinity for plasmin as compared to aprotinin (3.5 nm versus 0.053 nm) and could also account for an observed narrower binding specificity.
Publisher: Elsevier BV
Date: 1990
Publisher: JSTOR
Date: 03-1991
DOI: 10.2307/3578110
Publisher: Elsevier BV
Date: 12-2006
DOI: 10.1016/J.BIOCHI.2006.06.014
Abstract: The venom from Australian elapid snakes contains a complex mixture of polypeptide toxins that adversely affect multiple homeostatic systems within their prey in a highly specific and targeted manner. Included in these toxin families are the recently described venom natriuretic peptides, which display similar structure and vasoactive functions to mammalian natriuretic peptides. This paper describes the identification and detailed comparative analysis of the cDNA transcripts coding for the mature natriuretic peptide from a total of nine Australian elapid snake species. Multiple isoforms were identified in a number of species and represent the first description of a natriuretic peptide from the venom gland for most of these snakes. Two distinct natriuretic peptide isoforms were selected from the common brown snake (Pseudonaja textilis), PtNP-a, and the mulga (Pseudechis australis), PaNP-c, for recombinant protein expression and functional analysis. Only one of these peptides, PtNP-a, displayed cGMP stimulation indicative of normal natriuretic peptide activity. Interestingly, both recombinant peptides demonstrated a dose-dependent inhibition of angiotensin converting enzyme (ACE) activity, which is predictive of the vasoactive effects of the toxin. The natriuretic peptides, however, did not possess any coagulopathic activity, nor did they inhibit or potentiate thrombin, adenosine diphosphate or arachidonic acid induced platelet aggregation. The data presented in this study represent a significant resource for understanding the role of various natriuretic peptides isoforms during the envenomation process by Australian elapid snakes.
Publisher: Elsevier BV
Date: 04-2018
DOI: 10.1016/J.IJROBP.2018.11.047
Abstract: Roberts syndrome (RBS) is a rare, recessively transmitted developmental disorder characterized by growth retardation, craniofacial abnormalities, and truncation of limbs. All affected in iduals to date have mutations in the ESCO2 (establishment of cohesion 2) gene, a key regulator of the cohesin complex, which is involved in sister chromatid cohesion and DNA double-strand break (DSB) repair. Here we characterize DNA damage responses (DDRs) for the first time in an RBS-affected family. Lymphoblastoid cell lines were established from an RBS family, including the proband and parents carrying ESCO2 mutations. Various DDR assays were performed on these cells, including cell survival, chromosome break, and apoptosis assays checkpoint activation indicators and measures of DNA breakage and repair. Cells derived from the RBS-affected in idual showed sensitivity to ionizing radiation (IR) and mitomycin C-induced DNA damage. In this ESCO2 compound heterozygote, other DDRs were also defective, including enhanced IR-induced clastogenicity and apoptosis increased DNA DSB induction and a reduced capacity for repairing IR-induced DNA DSBs, as measured by γ-H2AX foci and the comet assay. In addition to its developmental features, RBS can be, like ataxia telangiectasia, considered a DDR-defective syndrome, which contributes to its cellular, molecular, and clinical phenotype.
Publisher: American Association for Cancer Research (AACR)
Date: 15-11-2006
DOI: 10.1158/0008-5472.CAN-06-2565
Abstract: Ionizing radiation causes DNA damage that elicits a cellular program of damage control coordinated by the kinase activity of ataxia telangiectasia mutated protein (ATM). Transforming growth factor β (TGFβ)-1, which is activated by radiation, is a potent and pleiotropic mediator of physiologic and pathologic processes. Here we show that TGFβ inhibition impedes the canonical cellular DNA damage stress response. Irradiated Tgfβ1 null murine epithelial cells or human epithelial cells treated with a small-molecule inhibitor of TGFβ type I receptor kinase exhibit decreased phosphorylation of Chk2, Rad17, and p53 reduced γH2AX radiation-induced foci and increased radiosensitivity compared with TGFβ competent cells. We determined that loss of TGFβ signaling in epithelial cells truncated ATM autophosphorylation and significantly reduced its kinase activity, without affecting protein abundance. Addition of TGFβ restored functional ATM and downstream DNA damage responses. These data reveal a heretofore undetected critical link between the microenvironment and ATM, which directs epithelial cell stress responses, cell fate, and tissue integrity. Thus, Tgfβ1, in addition to its role in homoeostatic growth control, plays a complex role in regulating responses to genotoxic stress, the failure of which would contribute to the development of cancer conversely, inhibiting TGFβ may be used to advantage in cancer therapy. (Cancer Res 2006 66(22): 10861-9)
Publisher: Ovid Technologies (Wolters Kluwer Health)
Date: 09-1997
Publisher: Oxford University Press (OUP)
Date: 1982
DOI: 10.1269/JRR.23.423
Abstract: Empty nose syndrome (ENS) remains a controversial disease primarily associated with inferior turbinate tissue loss. Cotton placement into the inferior meatus often alleviates ENS symptoms within minutes, but the physiologic explanation for this phenomenon is unknown. Computational fluid dynamics (CFD) was employed to evaluate the mechanisms of altered nasal airflow conferred by cotton testing. Six ENS patients (12 sides) with pre-existing sinus computed tomography (CT) imaging were enrolled after marked symptomatic improvement (decrease in score on the Empty Nose Syndrome 6-Item Questionnaire [ENS6Q] of >7 points) with office-based cotton testing. The fashioned cotton plug was labeled in situ with iohexol contrast spray, and sinus CT was immediately obtained to detect cotton contouring in the inferior meatus. CT imaging from pre- and post-cotton placement was analyzed using comparative CFD techniques. After cotton placement, significant symptomatic improvement and reduced ENS6Q scores (16.8 ± 4.1 to 3.1 ± 2.4 p < 0.001) were recorded. Using CFD, cotton placement produced an expected 21% increase in upper airway resistance (p < 0.05). However, a significant shift in the nasal airflow distribution was also detected, with a transition of airflow vectors away from a middle meatus jetstream (-41% p < 0.002). Objective CFD assessment confirmed that the cotton test not only increases nasal resistance, but also restores airflow distribution to the inferior meatus in symptomatic ENS patients. These results highlight the potential efficacy of cotton test in ENS patients and further bolster the utility of this tool in identifying appropriate candidates for the inferior meatus augmentation procedure.
Publisher: Elsevier BV
Date: 04-1986
DOI: 10.1016/0014-4827(86)90065-0
Abstract: We have investigated in greater detail the radioresistant DNA synthesis universally observed in cells from patients with ataxia-telangiectasia (A-T). The approach employed in this study was to permeabilize cells with lysolecithin after gamma-irradiation and thus facilitate the introduction of cell extract into these cells. This permeabilization can be reversed by diluting the cells in growth medium. Cells treated in this way show the characteristic inhibition (control cells) or lack of it (A-T cells) after exposure to ionizing radiation. Introduction of A-T cells extracts into control cells prevented the radiation-induced inhibition of DNA synthesis normally observed in these cells. A-T cell extracts did not change the level of radioresistant DNA synthesis in A-T cells. Control cell extracts on the other hand did not influence the pattern of inhibition of DNA synthesis in either cell type. It seems likely that the agent involved is a protein because of its heat lability and sensitivity to trypsin digestion. It has a molecular weight (MW) in the range 20-30 000 D. The development of this assay system for a factor conferring radioresistant DNA synthesis on control cells provides a means of purifying this factor, and ultimately an approach to identifying the gene responsible.
Publisher: Oxford University Press (OUP)
Date: 15-06-2006
DOI: 10.1093/HMG/DDL149
Abstract: The APTX gene, mutated in patients with the neurological disorder ataxia with oculomotor apraxia type 1 (AOA1), encodes a novel protein aprataxin. We describe here, the interaction and interdependence between aprataxin and several nucleolar proteins, including nucleolin, nucleophosmin and upstream binding factor-1 (UBF-1), involved in ribosomal RNA (rRNA) synthesis and cellular stress signalling. Interaction between aprataxin and nucleolin occurred through their respective N-terminal regions. In AOA1 cells lacking aprataxin, the stability of nucleolin was significantly reduced. On the other hand, down-regulation of nucleolin by RNA interference did not affect aprataxin protein levels but abolished its nucleolar localization suggesting that the interaction with nucleolin is involved in its nucleolar targeting. GFP-aprataxin fusion protein co-localized with nucleolin, nucleophosmin and UBF-1 in nucleoli and inhibition of ribosomal DNA transcription altered the distribution of aprataxin in the nucleolus, suggesting that the nature of the nucleolar localization of aprataxin is also dependent on ongoing rRNA synthesis. In vivo rRNA synthesis analysis showed only a minor decrease in AOA1 cells when compared with controls cells. These results demonstrate a cross-dependence between aprataxin and nucleolin in the nucleolus and while aprataxin does not appear to be directly involved in rRNA synthesis its nucleolar localization is dependent on this synthesis.
Publisher: CSIRO Publishing
Date: 1996
DOI: 10.1071/MF9960543
Abstract: Embryonic and post-larval development of the tropical solitary ascidian Herdmania momus is shown to be similar to that of extensively studied ascidian model systems. H. momus development is rapid and temperature-dependent, with hatching occurring 8.5 h after fertilization at 28�C. An increase in total embryonic gene transcription is detected at the 110-cell stage or the onset of gastrulation. Treatment of early embryos with actinomycin D inhibits transcription and curtails morphogenetic cell movement in the early gastrula without immediately inhibiting cell ision. The prevalence of homeobox-containing transcripts increases around the 110-cell stage and later in development. Isolated H. momus homeobox genes, expressed at the tailbud stage, have greatest sequence identity to members of Hox, otd/Otx, eve/Evx and cad/Cdx homeobox classes. Evidence from H. momus and other ascidians suggests that urochordates possess most of the homeobox genes of the chordate HOX cluster.
Publisher: Oxford University Press (OUP)
Date: 30-08-2020
Abstract: Despite significant endeavor having been applied to identify effective therapies to treat glioblastoma (GBM), survival outcomes remain intractable. The greatest nonsurgical benefit arises from radiotherapy, though tumors typically recur due to robust DNA repair. Patients could therefore benefit from therapies with the potential to prevent DNA repair and synergize with radiotherapy. In this work, we investigated the potential of salinomycin to enhance radiotherapy and further uncover novel dual functions of this ionophore to induce DNA damage and prevent repair. In vitro primary GBM models and ex vivo GBM patient explants were used to determine the mechanism of action of salinomycin by immunoblot, flow cytometry, immunofluorescence, immunohistochemistry, and mass spectrometry. In vivo efficacy studies were performed using orthotopic GBM animal xenograft models. Salinomycin derivatives were synthesized to increase drug efficacy and explore structure-activity relationships. Here we report novel dual functions of salinomycin. Salinomycin induces toxic DNA lesions and prevents subsequent recovery by targeting homologous recombination (HR) repair. Salinomycin appears to target the more radioresistant GBM stem cell–like population and synergizes with radiotherapy to significantly delay tumor formation in vivo. We further developed salinomycin derivatives which display greater efficacy in vivo while retaining the same beneficial mechanisms of action. Our findings highlight the potential of salinomycin to induce DNA lesions and inhibit HR to greatly enhance the effect of radiotherapy. Importantly, first-generation salinomycin derivatives display greater efficacy and may pave the way for clinical testing of these agents.
Publisher: S. Karger AG
Date: 2005
DOI: 10.1159/000092421
Abstract: Textilinin-1 (Q8008) was isolated from the venom of the i Pseudonaja textilis /i and has a 47% sequence identity to the antihaemorrhagic therapeutic agent aprotinin. When equimolar concentrations of enzyme and aprotinin were pre-incubated, plasmin was inhibited 100%, plasma kallikrein 58%, and tissue kallikrein 99%. Under the same conditions, textilinin-1 inhibited plasmin 98%, plasma kallikrein 16% and tissue kallikrein 17%. Whole blood clot lysis was inhibited strongly by both aprotinin and textilinin-1, as shown by thrombelastography. At 2 µ i M /i inhibitor lysis initiated by t-PA was greater than 99% inhibited by aprotinin (LY60 = 0.4 ± 0.1) whereas textilinin-1, inhibited lysis by 91% (LY60 = 8.9 ± 0.7). The same trend was found with the lysis of euglobulin fractions. From these data textilinin-1 appears to be a more specific plasmin inhibitor than aprotinin but aprotinin inhibits clot lysis to a greater extent.
Publisher: Ovid Technologies (Wolters Kluwer Health)
Date: 07-2006
Publisher: Springer Science and Business Media LLC
Date: 21-07-2107
DOI: 10.1007/S11060-018-2838-0
Abstract: Glioblastoma (GBM) is a highly fatal disease with a 5 year survival rate of less than 22%. One of the most effective treatment regimens to date is the use of radiotherapy which induces lethal DNA double-strand breaks to prevent tumour growth. However, recurrence occurs in the majority of patients and is in-part a result of robust radioresistance mechanisms. In this study, we demonstrate that the multifunctional cytokine, interleukin-6 (IL-6), confers a growth advantage in GBM cells but does not have the same effect on normal neural progenitor cells. Further analysis showed IL-6 can promote radioresistance in GBM cells when exposed to ionising radiation. Ablation of the Ataxia-telangiectasia mutated serine/threonine kinase that is recruited and activated by DNA double-strand breaks reverses the effect of radioresistance and re-sensitised GBM to DNA damage thus leading to increase cell death. Our finding suggests targeting the signaling cascade of DNA damage response is a potential therapeutic approach to circumvent IL-6 from promoting radioresistance in GBM.
Publisher: Springer Science and Business Media LLC
Date: 24-04-1997
Abstract: The recently cloned gene (ATM) mutated in the human genetic disorder ataxia-telangiectasia (A-T) is involved in DNA damage response at different cell cycle checkpoints and also appears to have a wider role in signal transduction. Antibodies prepared against peptides from the predicted protein sequence detected a approximately 350 kDa protein corresponding to the open reading frame, which was absent in 13/23 A-T homozygotes. Subcellular fractionation, immunoelectronmicroscopy and immunofluorescence showed that the ATM protein is present in the nucleus and cytoplasmic vesicles. This distribution did not change after irradiation. We also provide evidence that ATM protein binds to p53 and this association is defective in A-T cells compatible with the defective p53 response in these cells. These results provide further support for a role for the ATM protein as a sensor of DNA damage and in a more general role in cell signalling, compatible with the broader phenotype of the syndrome.
Publisher: Elsevier BV
Date: 03-1986
DOI: 10.1016/0167-8817(86)90067-2
Abstract: DNA-chain elongation rates, determined by sedimentation analysis, were found to be similar in control and ataxia-telangiectasia lymphoblastoid cells. A gamma-radiation dose of 6 Gray, which had previously been shown to have a marked inhibitory effect on initiation of DNA replication, had no appreciable effect on elongation rates in either cell type. Elongation rates were also determined at 20 Gray of gamma-rays by pulsing cells with [3H]thymidine prior to irradiation to avoid anomalous sedimentation behaviour. At this radiation dose elongation was almost completely inhibited in control cells while little or no inhibition was observed in ataxia-telangiectasia cells. Deoxyribonucleoside triphosphate pool equilibration times were not altered at either dose.
Publisher: Springer Science and Business Media LLC
Date: 18-08-1998
Abstract: The cloning of a full-length cDNA for the gene (ATM) mutated in the human genetic disorder ataxia-telangiectasia (A-T) has been described recently. This cDNA, as well as a fragment representing a functional region from ATM, are capable of rescuing various aspects of the radiosensitive phenotype in A-T cells. We have subcloned full-length ATM cDNA in the opposite orientation in an EBV-based vector under the control of an inducible promoter to determine whether this anti-sense construct might sensitize control lymphoblastoid cells to ionizing radiation. The effectiveness of expression of this construct in control cells was monitored by loss of ATM protein which was evident over a period 6-12 h after induction. Under these conditions radiosensitivity was enhanced approximately threefold in control cells, approaching the degree of radiosensitivity observed in A-T cells. Expression of the anti-sense construct also increased the number of radiation-induced chromosomal breaks and led to the appearance of radioresistant DNA synthesis in these cells. Abrogation of the G1/S checkpoint was evident from the loss of the p53 response and that of its downstream effector, p21/WAF1, post-irradiation. The extent of accumulation of transfected cells in G2/M phase at 24 h post-irradiation was similar to that observed in A-T cells and the induction of stress-activated protein kinase by ionizing radiation was prevented by antisense ATM cDNA expression. These data demonstrate that full-length ATM anti-sense cDNA, by reducing the amount of ATM protein, is effective in imposing a series of known defects characteristic of the A-T phenotype. This inducible system provides an experimental model to further investigate mechanisms underlying radiosensitivity and cell cycle control.
Publisher: Wiley
Date: 29-09-2019
DOI: 10.1111/JCMM.14685
Publisher: Elsevier
Date: 2010
Publisher: Wiley
Date: 26-03-2009
DOI: 10.1111/J.1365-2141.2009.07605.X
Abstract: Aprotinin has been used widely in surgery as an anti-bleeding agent but is associated with a number of side effects. We report that textilinin-1, a serine protease inhibitor from Pseudonaja textilis venom with sequence relatedness to aprotinin, is a potent but reversible plasmin inhibitor and has a narrower range of protease inhibition compared to aprotinin. Like aprotinin, textilinin-1 at 5 micromol/l gave almost complete inhibition of tissue plasminogen activator-induced fibrinolysis of whole blood clots. The activated partial thromboplastin time for plasma was markedly increased by aprotinin but unaffected by textilinin-1. In a mouse tail-vein bleeding model, intravenous textilinin-1 and aprotinin caused similar decreases in blood loss but time to haemostasis in the textilinin-treated animals was significantly shorter than in aprotinin-treated mice. Based on these data, textilinin-1 merits further investigation as a therapeutic alternative to aprotinin.
Publisher: Wiley
Date: 04-1990
DOI: 10.1111/J.1834-7819.1990.TB05880.X
Abstract: Proto-oncogenes are important in both normal cellular differentiation and in carcinogenesis. The majority of transforming genes belong to the ras family and the ras gene product has been shown to be elevated in some oral carcinomas. RAP-5 monoclonal antibody was used to determine the expression of the p21ras protein in normal and neoplastic oral mucosa in an immunohistological study. The expression of p21ras protein was generally restricted to acanthous cells with strong staining in normal oral mucosa and well-differentiated carcinomas. In contrast, the p21ras protein was not detected in significant amounts in severely dysplastic lesions and poorly differentiated carcinomas. These results suggest that expression of p21ras is a normal feature of more fully differentiated tissues, both normal and neoplastic, and is not useful as an indicator of cell proliferation or 'malignant potential'.
Publisher: JSTOR
Date: 04-1994
DOI: 10.2307/3578780
Publisher: Springer Science and Business Media LLC
Date: 11-1987
DOI: 10.1007/BF00265663
Abstract: In idual susceptibility to the toxic effects of cigarette smoke may be modified by inherited variability in carcinogen metabolism. The purpose of the present study was to investigate pancreatic cancer risk associated with cigarette smoking and 33 variants within carcinogen metabolism genes and examine whether these variants modify the association between smoking and pancreatic cancer. A population-based study was conducted with 455 pancreatic cancer cases and 893 controls. Epidemiological and smoking data were collected from questionnaires and variants were genotyped by mass spectrometry. Age- and sex-adjusted odds ratio (ASOR) and multivariate-adjusted odds ratio (MVOR) estimates were obtained using multivariate logistic regression, and interactions between each variant and smoking were investigated. Current smoker status [MVOR = 2.29, 95% confidence interval (95% CI): 1.62, 3.22], 10-27 pack-years (MVOR = 1.57, 95% CI: 1.13, 2.18), >27 pack-years (MVOR = 1.77, 95% CI: 1.27, 2.46) and longer durations of smoking (19-32 years: MVOR = 1.46, 95% CI: 1.05, 2.05 >32 years: MVOR = 1.78, 95% CI: 1.30, 2.45) were associated with increased pancreatic cancer risk. CYP1B1-4390-GG (ASOR = 0.36, 95% CI: 0.15, 0.86) and Uridine 5'-diphospho glucuronosyltransferase 1 family, polypeptide A7-622-CT (ASOR = 0.77, 95% CI: 0.60, 0.99) were associated with reduced risk. N-acetyltransferase 1-640-GT/GG (ASOR = 1.75, 95% CI: 1.00, 3.05), GSTM1 (rs737497)-GG (ASOR = 1.41, 95% CI: 1.02, 1.95), GSTM1 gene deletion (ASOR = 4.89, 95% CI: 3.52, 6.79) and glutathione S-transferase theta-1 gene deletion (ASOR = 4.41, 95% CI: 2.67, 7.29) were associated with increased risk. Significant interactions were observed between pack-years and EPHX1-415 (P = 0.04) and smoking status and N-acetyltransferase 2-857 (P = 0.03). Variants of carcinogen metabolism genes are independently associated with pancreatic cancer risk and may modify the risk posed by smoking.
Publisher: Public Library of Science (PLoS)
Date: 11-02-2016
Publisher: Elsevier BV
Date: 03-2001
Publisher: Informa UK Limited
Date: 1985
DOI: 10.1080/09553008514550951
Abstract: Exposure of normal control and ataxia-telangiectasia (A-T) lymphoblastoid cell lines to ionizing radiation gives rise to an increase in the proportion of G2 phase cells. The size and extent of the G2 phase block is greater in A-T cells than in normal cells. Caffeine has a similar overall effect in control and A-T cell lines in reducing the G2 arrest observed after ionizing radiation. While the proportion of cells accumulated in G2 in A-T cells is considerably greater than in controls, addition of caffeine at the time of maximal G2 block brings about a return of G2 phase cell numbers to unirradiated values in 3 hours in both cell types. In normal control cells the caffeine-mediated decrease in G2 cells is reflected by an increase in mitotic cells. These mitotic cells have a higher frequency of chromosome aberrations compared to cells harvested in the absence of caffeine. Similarly in A-T cells addition of caffeine to irradiated cultures, delayed in G2 phase, increased the number of mitotic cells and the frequency of chromosome aberrations.
Publisher: Oxford University Press (OUP)
Date: 30-07-2009
DOI: 10.1093/HMG/DDP359
Abstract: Aprataxin, defective in the neurodegenerative disorder ataxia oculomotor apraxia type 1 (AOA1), is a DNA repair protein that processes the product of abortive ligations, 5' adenylated DNA. In addition to its interaction with the single-strand break repair protein XRCC1, aprataxin also interacts with poly-ADP ribose polymerase 1 (PARP-1), a key player in the detection of DNA single-strand breaks. Here, we reveal reduced expression of PARP-1, apurinic endonuclease 1 (APE1) and OGG1 in AOA1 cells and demonstrate a requirement for PARP-1 in the recruitment of aprataxin to sites of DNA breaks. While inhibition of PARP activity did not affect aprataxin activity in vitro, it retarded its recruitment to sites of DNA damage in vivo. We also demonstrate the presence of elevated levels of oxidative DNA damage in AOA1 cells coupled with reduced base excision and gap filling repair efficiencies indicative of a synergy between aprataxin, PARP-1, APE-1 and OGG1 in the DNA damage response. These data support both direct and indirect modulating functions for aprataxin on base excision repair.
Publisher: Wiley
Date: 20-08-2003
DOI: 10.1002/GCC.10261
Abstract: Although ATM, the protein defective in ataxia-telangiectasia (A-T), is activated primarily by radiation, there is also evidence that expression of the protein can be regulated by both radiation and growth factors. Computer analysis of the ATM promoter proximal 700-bp sequence reveals a number of potentially important cis-regulatory sequences. Using nucleotide substitutions to delete putative functional elements in the promoter of ATM, we examined the importance of some of these sites for both the basal and the radiation-induced activity of the promoter. In lymphoblastoid cells, most of the mutations in transcription factor consensus sequences [Sp1(1), Sp1(2), Cre, Ets, Xre, gammaIre(2), a modified AP1 site (Fse), and GCF] reduced basal activity to various extents, whereas others [gammaIre(1), NF1, Myb] left basal activity unaffected. In human skin fibroblasts, results were generally the same, but the basal activity varied up to 8-fold in these and other cell lines. Radiation activated the promoter approximately 2.5-fold in serum-starved lymphoblastoid cells, reaching a maximum by 3 hr, and all mutated elements equally blocked this activation. Reduction in Sp1 and AP1 DNA binding activity by serum starvation was rapidly reversed by exposure of cells to radiation. This reduction was not evident in A-T cells, and the response to radiation was less marked. Data provided for interaction between ATM and Sp1 by protein binding and co-immunoprecipitation could explain the altered regulation of Sp1 in A-T cells. The data described here provide additional evidence that basal and radiation-induced regulation of the ATM promoter is under multifactorial control.
Publisher: Elsevier BV
Date: 04-2005
Publisher: Informa UK Limited
Date: 25-11-2019
DOI: 10.1080/08820139.2019.1692864
Abstract: Ataxia-telangiectasia (A-T) is a rare autosomal recessive syndrome characterized by progressive cerebellar ataxia, oculocutaneous telangiectasia, immunodeficiency and cancer predisposition, caused by mutations in the ataxia telangiectasia mutated
Publisher: Elsevier BV
Date: 2005
DOI: 10.1016/J.MRFMMM.2004.04.020
Abstract: DNA double strand breaks represent the most threatening lesion to the integrity of the genome in cells exposed to ionizing radiation and radiomimetic chemicals. Those breaks are recognized, signaled to cell cycle checkpoints and repaired by protein complexes. The product of the gene (ATM) mutated in the human genetic disorder ataxia-telangiectasia (A-T) plays a central role in the recognition and signaling of DNA damage. ATM is one of an ever growing number of proteins which when mutated compromise the stability of the genome and predispose to tumour development. Mechanisms for recognising double strand breaks in DNA, maintaining genome stability and minimizing risk of cancer are discussed.
Publisher: Elsevier BV
Date: 07-1993
DOI: 10.1016/0378-1119(93)90282-8
Abstract: While sequence information is available for a number of eukaryotic protein phosphatase 1 (PP1)-encoding genes, the cloning and characterization of a complete human pp1 gene has not been reported. We have used two conserved regions within the pp1 family of genes to synthesize oligodeoxyribonucleotide primers for the lification of a 438-bp sequence from human mRNA. This DNA fragment was sequenced to verify that it corresponded to a pp1 cDNA and it was used to screen a human cDNA library to isolate a full-length clone. The deduced amino acid (aa) sequence identified a protein of 330 aa in length. Comparison with the rabbit pp1 cDNA sequence showed some nucleotide differences, largely at the third position of the codon, with complete concordance at the aa level. Northern blot analysis revealed an mRNA of approximately 1.6 kb.
Publisher: Wildlife Disease Association
Date: 04-1988
DOI: 10.7589/0090-3558-24.2.259
Abstract: The IDEIA Chlamydia Test, a commercially available antigen-capture enzyme-linked immunosorbent assay (ELISA) test, based on a monoclonal antibody for the detection of chlamydia in clinical specimens, was evaluated in a population of 65 free-ranging koalas in southeastern Queensland determined to be infected with Chlamydia psittaci. Compared to isolation of the organism in tissue culture, the sensitivity of the IDEIA test ranged from 3 to 11%, and the specificity from 90 to 97%. The results indicated that the IDEIA test is unsuitable for use as a diagnostic screening test for C. psittaci in free-ranging koalas.
Publisher: Springer Science and Business Media LLC
Date: 30-10-2001
Abstract: Mutations in the ATM gene lead to the genetic disorder ataxia-telangiectasia. ATM encodes a protein kinase that is mainly distributed in the nucleus of proliferating cells. Recent studies reveal that ATM regulates multiple cell cycle checkpoints by phosphorylating different targets at different stages of the cell cycle. ATM also functions in the regulation of DNA repair and apoptosis, suggesting that it is a central regulator of responses to DNA double-strand breaks.
Publisher: Oxford University Press (OUP)
Date: 1977
Abstract: Phytohemagglutinin stimulated human lymphocytes exhibit a 20 fold increase in DNA repair synthesis following ionizing radiation damage compared to the level of repair in unstimulated cells. The peak of repair synthesis coincides with that for DNA replication. Stimulated lymphocytes provide a relatively simple assay for ionizing radiation repair defects.
Publisher: Wiley
Date: 31-12-2020
Publisher: Informa UK Limited
Date: 1999
Abstract: To provide an update on the product of the ATM gene mutated in the human genetic disorder ataxia-telangiectasia (A-T). The product of the ATM gene mutated in the human genetic disorder A-T is a 350 kDa protein that plays a central role in the regulation of a number of cellular processes. It is a member of the phosphatidylinositol 3-kinase superfamily, but is more likely a protein kinase similar to another member of that family, i.e. DNA-dependent protein kinase (DNA-PK). A-T cells and fibroblasts derived from the atm -/- mouse are hypersensitive to ionizing radiation and defective in cell cycle checkpoint control. At present the nature of the lesion in damaged DNA recognized by ATM remains uncertain, but it is evident that a small number of residual strand breaks remain unrepaired in A-T cells, which may well account for the radiosensitivity. On the other hand, considerable progress has been achieved in delineating the role of ATM in cell cycle checkpoint control. Defects are observed at all cell cycle checkpoints in A-T cells post-irradiation. At the G1 /S interface ATM has been shown to play a central role in radiation-induced activation of the tumour suppressor gene product p53. ATM binds to p53 in a complex fashion and activates the molecule in response to breaks in DNA by phosphorylating it at serine 15 close to the N-terminus and by controlling other phosphorylation and dephosphorylation changes on the molecule. This in turn leads to the induction of p21/WAF1 and other p53 effector proteins before inhibition of cyclin-dependent kinase activity and G1 arrest. Emerging evidence supports a direct role for ATM at other cell cycle checkpoints. Other proteins interacting with ATM include c-Abl a protein tyrosine kinase, beta-adaptin an endosomal protein and p21 a downstream effector of p53. The significance of these interactions is currently being investigated. ATM also plays an important role in the regulation and surveillance of meiotic progression. The localization of ATM to both the nucleus and other subcellular organelles implicates this molecule in a myriad of cellular processes. ATM is involved in DNA damage recognition and cell cycle control in response to ionizing radiation damage. There is evidence that ATM may also have a more general signalling role.
Publisher: Springer Science and Business Media LLC
Date: 07-01-1999
Abstract: Cells from patients with the human genetic disorder ataxia-telangiectasia (A-T) are defective in the activation of cell cycle checkpoints in response to ionizing radiation damage. In order to understand the role of ATM in checkpoint control we investigated whether Schizosaccaromyces pombe chk1, a protein kinase implicated in controlling the G2 DNA damage checkpoint, might alter the radiosensitive phenotype in A-T cells. The fission yeast chkl gene was cloned into an EBV-based vector under the control of a metallothionein promoter and transfected into A-T lymphoblastoid cells. Induction of chk1 enhanced the survival of an A-T cell line in response to radiation exposure as determined by cell viability and reduction of radiation-induced chromosome aberrations. This can be accounted for at least in part by the restoration of the G2 checkpoint to chk1 expressing cells. There was no evidence that chk1 expression corrected either the G1/S checkpoint or radioresistant DNA synthesis in S phase in these cells. These results suggest that chk1 when overexpressed acts downstream from ATM to restore the G2 checkpoint in these cells and correct the radiosensitive phenotype. These data allow us to dissociate in idual checkpoint events and relate them to the radiosensitive phenotype in A-T cells.
Publisher: Elsevier BV
Date: 09-2013
DOI: 10.1016/J.CECA.2013.05.009
Abstract: We have previously reported that spectrin increases dramatically in amount and is assembled into the cytoskeleton in differentiating keratinocytes both in vitro and in vivo (Zhao et al., PLoS ONE 6 (12) (2011) e28267). We demonstrate here that extracellular calcium (Ca2+) enhances differentiation of keratinocytes and that this is associated with increased spectrin expression and formation of a spectrin-based cytoskeleton. While Retinoic acid (RA) also enhanced keratinocyte differentiation, it abrogated the spectrin-based cytoskeleton in keratinocytes. Furthermore, RA substantially inhibited expression of both Src and PI3K-p85α and consequently the amounts of specific phosphorylation of both of these proteins. RA also enhanced AKT expression and dramatically induced phosphorylation of AKT((Thr308)), accompanied by phosphorylation of both PKCδ((Thr505)) and β-adducin((Ser662)) and upregulated cyclin D2 and down-regulated cyclin B1. On the other hand, Ca2+ overcame the inhibitory effects of RA on expression of Src, PI3K-p85α and cyclin B1 by maintaining high levels of phosphorylation of both Src((Tyr527)) and PI3K-p85α and preventing phosphorylation of AKT((Thr308)), PKCδ((Thr505)) and β-adducin((Ser662)). These data highlight the importance of Ca2+ in both spectrin expression and the organizational integrity of the spectrin-based cytoskeleton in differentiating keratinocytes and assist in elucidating the signalling pathways involved.
Publisher: Springer Science and Business Media LLC
Date: 29-09-2015
Abstract: Senataxin, defective in ataxia oculomotor apraxia type 2, protects the genome by facilitating the resolution of RNA–DNA hybrids (R-loops) and other aspects of RNA processing. Disruption of this gene in mice causes failure of meiotic recombination and defective meiotic sex chromosome inactivation, leading to male infertility. Here we provide evidence that the disruption of Setx leads to reduced SUMOylation and disruption of protein localization across the XY body during meiosis. We demonstrate that senataxin and other DNA damage repair proteins, including ataxia telangiectasia and Rad3-related protein-interacting partner, are SUMOylated, and a marked downregulation of both ataxia telangiectasia and Rad3-related protein-interacting partner and TopBP1 leading to defective activation and signaling through ataxia telangiectasia and Rad3-related protein occurs in the absence of senataxin. Furthermore, chromodomain helicase DNA-binding protein 4, a component of the nucleosome remodeling and deacetylase chromatin remodeler that interacts with both ataxia telangiectasia and Rad3-related protein and senataxin was not recruited efficiently to the XY body, triggering altered histone acetylation and chromatin conformation in Setx −/− pachytene-staged spermatocytes. These results demonstrate that senataxin has a critical role in ataxia telangiectasia and Rad3-related protein- and chromodomain helicase DNA-binding protein 4-mediated transcriptional silencing and chromatin remodeling during meiosis providing greater insight into its critical role in gene regulation to protect against neurodegeneration.
Publisher: Elsevier BV
Date: 11-2004
DOI: 10.1016/J.BBRC.2004.09.145
Abstract: Serine/threonine protein kinase AMP-activated protein kinase (AMPK) is a key metabolic stress-responsive factor that promotes the adaptation of cells to their microenvironment. Elevated concentrations of intracellular AMP, caused by metabolic stress, are known to activate AMPK by phosphorylation of the catalytic subunit. Recently, the tumor suppressor serine/threonine protein kinase LKB1 was identified as an upstream kinases, AMPKKs. In the current study, we found that stimulation with growth factors also caused AMPK-alpha subunit phosphorylation. Interestingly, even an LKB1-nonexpressing cancer cell line, HeLa, exhibited growth factor-stimulated AMPK-alpha subunit phosphorylation, suggesting the presence of an LKB1-independent pathway for AMPK-alpha subunit phosphorylation. In the human pancreatic cancer cell line PANC-1, AMPK-alpha subunit phosphorylation promoted by IGF-1 was suppressed by antisense ataxia telangiectasia mutated (ATM) expression. We found that IGF-1 also induced AMPK-alpha subunit phosphorylation in the human normal fibroblast TIG103 cell line, but failed to do so in a human fibroblast AT2-KY cell line lacking ATM. Immunoprecipitates of ATM collected from IGF-1-stimulated cells also caused the phosphorylation of the AMPK-alpha subunit in vitro. IGF-1-stimulated ATM phosphorylation at both threonine and tyrosine residues, and our results demonstrated that the phosphorylation of tyrosine in the ATM molecule is important for AMPK-alpha subunit phosphorylation during IGF-1 signaling. These results suggest that IGF-1 induces AMPK-alpha subunit phosphorylation via an ATM-dependent and LKB1-independent pathway.
Publisher: Elsevier BV
Date: 03-2020
Publisher: American Association for the Advancement of Science (AAAS)
Date: 23-06-1995
Abstract: A gene, ATM, that is mutated in the autosomal recessive disorder ataxia telangiectasia (AT) was identified by positional cloning on chromosome 11q22-23. AT is characterized by cerebellar degeneration, immunodeficiency, chromosomal instability, cancer predisposition, radiation sensitivity, and cell cycle abnormalities. The disease is genetically heterogeneous, with four complementation groups that have been suspected to represent different genes. ATM, which has a transcript of 12 kilobases, was found to be mutated in AT patients from all complementation groups, indicating that it is probably the sole gene responsible for this disorder. A partial ATM complementary DNA clone of 5.9 kilobases encoded a putative protein that is similar to several yeast and mammalian phosphatidylinositol-3' kinases that are involved in mitogenic signal transduction, meiotic recombination, and cell cycle control. The discovery of ATM should enhance understanding of AT and related syndromes and may allow the identification of AT heterozygotes, who are at increased risk of cancer.
Publisher: Springer Science and Business Media LLC
Date: 27-03-1997
Abstract: We have studied gene expression during ascidian embryonic development using the technique of differential display and isolated partial cDNA sequences of 12 genes. Developmental regulation of these genes has been confirmed by northern hybridization analysis. Further cDNA cloning and sequence analysis of an mRNA that is present during gastrulation, neurulation and tailbud formation reveals that it encodes a novel serine protease containing a single kringle motif and catalytic domain. The spatial expression of this gene, designated Hmserp1, is restricted to precursor cells of the epidermis. The structure and expression of Hmserp1 is discussed in relation to possible functions during development.
Publisher: Springer Science and Business Media LLC
Date: 05-1988
DOI: 10.1007/BF00392663
Publisher: Elsevier BV
Date: 11-2004
Publisher: BMJ
Date: 08-1998
DOI: 10.1136/MP.51.4.224
Abstract: The gene mutated in ataxia telangiectasia (ATM) has an established tumour suppressor role in breast cancer. ATM appears to be expressed in most normal cells, including breast epithelium, where it has been postulated to have a nuclear role in cell cycle regulation following DNA damage. However, ATM is not upregulated after DNA damage. In this study, we demonstrate an absence of immunohistologically detectable levels of ATM in the normally quiescent myoepithelial cells that line normal breast ducts. This contrasts dramatically with the significant expression of ATM in the proliferative myoepithelium of sclerosing adenosis (n = 7). This upregulation of ATM suggests that ATM expression is coupled to the proliferative status of the myoepithelium. Our results also indicate that there are factors other than ATM gene mutations that can dramatically influence ATM expression in the breast and that these factors should be considered for their possible implications in carcinogenesis.
Publisher: Elsevier BV
Date: 09-1999
DOI: 10.1016/S0923-2508(99)00108-4
Abstract: Chlamydial infection is responsible for a wide spectrum of diseases of the eye, genitourinary tract, and lung. This group of organisms is also implicated in the pathogenesis of coronary artery disease as well as arthritis. Since cross-species infection is widely reported (though probably underestimated), it is an advantage to have a rapid and reliable method to detect all forms of chlamydiae in patient s les. We have identified a 160/163-bp DNA fragment in Chlamydia which is highly conserved in all chlamydial species. A polymerase chain reaction method based on this sequence has been developed to detect, in clinical s les, chlamydiae which have been shown to be positive by fluorescent-staining immunoassay this method can be utilized in combination with restriction endonuclease cleavage to identify in idual chlamydial species. Thus we have developed a sensitive and rapid detection method and have used it on s les from patients with respiratory and genital infections.
Publisher: Wiley
Date: 12-01-1990
DOI: 10.1111/J.1439-0450.1990.TB01099.X
Abstract: In order to elucidate whether natural infection of BLV in cattle might induce humoral immunological responses, changes in IgG 1 , IgG 2 and IgM concentrations in the sera of infected cattle were determined. Twelve BLV‐infected cattle were used. Cattle of different breeds were classified serologically and haematologically into BLV + PL + , BLV + PL − and BLV‐free groups. Ig concentrations in the sera of the three groups were quantitated using a commercial single radial immunodiffusion assay. The findings were compared to those of BLV‐free cattle. The serum IgM concentrations were significantly lower in cattle with PL (P 0.001) than in BLV + PL − and BLV‐free cattle. The IgM concentrations tended to be lower in BLV + PL − than those of BLV‐free cattle. There were no significant differences in IgG 1 and IgG 2 serum concentrations between the three experimental cattle groups. IgG 1 was the predominant subtype in the sera of all cattle groups.
Publisher: Oxford University Press (OUP)
Date: 10-02-2020
DOI: 10.1093/HMG/DDAA023
Abstract: Patients with ataxia-telangiectasia (A-T) lack a functional ATM kinase protein and exhibit defective repair of DNA double-stranded breaks and response to oxidative stress. We show that CRISPR/Cas9-assisted gene correction combined with piggyBac (PB) transposon-mediated excision of the selection cassette enables seamless restoration of functional ATM alleles in induced pluripotent stem cells from an A-T patient carrying compound heterozygous exonic missense/frameshift mutations, and from a patient with a homozygous splicing acceptor mutation of an internal coding exon. We show that the correction of one allele restores expression of ~ 50% of full-length ATM protein and ameliorates DNA damage-induced activation (auto-phosphorylation) of ATM and phosphorylation of its downstream targets, KAP-1 and H2AX. Restoration of ATM function also normalizes radiosensitivity, mitochondrial ROS production and oxidative-stress-induced apoptosis levels in A-T iPSC lines, demonstrating that restoration of a single ATM allele is sufficient to rescue key ATM functions. Our data further show that despite the absence of a functional ATM kinase, homology-directed repair and seamless correction of a pathogenic ATM mutation is possible. The isogenic pairs of A-T and gene-corrected iPSCs described here constitute valuable tools for elucidating the role of ATM in ageing and A-T pathogenesis.
Publisher: Elsevier BV
Date: 1993
Abstract: Exposure of the Burkitt's lymphoma cell line BM13674 cells to gamma-radiation or heat results in extensive DNA fragmentation and morphological changes characteristic of apoptosis. When cells were gamma-irradiated in the presence of calyculin A, a potent inhibitor of the catalytic subunit of phosphatases 1 and 2A, apoptosis was prevented. This was shown to be concentration dependent with maximal inhibition occurring at 20nM. Both DNA fragmentation and the morphological features characteristic of apoptosis were prevented by incubation with calyculin A. The concentration required to inhibit apoptosis (20 nM) was considerably less than that reported previously for okadaic acid (500 nM), also an inhibitor of phosphatase activity as well as apoptosis. In addition, while okadaic acid caused a marked condensation of nuclear material in both control and irradiated cells, while preventing apoptosis, no such changes in chromatin were evident in the presence of calyculin A. It is clear from these data and other results with protein synthesis inhibitors that the complete machinery for apoptosis, induced under certain conditions, preexists in the cell, and phosphatase activity plays a key role in this process.
Publisher: Elsevier BV
Date: 09-2016
Publisher: Frontiers Media SA
Date: 13-10-2017
Publisher: American Association for the Advancement of Science (AAAS)
Date: 22-10-2010
Abstract: The protein kinase ATM (ataxia-telangiectasia mutated) is a key component of the signaling pathway through which cells are protected from DNA damage. ATM becomes activated within a protein complex at sites of double-stranded breaks in DNA. ATM is also activated in response to increased production of reactive oxygen species (ROS). Such activation was thought to reflect DNA damage caused by ROS, but Guo et al. (p. 517 ) showed that ATM was in fact directly activated by ROS. A cysteine residue in ATM contributes to the formation of disulfide-linked dimers of activated ATM on exposure to ROS in vitro. Experiments using mutated forms of the enzyme suggested that two distinct mechanisms regulated ATM activity.
Publisher: Hindawi Limited
Date: 24-09-2002
DOI: 10.1002/HUMU.9068
Abstract: In vitro mutagenesis of large genes has proven to be difficult for a number of reasons, including the number of steps involved and the instability of large inserts. We describe here a single-step PCR method to introduce mutations into an ataxia-telangiectasia mutated (ATM) gene cDNA construct (20 kb). This involved several modifications of the Stratagene QuikChange Site-Directed Mutagenesis Kit. Four sites implicated in the function of ATM were mutagenised in a 20 kb plasmid, improving upon existing methods capable of mutagenesis in DNA constructs up to 13 kb, while maintaining a high efficiency of mutagenesis (85-100%). This approach makes it possible to introduce multiple mutations into large cDNA for structural/functional studies.
Publisher: Springer Science and Business Media LLC
Date: 26-02-2004
Publisher: American Association for Cancer Research (AACR)
Date: 09-2012
DOI: 10.1158/1535-7163.MCT-11-1044
Abstract: Glioblastoma multiforme (GBM) is the most common form of brain tumor with a poor prognosis and resistance to radiotherapy. Recent evidence suggests that glioma-initiating cells play a central role in radioresistance through DNA damage checkpoint activation and enhanced DNA repair. To investigate this in more detail, we compared the DNA damage response in nontumor forming neural progenitor cells (NPC) and glioma-initiating cells isolated from GBM patient specimens. As observed for GBM tumors, initial characterization showed that glioma-initiating cells have long-term self-renewal capacity. They express markers identical to NPCs and have the ability to form tumors in an animal model. In addition, these cells are radioresistant to varying degrees, which could not be explained by enhanced nonhomologous end joining (NHEJ). Indeed, NHEJ in glioma-initiating cells was equivalent, or in some cases reduced, as compared with NPCs. However, there was evidence for more efficient homologous recombination repair in glioma-initiating cells. We did not observe a prolonged cell cycle nor enhanced basal activation of checkpoint proteins as reported previously. Rather, cell-cycle defects in the G1–S and S-phase checkpoints were observed by determining entry into S-phase and radioresistant DNA synthesis following irradiation. These data suggest that homologous recombination and cell-cycle checkpoint abnormalities may contribute to the radioresistance of glioma-initiating cells and that both processes may be suitable targets for therapy. Mol Cancer Ther 11(9) 1863–72. ©2012 AACR.
Publisher: Oxford University Press (OUP)
Date: 03-08-2015
DOI: 10.1093/NAR/GKV754
Publisher: Oxford University Press (OUP)
Date: 02-04-2014
DOI: 10.1093/HMG/DDU141
Abstract: The MRE11/RAD50/NBN (MRN) complex plays a key role in detecting DNA double-strand breaks, recruiting and activating ataxia-telangiectasia mutated and in processing the breaks. Members of this complex also act as adaptor molecules for downstream signaling to the cell cycle and other cellular processes. Somewhat more controversial are the results to support a role for MRN in the ataxia-telangiectasia and Rad3-related (ATR) activation and signaling. We provide evidence that RAD50 is required for ATR activation in mammalian cells in response to DNA replication stress. It is in turn phosphorylated at a specific site (S635) by ATR, which is required for ATR signaling through Chk1 and other downstream substrates. We find that RAD50 phosphorylation is essential for DNA replication restart by promoting loading of cohesin at these sites. We also demonstrate that replication stress-induced RAD50 phosphorylation is functionally significant for cell survival and cell cycle checkpoint activation. These results highlight the importance of the adaptor role for a member of the MRN complex in all aspects of the response to DNA replication stress.
Publisher: Oxford University Press (OUP)
Date: 1989
Abstract: We have provided evidence recently for a defect in DNA topoisomerase II in ataxia--telangiectasia (A-T) lymphoblastoid cells. This study was initiated to investigate in greater detail the nature of this defect. Southern hybridization analysis was carried out on DNA from control and A-T Epstein--Barr virus-transformed lymphoblastoid cells. The pattern of digestion, using several restriction enzymes, was the same in both cell types. Expression of topoisomerase II mRNA occurred to the same extent and there was no difference in the size of mRNA between the cell types. Western blot analysis revealed that the same amount of a major band of topoisomerase II protein was present in A-T and control cells but there was evidence for a reduced amount of a lower-molecular-weight form in A-T only. Extraction and purification did not lead to alteration in size of the enzyme or in amount recovered.
Publisher: Wiley
Date: 04-2009
DOI: 10.1111/J.1754-9485.2009.02053.X
Abstract: Malignant myoepithelioma of the breast (MMB) is a rare and often aggressive disease with poor prognosis. Little is known regarding its optimal treatment and progression. We describe the clinical history of a woman following excision of a benign adenomyoepithelioma which recurred years later as a radioresistant malignant myoepithelioma with high levels of ataxia telangiectasia mutated protein and mutant p53 (Cys135Phe). MMB requires close follow-up and aggressive treatment. If adjuvant radiotherapy is adopted to improve local control, minimal postoperative delay and higher doses than for standard post-mastectomy radiation are recommended.
Publisher: Wiley
Date: 09-1988
Abstract: Activation and/or overexpression of the protein product of the ras gene family (p21ras) has been implicated in the development of various cancers, including bladder carcinoma. We have used the anti-p21ras monoclonal antibody, RAP-5, to assess the level and pattern of expression in formalin-fixed, paraffin-embedded tissue sections of both normal and malignant urothelium. All 14 random normal bladder biopsies and 67 of 68 transitional cell carcinomas of the urinary bladder were positively stained with the RAP-5 antibody. In normal urothelium, p21ras staining tended to be localized to the superficial cell layer. With increasing histological grade and/or depth of invasion of the tumour, a greater proportion of tissue sections demonstrated a staining pattern which was more uniform with respect to the different epithelial cell types. Serially diluting the primary antibody did not reveal any significant differences in the staining patterns observed. Despite the change in staining pattern with increasing grade, these results suggest that p21ras expression by itself is not a useful indicator of the malignant phenotype.
Publisher: Elsevier BV
Date: 1992
Publisher: Wiley
Date: 30-09-2005
DOI: 10.1111/J.1365-2141.2005.05744.X
Abstract: The snake venom group C prothrombin activators contain a number of components that enhance the rate of prothrombin activation. The cloning and expression of full-length cDNA for one of these components, an activated factor X (factor Xa)-like protease from Pseudonaja textilis as well as the generation of functional chimeric constructs with procoagulant activity were described. The complete cDNA codes for a propeptide, light chain, activation peptide (AP) and heavy chain related in sequence to mammalian factor X. Efficient expression of the protease was achieved with constructs where the AP was deleted and the cleavage sites between the heavy and light chains modified, or where the AP was replaced with a peptide involved in insulin receptor processing. In human kidney cells (H293F) transfected with these constructs, up to 80% of the pro-form was processed to heavy and light chains. Binding of the protease to barium citrate and use of specific antibodies demonstrated that gamma-carboxylation of glutamic acid residues had occurred on the light chain in both cases, as observed in human factor Xa and the native P. textilis protease. The recombinant protease caused efficient coagulation of whole citrated blood and citrated plasma that was enhanced by the presence of Ca2+. This study identified the complete cDNA sequence of a factor Xa-like protease from P. textilis and demonstrated for the first time the expression of a recombinant form of P. textilis protease capable of blood coagulation.
Publisher: Ovid Technologies (Wolters Kluwer Health)
Date: 07-2018
Publisher: American Society of Hematology
Date: 17-09-2009
Publisher: Springer Science and Business Media LLC
Date: 02-1988
DOI: 10.1007/BF00278178
Abstract: Cyclooxygenase-2 (COX-2) is up-regulated in most high-grade gliomas, and high COX-2 expression is associated with aggressive character and poor prognosis. However, the effect of COX-2 in human glioma cell lines is not well known. This study examined the effect of several stimuli, including interleukin-1beta (IL-1beta) and carcinogens, on COX-2 induction in normal astrocyte cells and human glioma cell lines U87MG, A172, and T98G. IL-1beta-induced COX-2 expression strongly at both protein and messenger ribonucleic acid levels in only the U87MG cells of the glioma cell lines. Furthermore, carcinogen induced COX-2 expression. Similar findings were also observed in normal human astrocyte cells. The U87MG glioma cell line is a good model for COX-2 induction in glioma cell lines.
Publisher: Springer Science and Business Media LLC
Date: 10-2007
DOI: 10.1007/S00018-007-7352-Z
Abstract: Envenomation from Australian elapid snakes results in a myriad of neurological effects due to post-synaptic neurotoxins that bind and inhibit nicotinic acetylcholine receptors (nAChRs) of neurons and muscle fibres. However, despite the significant physiological effects of these toxins, they have remained largely undercharacterised at the molecular level. This study describes the identification and comparative analysis of multiple neurotoxin isoforms from ten Australian snakes, including functional characterisation of two of these isoforms, Os SNTX-1 from Oxyuranus scutellatus and the more potent Pt LNTX-1 from Pseudonaja textilis. Electrophysiological recordings from adrenal chromaffin cells demonstrate that both neurotoxins act as competitive antagonists of nAChRs in a concentration-dependent manner. Their effects upon spontaneous and nerve-evoked membrane responses at the hibian neuromuscular junction provide further evidence that both toxins bind muscle nAChRs in an irreversible manner. This study represents one of the most comprehensive descriptions to date of the sequences and activity of in idual Australian elapid neurotoxins.
Publisher: Elsevier BV
Date: 07-1989
DOI: 10.1016/0006-291X(89)91957-8
Abstract: Following treatment of the human T-cell leukaemia line, CEM-C7, with the glucocorticoid, dexamethasone, a rapid decrease in viability occurred after 40 h which coincided with fragmentation of DNA in these cells. A similar pattern of DNA fragmentation was observed when these cells were gamma-irradiated or treated with cycloheximide. Distinct morphological changes occurred after treatment, indicating a form of cell death, regulated from within, termed apoptosis. A set of nuclear proteins ranging in size from 10-18 kDa appeared by 40 h following treatment with dexamethasone. Treatment of cells with gamma-irradiation or cycloheximide also produced the same protein pattern. This set of proteins, and a doublet approximately 55 kDa in size, had apparent nuclease activity which was not observed in untreated cells. However, protein microsequencing of these bands in the 10-18 kDa region revealed that they were histone proteins. These results cast doubt on a recent report which provided evidence that these proteins were induced nucleases.
Publisher: EMBO
Date: 02-2006
Publisher: Wiley
Date: 08-1998
DOI: 10.1046/J.1464-410X.1998.00736.X
Abstract: To assess the ability of a transferrin-adriamycin conjugate (Tf-ADR) to target transferrin receptor (TfR)-positive cancer cells selectively and to overcome drug resistance in bladder cancer cell lines. Two paired sets of cell lines were used: the first was Chinese hamster ovary (CHO) cells (TfR-negative TRVb cells, as a model for normal resting cells, and TRVb-1 cells which were transfected with human TfR), and the second was a pair of bladder cancer cell lines (ADR-sensitive MGH-U1 cells and ADR-resistant MGH-U1R cells). Cell survival curves were determined after treatment with ADR, Tf and Tf-ADR. MGH-U1, TRVb and TRVb-1 cells required similar concentrations of ADR and Tf-ADR for 50% inhibition of growth MGH-U1R cells were resistant to both ADR and TF-ADR. Tf-ADR did not prevent toxicity to the TfR-negative cells nor did it overcome the resistance of the ADR-resistant cells. These results imply that Tf-ADR does not provide a better cytotoxic drug delivery system for the treatment of bladder cancer.
Publisher: Springer Science and Business Media LLC
Date: 09-03-2007
Abstract: Several different autosomal recessive genetic disorders characterized by ataxia with oculomotor apraxia (AOA) have been identified with the unifying feature of defective DNA damage recognition and/or repair. We describe here the characterization of a novel form of AOA showing increased sensitivity to agents that cause single-strand breaks (SSBs) in DNA but having no gross defect in the repair of these breaks. Evidence for the presence of residual SSBs in DNA was provided by dramatically increased levels of poly (ADP-ribose)polymerase (PARP-1) auto-poly (ADP-ribosyl)ation, the detection of increased levels of reactive oxygen/nitrogen species (ROS/RNS) and oxidative damage to DNA in the patient cells. There was also evidence for oxidative damage to proteins and lipids. Although these cells were hypersensitive to DNA damaging agents, the mode of death was not by apoptosis. These cells were also resistant to TRAIL-induced death. Consistent with these observations, failure to observe a decrease in mitochondrial membrane potential, reduced cytochrome c release and defective apoptosis-inducing factor translocation to the nucleus was observed. Apoptosis resistance and PARP-1 hyperactivation were overcome by incubating the patient's cells with antioxidants. These results provide evidence for a novel form of AOA characterized by sensitivity to DNA damaging agents, oxidative stress, PARP-1 hyperactivation but resistance to apoptosis.
Publisher: Wiley
Date: 12-1992
Abstract: Gamma-radiation, tetrandrine, bistratene A, and cisplatin were all found to induce pronounced morphological changes characteristic of apoptosis and extensive DNA fragmentation in the human BM13674 cell line 8 h after treatment. Apoptosis induced in BM13674 cells by these erse agents was markedly inhibited by 1 microM okadaic acid, a tumour promoter that inhibits protein phosphatases 1 and 2A. This compound also inhibited the appearance of apoptosis in fresh human leukaemia cells that had been exposed to gamma-radiation. The inhibition of apoptosis was confirmed using fluorescence microscopy and DNA gel electrophoresis. Dephosphorylation of a limited number of proteins was shown to be associated with apoptosis and okadaic acid prevented these dephosphorylations. Previous studies on the BM13674 cell line showed that an inhibitor of protein synthesis failed to prevent apoptosis in these cells. The present data provides further support that posttranslational modification of proteins, in particular, phosphorylation/dephosphorylation status, plays an important role in inhibition/activation of programmed cell death in different human cells after exposure to several cytotoxic agents.
Publisher: Elsevier BV
Date: 2015
DOI: 10.1016/J.CELLSIG.2014.10.001
Abstract: Here, we report that siRNA transfection of β-adducin significantly disrupted the spectrin-based cytoskeleton and cytoskeletal arrangements of both β-adducin and PKCδ by substantially inhibiting the expression of β-adducin, spectrin and PKCδ proteins in differentiating keratinocytes. However, extracellular Ca2+ treatment blocked the inhibitory effects of the β-adducin siRNA. Ca2+ also prevented the significant down-regulation of two differentiation markers involucrin and K1/10 and the distinct up-regulation of proliferation marker K14 in β-adducin siRNA transfected keratinocytes. In addition, β-adducin knockdown resulted in a substantial reduction of epidermal growth factor receptor (EGFR), cadherin and β-catenin and enhanced phosphorylation of EGFR on tyrosine 1173 and Ca2+ prevented these changes. Furthermore, Ca2+ blocked the inhibitory effects of β-adducin siRNA on the expression of calmodulin, phosphorylated-calmodulin (P-CaM((Tyr138))) and myristoylated alanine-rich C-kinase substrate (MARCKS) in keratinocytes. Co-immunoprecipitation studies further revealed that calmodulin, not MARCKS, strongly interacted with EGFR, cadherin and β-catenin. Our data suggest that Ca2+ plays an important role in regulating the expression and function of β-adducin to sustain normal organization of the spectrin-based cytoskeleton and the differentiation properties in keratinocytes through the calmodulin/EGFR/cadherin signaling pathway.
Publisher: American Association for Cancer Research (AACR)
Date: 2015
DOI: 10.1158/1055-9965.EPI-14-0377
Abstract: Background: PCA3 is a long noncoding RNA (lncRNA) with unknown function, upregulated in prostate cancer. LncRNAs may be processed into smaller active species. We hypothesized this for PCA3. Methods: We computed feasible RNA hairpins within the BMCC1 gene (encompassing PCA3) and searched a prostate transcriptome for these. We measured expression using qRT-PCR in three cohorts of prostate cancer tissues (n = 60), exfoliated urinary cells (n = 484 with cancer and n = 166 controls), and in cell lines (n = 22). We used in silico predictions and RNA knockup to identify potential mRNA targets of short transcribed RNAs. Results: We predicted 13 hairpins, of which PCA3-shRNA2 was most abundant within the prostate transcriptome. PCA3-shRNA2 is located within intron 1 of PCA3 and appears regulated by androgens. Expression of PCA3-shRNA2 was upregulated in malignant prostatic tissues, exfoliated urinary cells from men with prostate cancer (13–273 fold change t test P & 0.003), and closely correlated to PCA3 expression (r = 0.84–0.93 P & 0.001). Urinary PCA3-shRNA2 (C-index, 0.75–0.81) and PCA3 (C-index, 0.78) could predict the presence of cancer in most men. PCA3-shRNA2 knockup altered the expression of predicted target mRNAs, including COPS2, SOX11, WDR48, TEAD1, and Noggin. PCA3-shRNA2 expression was negatively correlated with COPS2 in patient s les (r = −0.32 P & 0.001). Conclusion: We identified a short RNA within PCA3, whose expression is correlated to PCA3, which may target mRNAs implicated in prostate biology. Impact: This short RNA is stable ex vivo, suggesting a role as a robust biomarker. We identify cytoplasmic enrichment of this RNA and potential targeting of mRNAs implicated in prostate carcinogenesis. Cancer Epidemiol Biomarkers Prev 24(1) 268–75. ©2014 AACR.
Publisher: Elsevier BV
Date: 06-1999
Publisher: Elsevier BV
Date: 08-1978
Publisher: Oxford University Press (OUP)
Date: 06-1988
Publisher: Elsevier BV
Date: 09-2011
Publisher: Springer Science and Business Media LLC
Date: 02-05-2011
DOI: 10.1007/S00018-011-0683-9
Abstract: ATM is the most significant molecule involved in monitoring the genomic integrity of the cell. Any damage done to DNA relentlessly challenges the cellular machinery involved in recognition, processing and repair of these insults. ATM kinase is activated early to detect and signal lesions in DNA, arrest the cell cycle, establish DNA repair signaling and faithfully restore the damaged chromatin. ATM activation plays an important role as a barrier to tumorigenesis, metabolic syndrome and neurodegeneration. Therefore, studies of ATM-dependent DNA damage signaling pathways hold promise for treatment of a variety of debilitating diseases through the development of new therapeutics capable of modulating cellular responses to stress. In this review, we have tried to untangle the complex web of ATM signaling pathways with the purpose of pinpointing multiple roles of ATM underlying the complex phenotypes observed in AT patients.
Publisher: Wiley
Date: 12-2006
Abstract: The Australian elapid snakes are amongst the most venomous snakes in the world, but much less is known about the overall venom composition in comparison to Asian and American snakes. We have used a combined approach of cDNA cloning and 2-DE with MS to identify nerve growth factor (NGF) in venoms of the Australian elapid snakes and demonstrate its neurite outgrowth activity. While a single 730 nucleotide ORF, coding for a 243 amino acid precursor protein was detected in all snakes, use of 2-DE identified NGF proteins with considerable variation in molecular size within and between the different snakes. The variation in size can be explained at least in part by N-linked glycosylation. It is possible that these modifications alter the stability, activity and other characteristics of the snake NGFs. Further characterisation is necessary to delineate the function of the in idual NGF isoforms.
Publisher: Springer Science and Business Media LLC
Date: 1987
DOI: 10.1007/BF00229375
Abstract: Acyclic nucleoside phosphonates (ANPs), such as (S)-1-[(3-hydroxy-2-phosphonomethoxy)propyl)]cytosine (HPMPC), are an important group of broad-spectrum antiviral agents with activity against DNA viruses. In this report, we present the in vitro potencies of novel ANPs against gammaherpesviruses, including Kaposi's sarcoma-associated herpesvirus, Epstein-Barr virus (EBV), and three animal gammaherpesviruses. 1-(S)-[3-hydroxy-2-(phosphonomethoxy)propyl]-5-azacytosine (HPMP-5-azaC), (S)-9-[3-hydroxy-2-(phosphonomethoxy)propyl]-3-deazaadenine (3-deaza-HPMPA), and their cyclic derivatives have emerged as highly potent antigammaherpesvirus agents. Interestingly, cyclic prodrugs of ANPs exhibited reduced activities against EBV strain P3HR-1, but not against EBV strain Akata. Cell culture metabolism studies with HPMPC and cyclic HPMPC revealed that these differences were attributable to an altered drug metabolism in P3HR-1 cells after EBV reactivation and, more specifically, to a reduced hydrolysis of cyclic HPMPC by cyclic CMP phosphodiesterase. We did not correlate this effect with phosphodiesterase downregulation, or to functional mutations. Instead, altered cyclic AMP levels in P3HR-1 cells indicated a competitive inhibition of the phosphodiesterase by this cyclic nucleotide. Finally, both HPMPC and HPMP-5-azaC emerged as highly effective inhibitors in vivo through significant inhibition of murine gammaherpesvirus replication and dissemination. With the current need for potent antigammaherpesvirus agents, our findings underline the requirement of appropriate surrogate viruses for antiviral susceptibility testing and highlight HPMP-5-azaC as a promising compound for future clinical development.
Publisher: Elsevier BV
Date: 08-1994
DOI: 10.1016/0165-4608(94)90069-8
Abstract: Two assay systems, radiation-induced chromosome aberrations and flow cytometry, were compared for the detection of ataxia-telangiectasia (A-T) heterozygotes. In three A-T families, the frequencies of chromatid aberrations in phytohemagglutinin-stimulated blood lymphocytes after 1 Gy of gamma-irradiation were twofold higher in A-T homozygotes than in obligate A-T heterozygotes, which were in turn approximately twofold higher than in normal control cells. Other consanguineous relatives of A-T patients had intermediate levels of induced chromatid aberrations, suggesting that they were carriers of the gene. Matched Epstein-Barr virus-transformed lymphoblastoid cell lines from A-T homozygotes showed a greater radiation-induced accumulation in the G2 phase of the cell cycle than did control cells. In family B, both obligate heterozygotes had increased G2 delay, as did the one heterozygote available for family C, and two of the grandparents in that family were in the high range for G2 delay. Neither parent in family A had high G2 phase delay after irradiation although the induced chromatid aberrations were in the heterozygote valve range. These results show a good concordance between the two assay systems for A-T heterozygotes, with the chromatid aberrations somewhat more consistent.
Publisher: Wiley
Date: 17-12-2005
DOI: 10.1002/IJC.20760
Abstract: The identification of biomarkers capable of providing a reliable molecular diagnostic test for prostate cancer (PCa) is highly desirable clinically. We describe here 4 biomarkers, UDP-N-Acetyl-alpha-D-galactosamine transferase (GalNAc-T3 not previously associated with PCa), PSMA, Hepsin and DD3/PCA3, which, in combination, distinguish prostate cancer from benign prostate hyperplasia (BPH). GalNAc-T3 was identified as overexpressed in PCa tissues by microarray analysis, confirmed by quantitative real-time PCR and shown immunohistochemically to be localised to prostate epithelial cells with higher expression in malignant cells. Real-time quantitative PCR analysis across 21 PCa and 34 BPH tissues showed 4.6-fold overexpression of GalNAc-T3 (p = 0.005). The noncoding mRNA (DD3/PCA3) was overexpressed 140-fold (p = 0.007) in the cancer s les compared to BPH tissues. Hepsin was overexpressed 21-fold (p = 0.049, whereas the overexpression for PSMA was 66-fold (p = 0.047). When the gene expression data for these 4 biomarkers was combined in a logistic regression model, a predictive index was obtained that distinguished 100% of the PCa s les from all of the BPH s les. Therefore, combining these genes in a real-time PCR assay represents a powerful new approach to diagnosing PCa by molecular profiling. (Supplemental material for this article can be found on the International Journal of Cancer website at pages/0020-7136/suppmat/index.html.)
Publisher: Wiley
Date: 30-10-2002
DOI: 10.1046/J.1365-2141.2002.03878.X
Abstract: Two peptides, textilinins 1 and 2, isolated from the venom of the Australian common brown snake, Pseudonaja textilis textilis, are effective in preventing blood loss. To further investigate the potential of textilinins as antihaemorrhagic agents, we cloned cDNAs encoding these proteins. The isolated full-length cDNA (430 bp in size) was shown to code for a 59 amino acid protein, corresponding in size to the native peptide, plus an additional 24 amino acid propeptide. Six such cDNAs were identified, differing in nucleotide sequence in the coding region but with an identical propeptide. All six sequences predicted peptides containing six conserved cysteines common to Kunitz-type serine protease inhibitors. When expressed as glutathione S-transferase (GST) fusion proteins and released by cleavage with thrombin, only those peptides corresponding to textilinin 1 and 2 were active in inhibiting plasmin with Ki values similar to those of their native counterparts and in binding to plasmin less tightly than aprotinin by two orders of magnitude. Similarly, in the mouse tail vein blood loss model only recombinant textilinin 1 and 2 were effective in reducing blood loss. These recombinant textilinins have potential as therapeutic agents for reducing blood loss in humans, obviating the need for reliance on aprotinin, a bovine product with possible risk of transmissible disease, and compromising the fibrinolytic system in a less irreversible manner.
Publisher: Elsevier BV
Date: 02-2012
DOI: 10.1016/J.BIOCHI.2011.08.003
Abstract: As part of a wider study on Australian snake venom components, we have identified and characterised Kunitz-type protease inhibitors from the venoms of Oxyuranus scutellatus and Oxyuranus microlepidotus (Australian taipans) with plasma kallikrein inhibitory activity. Each inhibitor had a mass of 7 kDa and was purified from the venom as part of a protein complex. Mass spectrometry and N-terminal sequencing was employed to obtain amino acid sequence information for each inhibitor and a recombinant form of the O. scutellatus inhibitor, termed TSPI, was subsequently expressed and purified. TSPI was investigated for inhibition against a panel of 12 enzymes involved in haemostasis and estimates of the K(i) value determined for each enzyme. TSPI was found to be a broad spectrum inhibitor with most potent inhibitory activity observed against plasma kallikrein that corresponded to a K(i) of 0.057 ± 0.019 nM. TSPI also inhibited fibrinolysis in whole blood and prolonged the intrinsic clotting time. These inhibitors are also unique in that they appear to be found only in Oxyuranus sp. venoms.
Publisher: Springer New York
Date: 2017
DOI: 10.1007/978-1-4939-6955-5_29
Abstract: Reprogramming of cells enables generation of pluripotent stem cells and resulting progeny through directed differentiation, making this technology an invaluable tool for the study of human development and disease. Reprogramming occurs with a wide range of efficiency, a culmination of intrinsic and extrinsic factors including the tissue of origin, the passage number and culture history of the target cells. Another major factor affecting reprogramming is the methodology used and the quality of the reprogramming process itself, including for conventional viral-based approaches viral titer and subsequent viral transduction efficiency, including downstream transgene insertion and stoichiometry. Genetic background is an important parameter affecting the efficiency of the reprogramming process with reports that cells from in iduals harboring specific mutations are more difficult to reprogram than control counterparts.Ataxia-Telangiectasia (A-T) fibroblasts underwent reprogramming at reduced efficiency in contrast to their controls. To optimize reprogramming of fibroblasts from patients with A-T, we examined the response of A-T cells to various cell culture conditions after lentiviral transduction with reprogramming factors Oc4/Sox2 (pSIN4-EF2-O2S) and Klf4/c-Myc (pSIN4-CMV-K2M). Parameters included media type (KSR or serum-containing DMEM), treatment with a p53 inhibitor (small-molecule cyclic pifithrin-α), and either a low or high concentration of bFGF. Post-transduction, equivalent numbers of cells from heterozygote and homozygote patients were plated and assessed at regular intervals for survival and proliferation. Our findings indicate that A-T cells responded favorably to the addition of FCS and gradual weaning away from their native media into KSR-containing stem cell media that produced suitable conditions for their reprogramming. We examined a range of properties to identify and isolate good quality iPSCs including the expression status of important stem cell transcription factors/surface proteins, methylation levels at stem cell associated regulatory loci, persistence of transgenes, karyotype status, and teratoma-forming ability.
Publisher: Elsevier BV
Date: 02-2006
Publisher: Elsevier BV
Date: 06-1997
Publisher: Walter de Gruyter GmbH
Date: 11-03-2010
Abstract: Background: Obtaining a suitable specimen for analysis in a timely manner is pivotal in clinical chemistry service provision. Serum is recognized as the preferred specimen for most assays, but because of time constraints for completion of clotting and an increasing number of patients on anti-coagulant therapy, latent clotting or no clotting is an outcome which can lead to errors and delay in delivery of critical results. Although lithium heparin plasma has unique problems, it has become an alternative in hospital-based laboratories. Methods: The Becton-Dickinson (BD) rapid serum tube (RST) was evaluated in a hospital environment using a total of 53 participants, both healthy and anticoagulated, for 31 analytes against BD PST II and BD SST II tubes measured with Beckman DxC800 and DxI800 analyzers. Results: Most results from the RST tube were comparable with those from the SST II tube. Potassium results were closer to the PST II plasma concentrations. Incomplete and latent clotting was encountered in the RST specimens from participants (cardiac and dialysis) who had received a total of units of heparin [activated partial thromboplastin time (APTT) s], warfarin/heparin combination, and specimens from cardiac surgery patients who had received a total of ,000 units of heparin (APTT s) at the time of collection of specimens. Conclusions: The RST tube provides a suitable alternative to lithium heparin plasma tubes for most patients in a hospital environment. However, latent clotting continued to occur in specimens collected from participants who had received high concentrations of anticoagulants. Clin Chem Lab Med 2010 :651–7.
Publisher: Elsevier BV
Date: 11-1971
DOI: 10.1016/0005-2787(71)90691-5
Abstract: The purpose of this retrospective study was to determine the prevalence of hypodontia and to ascertain the need of interdisciplinary treatment for ensuing esthetic and functional problems in a target population of Al-Jouf Province, Saudi Arabia. Using a dental administration software tool, a total of 1267 patients who presented to the outpatient clinics of the Orthodontic and Prosthodontic Departments between March 2015 and January 2016 were identified. Of those, 694 were females and 573 were males. All permanent teeth were investigated, except third molars. The prevalence of hypodontia was 6.1%. The difference between genders was not statistically significant ( The prevalence of hypodontia in Al-Jouf Province, Saudi Arabia, was within the average values portrayed in the majority of the published literature. The majority of affected in iduals had one or two missing teeth. None of the patients examined had more than four missing teeth. There were no significant differences in the distribution of hypodontia between the affected jaws according to gender. Although less prevalent, considerable cases of bilateral missing teeth were found in the present study which necessitates the need for urgent interdisciplinary intervention and management.
Publisher: Elsevier BV
Date: 11-2018
DOI: 10.1016/J.FREERADBIOMED.2018.03.008
Abstract: Here we describe new fluorescent probes based on fluorescein and rhodamine that provide reversible, real-time insight into cellular redox status. The new probes incorporate bio-imaging relevant fluorophores derived from fluorescein and rhodamine linked with stable nitroxide radicals such that they cannot be cleaved, either spontaneously or enzymatically by cellular processes. Overall fluorescence emission is determined by reversible reduction and oxidation, hence the steady state emission intensity reflects the balance between redox potentials of critical redox couples within the cell. The permanent positive charge on the rhodamine-based probes leads to their rapid localisation within mitochondria in cells. Reduction and oxidation also leads to marked changes in the fluorophore lifetime, enabling monitoring by fluorescence lifetime imaging microscopy. Finally, we demonstrate that administration of a methyl ester version of the rhodamine-based probe can be used at concentrations as low as 5 nM to generate a readily detected response to redox stress within cells as analysed by flow cytometry.
Publisher: Springer New York
Date: 2017
DOI: 10.1007/978-1-4939-6955-5_28
Abstract: The molecular pathogenesis of ataxia-telangiectasia (A-T) is not yet fully understood, and a versatile cellular model is required for in vitro studies. The occurrence of continuous neurogenesis and easy access make the multipotent adult stem cells from the olfactory mucosa within the nasal cavity a potential cellular model. We describe an efficient method to establish neuron-like cells from olfactory mucosa biopsies derived from A-T patients for the purpose of studying the cellular and molecular aspects of this debilitating disease.
Publisher: Informa UK Limited
Date: 12-2003
Publisher: Springer Science and Business Media LLC
Date: 22-02-2019
DOI: 10.1038/S41598-019-38901-3
Abstract: Respiratory disease is a major cause of morbidity and mortality in patients with ataxia-telangiectasia (A-T) who are prone to recurrent sinopulmonary infections, bronchiectasis, pulmonary fibrosis, and pulmonary failure. Upper airway infections are common in patients and S. pneumoniae is associated with these infections. We demonstrate here that the upper airway microbiome in patients with A-T is different from that to healthy controls, with S. pneumoniae detected largely in patients only. Patient-specific airway epithelial cells and differentiated air-liquid interface cultures derived from these were hypersensitive to infection which was at least in part due to oxidative damage since it was partially reversed by catalase. We also observed increased levels of the pro-inflammatory cytokines IL-8 and TNF-α (inflammasome-independent) and a decreased level of the inflammasome-dependent cytokine IL-β in patient cells. Further investigation revealed that the ASC-Caspase 1 signalling pathway was defective in A-T airway epithelial cells. These data suggest that the heightened susceptibility of these cells to S. pneumoniae infection is due to both increased oxidative damage and a defect in inflammasome activation, and has implications for lung disease in these patients.
Publisher: Microbiology Society
Date: 08-1990
DOI: 10.1099/0022-1317-71-8-1737
Abstract: The molecular cloning and characterization of an EcoRI fragment, 8.26 kb in size, of an Australian isolate of bovine leukaemia virus (pBLV-A1) is described. This fragment includes most of the proviral genome as well as 340 bp of flanking bovine DNA sequence at the 5' end. Approximately 790 bp, including the 3' long terminal repeat, was missing from this clone. At the level of restriction enzyme mapping, this isolate could be distinguished from American, Belgian and Japanese isolates. DNA sequencing of the entire clone demonstrated some variation at the amino acid level between pBLV-A1 and the Japanese and Belgian isolates, particularly in the gag gene. In that gene there were 59 amino acid changes compared to the Japanese isolate and 24 compared to the Belgian isolate. The greater number in the case of the Japanese isolate was due to both single nucleotide changes and frameshift in a single region of the gene. This study also demonstrates that there are large tracts of amino acid sequence, particularly within the env and pol genes, that are highly conserved in different isolates. Some of these conserved sequences exist in regions containing epitopes important in virus infectivity.
Publisher: Elsevier BV
Date: 2021
Publisher: Springer Science and Business Media LLC
Date: 10-2008
DOI: 10.1038/NRM2514
Abstract: First described over 80 years ago, ataxia-telangiectasia (A-T) was defined as a clinical entity 50 years ago. Although not encountered by most clinicians, it is a paradigm for cancer predisposition and neurodegenerative disorders and has a central role in our understanding of the DNA-damage response, signal transduction and cell-cycle control. The discovery of the protein A-T mutated (ATM) that is deficient in A-T paved the way for rapid progress on understanding how ATM functions with a host of other proteins to protect against genome instability and reduce the risk of cancer and other pathologies.
Publisher: Elsevier BV
Date: 04-1997
DOI: 10.1016/S0967-5868(97)90060-6
Abstract: The prognosis for adult patients with astrocytomas remains poor. In recent years there has been a significant amount of research into the molecular mechanisms underlying the development and progression of these tumours. This review describes some of the oncogenes and tumour suppressor genes that are important in the development of astrocytoma, as well as the molecular mechanisms underlying angiogenesis and invasion. Possible clinical applications are described.
Publisher: Springer Science and Business Media LLC
Date: 12-1995
DOI: 10.1007/BF00347133
Publisher: Georg Thieme Verlag KG
Date: 2009
DOI: 10.1160/TH09-08-0050
Publisher: Wiley
Date: 02-1986
DOI: 10.1111/J.1464-410X.1986.TB05420.X
Abstract: An immunohistochemical profile of cells in the mucosa and lamina propria of adult human bladders is described. Urothelial cells were HLA-DR-ve, ACP + ve and ATPase-ve. All lymphocytes in this layer were of the suppressor/cytotoxic T subgroup and dendritic cells with an identical phenotype to Langerhans cells were seen. In the lamina propria most lymphocytes were of the suppressor/cytotoxic type with some helper/inducer cells. An occasional natural killer cell and Langerhans cell was identified and large macrophage cells with a common phenotype to antigen presenting interdigitating (ID) cells were noted. Fibronectin staining was dense in the vicinity of basement membranes merging to form fine interconnecting latticework-like structures elsewhere in the lamina propria.
Publisher: Elsevier BV
Date: 10-2004
Publisher: Walter de Gruyter GmbH
Date: 29-09-2018
Abstract: Incomplete blood clotting or latent clotting in serum is a common laboratory problem, especially for patients on anticoagulant therapy or when serum tubes are centrifuged before clotting is completed. We describe a novel approach to producing high-quality serum using snake venom prothrombin activator complex (OsPA) as an additive in blood collection tubes for non-anticoagulated (normal) in iduals. Plasma clotting assays were performed using a Hyland-Clotek instrument. Blood clotting was visually observed, and thromboelastography was also performed to determine the important parameters of coagulation. Thrombin generation was assayed using the chromogenic substrate S-2238, and biochemical analytes in the serum were determined on chemistry and immunoassay analysers. Fibrinogen was determined by either ELISA or Clauss fibrinogen assay. We initially showed that OsPA had strong coagulation activity in clotting not only recalcified citrated plasma and recalcified citrated whole blood, but also fresh whole blood in a clinical setting. The use of TEG clearly showed improved speed of clotting and generation of a firmer clot. We also showed that the use of OsPA to produce serum did not interfere with the determination of commonly measured biochemical analytes. The underlying clotting mechanism involves a burst of thrombin production at the initial stages of the clotting process upon contact with prothrombin in blood. These results demonstrate rapid generation of high-quality serum, contributing to faster turnaround times with standardised quality s les, for accurate analyte determinations in normal in iduals.
Publisher: Elsevier BV
Date: 05-2020
Publisher: Informa UK Limited
Date: 15-04-2007
DOI: 10.4161/CC.6.8.4180
Abstract: Well before the gene (ATM) mutated in the human genetic disorder ataxia-telangiectasia (A-T) was described it was evident from the clinical, molecular and cellular phenotype of A-T that this gene would play a central role in the DNA damage response. Mutation of ATM causes defective cell cycle checkpoint activation,a reduced capacity for repair of DNA double strand breaks and abnormal apoptosis, all of which contribute to the major features of A-T including genome instability, increased cancer risk and neurodegeneration. While the exact mechanism of activation remains unknown, it is clear that the Mre11 complex plays an important role both in the recruitment of ATM to the sites of DNA damage and in the efficient activation of ATM. Although ATM responds to agents that produce double strand breaks in DNA, other stimuli are also capable of ATM activation. The description of autophosphorylation on S1981 of ATM and the ensuing transition from an inactive dimer to an active monomer represents a major milestone in our understanding of the activation process. However, it is now evident that more than one autophosphorylation event is required and not surprisingly this process is also attenuated by phosphatases and other modifications such as acetylation are also implicated. This is further complicated by a recent report that autophosphorylation at S1987 (the mouse site corresponding to S1981) is dispensable for Atm activation in an Atm mutant mouse model. Use of cell extracts and in vitro approaches in the reconstruction of activation complexes have shed further light on what it takes to activate ATM. The aim here is to examine the evidence for the involvement of these various steps in ATM activation and attempt to put together a comprehensive picture of the overall process and its significance to DNA damage signaling.
Publisher: Wiley
Date: 08-2000
DOI: 10.1046/J.1440-1673.2000.00825.X
Abstract: The cases of two patients who suffered severe late effects of radiotherapy are reported each tested positive for elevated in vitro radiohypersensitivity (RHS) but negative for the ataxia-telangiectasia mutation. The first patient underwent surgery and postoperative radiotherapy for lung cancer and subsequently developed fatal myelopathy. The second patient underwent triple-modality therapy for cervical cancer and suffered highly symptomatic pelvic fibrosis. The value of the testing was that it increased the confidence in the diagnosis of radiation effects and enabled suitable treatment to proceed. An increasing role for clinical RHS testing is anticipated.
Publisher: Elsevier BV
Date: 06-2005
Publisher: Elsevier BV
Date: 10-1993
DOI: 10.1016/0378-1135(93)90183-8
Abstract: The native Australian marsupial Phascolarctos cinereus, otherwise known as the koala, is prone to infection by the obligate intracellular parasite Chlamydia psittaci, which causes ocular 'pink eye' and urogenital 'dirty tail' diseases. Several chlamydial DNA probes to both chromosomal and plasmid sequences were used to type by Southern blot analysis 51 s les taken from wild and captive koalas from habitats on the eastern seaboard of Australia as far apart as Queensland and Victoria. Two types of C. psittaci were observed and called types I and II. Type II was found more frequently than type I and occurred in both ocular and urogenital s les, while type I showed a strong but not absolute preference for ocular sites. Cross-hybridization analyses indicated that type I and type II had about 10% DNA sequence identity to each other. DNA analyses showed that type II was very closely related to some ovine and bovine chlamydiae but type I could not be related to any other C. psittaci strain available. Light and electron microscopic analyses of infected BGM monolayers revealed that the two strains were similar in morphological characteristics. The type I strain was considerably more infectious than the type II strain in BGM cells and in the yolk sacs of embryonated eggs. A PCR based assay detected both type I and type II koala chlamydiae in s les that had been negative by Southern blot and tissue culture and provided the first evidence that both types can occur simultaneously at the one site of infection.
Publisher: Elsevier BV
Date: 06-1997
Publisher: Elsevier BV
Date: 11-1986
DOI: 10.1016/0003-2697(86)90326-X
Abstract: A rapid procedure for the isolation of 3,4-dihydroxyphenylalanine-containing proteins has been developed in which the protein is selectively bound to a m-phenylboronate agarose column, and eluted with 1.0 M ammonium acetate, pH 3.0. The method is based on the affinity of boronates for diols including catechol. The chromatography is carried out in the absence of oxygen to prevent oxidation of the catechol. Other proteins are eluted beforehand with 0.25 M ammonium acetate, pH 8.5, or for glycoproteins with a Tris buffer containing 0.2 M sorbitol, pH 8.5.
Publisher: Wiley
Date: 12-01-1989
DOI: 10.1111/J.1439-0450.1989.TB00624.X
Abstract: Twelve sheep were experimentally infected with a phytohemagglutinin (PHA) treated short term culture of lymphocytes from a cow naturally infected with BLV at the PL stage. Five of 12 (42%) BLV infected sheep had histologically confirmed lymphosarcoma 10–16 months after infection. The PBL's were increased to leukemic levels 3–21 weeks before death due to lymphoblastic leukemia. Lymphocyte proliferation and appearance of immature lymphocytes and lymphoblastic cells in the blood were a characteristic feature of tumour development following inoculation with an Australian strain of BLV. In contrast to a number of previous studies the peripheral lymph nodes of all infected sheep were clinically normal throughout the experimental period but at death gross tumours were evident in the mesentric lymph nodes and the heart in all cases. All the other lymph nodes, liver, spleen, kidney and lung were histologically infiltrated with lymphoid tumour cells. Gross tumours were present in the abomasum (1 out of 5) in the urinary tract (2 out of 5) and in the uterus (1 out of 2). The majority of the tumour cells isolated from the various tissues were centroblastic demonstrating that the malignant leukemia in experimentally infected sheep was of a multicentric centroblastic type. The central nervous system was not involved in any case. Über die Bildung eines Lymphosarkoms bei Schafen, die mit Rinderleukämievirus (BLV) experimentell infiziert wurden Zwölf Schafe wurden mit einer mit Phytohämagglutinin (PHA) behandelten kurzzeitigen Lymphozytenkultur, gewonnen von einer mit Rinderleukämievirus (BLV) natürlich infizierten Kuh in dem präleukotischen Stadium, experimentell infiziert. 10–16 Monate nach der Infektion zeigten fünf von 12 mit Rinderleukämievirus (BLV) infizierten Schafen (42 %) ein histologisch nachweisbares Lymphosarkom. Auf Grund einer lymphoblastischen Leukämie erreichten die periphären Blutlymphozyten (PBL) 3–21 Wochen vor dem Eintritt des Todes leukämische Werte. Die Vermehrung von Lymphozyten und das Erscheinen unreifer Lymphozyten sowie lymphoblastischer Zellen im Blut waren, nach Impfung mit einem australischen BLV‐Stamm, für eine Tumorbildung charakteristisch. Im Gegensatz zu mehreren früheren Untersuchungen blieben die Lymphknoten aller infizierten Schafe während des gesamten Zeitraumes klinisch normal, aber bei allen Tieren wurden nach dem Tode große Tumoren in den Mesenteriallymphknoten und im Herzen festgestellt. Die anderen Lymphknoten, die Leber, die Milz, die Nieren und die Lungen waren alle mit lymphotischen Tumorzellen histologisch infiltriert. Große Tumoren konnten im Labmagen (1 von 5), im Harnapparat (2 von 5) und in der Gebärmutter (1 von 2) nachgewiesen werden. Die meisten Tumorzellen, die aus verschiedenen Geweben isoliert wurden, waren zentroblastisch. Dies zeigte, daß karzinogene Leukämie bei experimentell infizierten Schafen multizentrisch und zentroblastisch war. Das zentrale Nervensystem war nicht betroffen.
Publisher: Oxford University Press (OUP)
Date: 10-06-2009
DOI: 10.1093/HMG/DDP278
Abstract: Ataxia oculomotor apraxia type 2 (AOA2) is an autosomal recessive neurodegenerative disorder characterized by cerebellar ataxia and oculomotor apraxia. The gene mutated in AOA2, SETX, encodes senataxin, a putative DNA/RNA helicase which shares high homology to the yeast Sen1p protein and has been shown to play a role in the response to oxidative stress. To investigate further the function of senataxin, we identified novel senataxin-interacting proteins, the majority of which are involved in transcription and RNA processing, including RNA polymerase II. Binding of RNA polymerase II to candidate genes was significantly reduced in senataxin deficient cells and this was accompanied by decreased transcription of these genes, suggesting a role for senataxin in the regulation/modulation of transcription. RNA polymerase II-dependent transcription termination was defective in cells depleted of senataxin in keeping with the observed interaction of senataxin with poly(A) binding proteins 1 and 2. Splicing efficiency of specific mRNAs and alternate splice-site selection of both endogenous genes and artificial minigenes were altered in senataxin depleted cells. These data suggest that senataxin, similar to its yeast homolog Sen1p, plays a role in coordinating transcriptional events, in addition to its role in DNA repair.
Publisher: SAGE Publications
Date: 18-01-2016
Abstract: For the STroke Imaging Research (STIR) and VISTA-Imaging Investigators The purpose of this study was to collect precise information on the typical imaging decisions given specific clinical acute stroke scenarios. Stroke centers worldwide were surveyed regarding typical imaging used to work up representative acute stroke patients, make treatment decisions, and willingness to enroll in clinical trials. STroke Imaging Research and Virtual International Stroke Trials Archive-Imaging circulated an online survey of clinical case vignettes through its website, the websites of national professional societies from multiple countries as well as through email distribution lists from STroke Imaging Research and participating societies. Survey responders were asked to select the typical imaging work-up for each clinical vignette presented. Actual images were not presented to the survey responders. Instead, the survey then displayed several types of imaging findings offered by the imaging strategy, and the responders selected the appropriate therapy and whether to enroll into a clinical trial considering time from onset, clinical presentation, and imaging findings. A follow-up survey focusing on 6 h from onset was conducted after the release of the positive endovascular trials. We received 548 responses from 35 countries including 282 in idual centers 78% of the centers originating from Australia, Brazil, France, Germany, Spain, United Kingdom, and United States. The specific onset windows presented influenced the type of imaging work-up selected more than the clinical scenario. Magnetic Resonance Imaging usage (27–28%) was substantial, in particular for wake-up stroke. Following the release of the positive trials, selection of perfusion imaging significantly increased for imaging strategy. Usage of vascular or perfusion imaging by Computed Tomography or Magnetic Resonance Imaging beyond just parenchymal imaging was the primary work-up (62–87%) across all clinical vignettes and time windows. Perfusion imaging with Computed Tomography or Magnetic Resonance Imaging was associated with increased probability of enrollment into clinical trials for 0–3 h. Following the release of the positive endovascular trials, selection of endovascular only treatment for 6 h increased across all clinical vignettes.
Publisher: Springer Science and Business Media LLC
Date: 12-1998
Abstract: The molecular events involved in apoptosis induced by ionizing radiation remain unresolved. In this paper we show that the cleavage of fodrin to a 150 kDa fragment is an early proteolytic event in radiation-induced apoptosis in the Burkitts' Lymphoma cell line BL30A and requires 100 microM zVAD-fmk for inhibition. Caspases-1, -3, -6 and -7 were shown to cleave fodrin to the 150 kDa fragment in vitro and all were inhibited by 10 microM zVAD-fmk. We also show that the in vitro cleavage of fodrin by calpain is inhibited by 100 microM zVAD-fmk as was the calpain-mediated hydrolysis of casein. We demonstrate that calpain is activated within 15 min after radiation exposure, concomitant with the cleavage of fodrin to the 150 kDa fragment whereas caspase-3 is activated at 2 h correlating with the cleavage of fodrin to the 120 kDa fragment. These results support a role for calpain in the early phases of the radiation-induced apoptosis pathway, upstream of the caspases.
Publisher: Oxford University Press (OUP)
Date: 06-02-2007
DOI: 10.1093/BMB/LDM012
Abstract: Ataxia-telangiectasia (A-T) is a rare autosomal recessive genetic disorder characterized by progressive neurodegeneration, a high risk of cancer and immunodeficiency. These patients are also hypersensitive to radiotherapy. The gene product defective in this syndrome, ATM (ataxia-telangiectasia mutated), normally recognizes DNA damage and signal to the DNA repair machinery and the cell cycle checkpoints to minimize the risk of genetic damage. No curative strategy for this disease exists. Treatment has focused on slowing the progress of the neurodegeneration devising approaches for the treatment of tumours while minimizing side effects and treatment with immunoglobulin for the immunodeficiency. The most debilitating feature of this disorder is the progressive neurodegeneration due to loss of Purkinje cells in the cerebellum and malfunction of other neuronal cells. Correcting for the loss of Purkinje cells is technically very difficult and would require transplantation of embryonic stem cells. However, since it seems likely that oxidative stress may contribute to the neurodegeneration in A-T, potential therapies based on the use of antioxidants offer some hope. We describe the natural course of disease, some supportive therapeutic approaches already in use and those with potential based on our knowledge of molecular and cellular characteristics of this disorder.
Publisher: Elsevier BV
Date: 11-1996
Publisher: Informa UK Limited
Date: 1996
Abstract: We used differential display, a method designed to lify partial cDNA sequences from subsets of mRNAs, to identify mRNAs induced by ionizing radiation in human Epstein Barr Virus (EBV)-transformed lymphoblastoid cells. Increased expression of a cDNA corresponding to the inositol 1,4,5 trisphosphate receptor (InsP3R) type 1 was observed after exposure of cells to 3Gy gamma-rays. This was confirmed by Northern blot analysis. The increase in mRNA for InsP3R type 1 was accompanied by a corresponding increase in the level of InsP3R type 1 protein as determined by Western blotting. Exposure of cells from patients with the human genetic disorder ataxia-telangiectasia (A-T), characterized by hypersensitivity to ionizing radiation, failed to change the levels of InsP3R type 1 mRNA and, as expected, there was no increase in InsP3R type 1 protein in A-T cells in response to radiation exposure. Protein levels for two other InsP3Rs, types 2 and 3, were observed to increase in control and A-T cells after exposure to ionizing radiation. The induction of the InsP3R type 1, which is primarily located in the endoplasmic reticulum, may play an important role in radiation signal transduction.
Publisher: Springer Science and Business Media LLC
Date: 10-1979
DOI: 10.1038/BJC.1979.226
Abstract: The presence of ocular squamous-cell carcinomas in cattle was associated with significantly lower blastogenic response of peripheral-blood cultures to PHA than that of age-matched control cattle. The difference in blastogenic response was more marked when the external diameter of the tumour exceeded 2 cm. Cattle with aquamous-cell carcinomas had cell-mediated immunity against tumour extracts, as measured by the leucocyte adherence inhibition (LAI) microassay. The LAI reaction against tumour extracts was directly proportional to the general level of cell-mediated immunity as demonstrated by the lymphoproliferative response to PHA.
Publisher: BMJ
Date: 10-1999
DOI: 10.1136/MP.52.5.252
Abstract: The gene mutated in ataxia-telangiectasia (A-T), designated ATM (for "A-T mutated"), is believed to be associated with an increased risk of developing breast cancer. Most patients with A-T have null mutations of the ATM gene that appear to give rise to a truncated nonfunctional ATM protein. Therefore, the increased risk of breast cancer reported in A-T heterozygotes appears to be the result of haplo-insufficiency of ATM in breast tissues. This study aimed to determine whether reduced synthesis of ATM was also an important factor in sporadic breast cancer. Paraffin wax embedded tissues from patients with breast invasive ductal carcinoma (IDC) (n = 42), patients with ductal carcinoma in situ (DCIS) (n = 17), and others with lymph node metastases (n = 14) were studied. A streptavidin-biotin-peroxidase system was used to stain tissue sections for the ATM protein using the ATM-4BA and CT-1 polyclonal and monoclonal antibodies, respectively. The protein truncation test was used to screen for mutations in the ATM gene in those patients who had greatly reduced ATM protein immunoreactivity in the primary carcinoma (n = 3). Most metastatic breast carcinomas in lymph nodes (71%) had greatly reduced or absent ATM protein synthesis, which was significant when compared with that observed in non-metastatic invasive breast carcinomas (p = 0.029 chi 2 test). Although not significant (p = 0.045 chi 2 test), some sporadic breast carcinomas (14 of 42) also had reduced or absent ATM protein immunoreactivity. The protein truncation test did not reveal any gross ATM gene abnormality in the cases tested, indicating that the patients were not A-T heterozygotes, who are predisposed to breast cancer. A reduction in immunohistochemically detectable ATM protein in sporadic breast carcinoma implicates ATM in the progression of the disease.
Publisher: Rockefeller University Press
Date: 11-06-2007
Abstract: Adefective response to DNA damage is observed in several human autosomal recessive ataxias with oculomotor apraxia, including ataxia-telangiectasia. We report that senataxin, defective in ataxia oculomotor apraxia (AOA) type 2, is a nuclear protein involved in the DNA damage response. AOA2 cells are sensitive to H2O2, c tothecin, and mitomycin C, but not to ionizing radiation, and sensitivity was rescued with full-length SETX cDNA. AOA2 cells exhibited constitutive oxidative DNA damage and enhanced chromosomal instability in response to H2O2. Rejoining of H2O2-induced DNA double-strand breaks (DSBs) was significantly reduced in AOA2 cells compared to controls, and there was no evidence for a defect in DNA single-strand break repair. This defect in DSB repair was corrected by full-length SETX cDNA. These results provide evidence that an additional member of the autosomal recessive AOA is also characterized by a defective response to DNA damage, which may contribute to the neurodegeneration seen in this syndrome.
Publisher: Elsevier BV
Date: 06-2007
Publisher: Wiley
Date: 13-07-2006
Publisher: Elsevier BV
Date: 09-1989
DOI: 10.1016/0921-8777(89)90023-2
Abstract: Recent reports from a number of laboratories have linked radiosensitivity in ataxia telangiectasia (A-T) to a large and prolonged block of some cells in G2 phase. Previous results from this laboratory, largely with one Epstein-Barr virus-transformed A-T lymphoblastoid cell line, presented evidence for a dramatic increase in the number of cells in G2 phase over controls during a 24-h period post irradiation. We describe here a study of the effect of gamma-radiation on G2 phase delay in several A-T cell lines. Based on previous results with several cell lines 24 h post irradiation was selected as the optimum time to discriminate between G2 phase delay in control and A-T cells. All A-T homozygotes showed a significantly greater number of cells in G2 phase, 24 h post irradiation, than observed in controls. A more prolonged delay in G2 phase after irradiation was seen in different A-T cell types that included lymphoblastoid cells, fibroblasts and SV40-transformed fibroblasts. At the radiation dose used it was not possible to distinguish A-T heterozygotes from controls.
Publisher: Bioscientifica
Date: 23-05-2014
DOI: 10.1530/ERC-14-0234
Publisher: American Association for Cancer Research (AACR)
Date: 03-2005
DOI: 10.1158/0008-5472.CAN-04-3451
Abstract: Previous reports have suggested a connection between reduced levels of the catalytic subunit of DNA-dependent protein kinases (DNA-PKcs), a component of the nonhomologous DNA double-strand breaks end-joining system, and a reduction in ATM. We studied this possible connection in other DNA-PKcs–deficient cell types, and following knockdown of DNA-PKcs with small interfering RNA, Chinese hamster ovary V3 cells, lacking DNA-PKcs, had reduced levels of ATM and hSMG-1, but both were restored after transfection with PRKDC. Atm levels were also reduced in murine scid cells. Reduction of ATM in a human glioma cell line lacking DNA-PKcs was accompanied by defective signaling through downstream substrates, post-irradiation. A large reduction of DNA-PKcs was achieved in normal human fibroblasts after transfection with two DNA-PKcs small interfering RNA sequences. This was accompanied by a reduction in ATM. These data were confirmed using immunocytochemical detection of the proteins. Within hours after transfection, a decline in PRKDC mRNA was seen, followed by a more gradual decline in DNA-PKcs protein beginning 1 day after transfection. No change in ATM mRNA was observed for 2 days post-transfection. Only after the DNA-PKcs reduction occurred was a reduction in ATM mRNA observed, beginning 2 days post-transfection. The amount of ATM began to decline, starting about 3 days post-treatment, then it declined to levels comparable to DNA-PKcs. Both proteins returned to normal levels at later times. These data illustrate a potentially important cross-regulation between the nonhomologous end-joining system for rejoining of DNA double-strand breaks and the ATM-dependent damage response network of pathways, both of which operate to maintain the integrity of the genome.
Publisher: Elsevier BV
Date: 07-2010
DOI: 10.1016/J.FREERADBIOMED.2010.03.019
Abstract: Changes to the redox status of biological systems have been implicated in the pathogenesis of a wide variety of disorders. Sensitive quantification of these changes has been developed using a novel fluorescent probe containing a redox-sensitive nitroxide moiety. As well as being able to selectively detect the superoxide radical in vitro, this method can measure overall changes to the cellular redox environment using flow cytometry on the basis of nitroxide reduction. The reversible nature of the probe's detection mechanism offers the unique advantage of being able to monitor redox changes in both oxidizing and reducing directions in real time.
Publisher: Oxford University Press (OUP)
Date: 1989
Abstract: To evaluate the effect the type of hip fracture (femoral neck or trochanteric) has on the Health-Related Quality of Life of elderly subjects. Forty-five patients with hip fractures (mean 74.30 +/- 7.12 years), 24 with a femoral neck fracture and 21 with a trochanteric fracture, completed the 36-item Short Form Health Survey (SF-36) at baseline and four months after fracture. The Health-Related Quality of Life scores were compared according to fracture type, undisplaced and displaced femoral neck fractures, and stable and unstable trochanteric fractures. Compared to baseline, all patients scored lower in the physical functioning, role limitation-physical, bodily pain and vitality categories four months after the fracture had occurred. The SF-36 scores for all the scales did not differ significantly between patients with femoral neck versus trochanteric fractures, or between patients with displaced versus undisplaced femoral neck fractures and stable versus unstable trochanteric fractures. The mental and physical quality of life of elderly patients with a hip fracture is severely impaired one month after fracture, with partial recovery by the end of the fourth month. The negative impact on the Health-Related Quality of Life did not differ significantly according to fracture type.
Publisher: Elsevier BV
Date: 2020
Publisher: Springer Science and Business Media LLC
Date: 10-1996
DOI: 10.1007/BF01920107
Abstract: Cancer stem cells (CSCs) are thought to play important roles in carcinogenesis, recurrence, metastasis, and therapy-resistance. We have successfully induced cancer stem-like sphere cells (CSLCs) which possess enhanced chemoresistance and metastatic potential. To enable the development of targeted therapy against CSLCs, we identified a gene responsible for this phenotype in CSLC. Human hepatoma cell line SK-HEP-1 was used for CSLC induction with a unique sphere inducing medium, and HuH-7 cells were used as non-sphere forming cells in the same condition. RNA-sequencing was performed followed by validation with quantitative RT-PCR and western blotting. Knockdown experiments were done by using CRISPR-Cas9 genome-editing, and the rescue experiments were performed using the expressing plasmid vector. Chemoresistance and liver metastasis of the cells, was studied following the splenic injection of cells to severely immune deficient mice and evaluated using the MTS assay. Quantification of exosomes in the medium was done using ELISA. RAB3B was identified as an up-regulated gene in both CSLCs and prognostically poor hepatocellular carcinoma (HCC) by RNA-sequencing. RAB3B-KD cells showed altered CSLC phenotypes such as sphere formation, chemoresistance, and metastatic potentials, and those were rescued by RAB3B complementation. Increased exosome secretion was observed in CSLCs, and it was not observed in the RAB3B-KD cells. In addition, the RAB3B expression correlated with the expression of ABCG2, APOE, LEPR, LXN, and TSPAN13. The up regulation of RAB3B may play an important role in the chemoresistance and metastatic potential of CSLCs.
Publisher: Wiley
Date: 12-01-1989
DOI: 10.1111/J.1439-0450.1989.TB00658.X
Abstract: This study was designed to determine the relative infectivity of lymphocytes and secretions from BLV‐infected cattle with and without persistent lymphocytosis (BLV + PL + and BLV + PL − ). Ninety‐seven sheep of mixed sex and age were assembled into 21 experimental groups. The recipient sheep were inoculated intravenously with serial dilutions of whole blood, saliva or nasal secretions from BLV + PL + and BLV + PL − donor cows. Between 200 to 20,000 cells from single and mixed BLV + PL + or single and mixed BLV + PL − donor cattle were used for inoculation. A very small number of BLV‐infected lymphocytes (200 cells) was sufficient to induce BLV infection in sheep inoculated with diluted whole blood from BLV + PL + cattle. The inoculation of whole blood (containing up to 20,000 lymphocyte cells) from BLV + PL − cattle did not induce BLV infection in recipient sheep. Saliva and nasal secretions also failed to bring about BLV transmission. Eine experimentelle Infektion von Schafen mit bovinem Leukämievirus: eine Untersuchung über die Infektiosität von Blut, Speichel‐ und Nasensekreten Die relative Infektiosität von Lymphozyten und Sekreten von mit BLV infizierten Rindern mit persistierender oder ohne persistierende Lymphozytose (BLV+PL+ und BLV+PL‐) wurde untersucht. Siebenundneunzig Schafe gemischten Geschlechts und Alters wurden in 21 Versuchsgruppen eingeteilt. Die Empfängertiere wurden mit gleichmäßig abgestuften Serienverdünnungen aus Ganz‐blut, Speichel‐ und Nasensekreten, die von Rindern mit BLV+PL+ gewonnen wurden, intravenös inokuliert. Zwischen 200 und 20 000 Zellen von Rindern mit entweder einer einfachen oder gemischten BLV+PL+ bzw. BLV+PL‐ Infektion wurden auf die Schafe überimpft. Eine sehr geringe Anzahl von mit BLV infizierten Lymphozyten (200 Zellen) reichte aus, um bei Schafen, die mit verdünntem Ganzblut von Rindern mit BLV+PL+ geimpft wurden, eine BLV‐Infektion hervorzurufen. Eine Impfung mit Ganzblut (mit bis zu 20 000 Lymphozytenzellen), gewonnen von Rindern mit BLV+PL‐, rief bei den Empfängertieren keine Infektion mit BLV hervor. Auch nach Impfung mit Speichel‐ und Nasensekreten fand keine Übertragung von BLV statt.
Publisher: Springer Science and Business Media LLC
Date: 10-1998
DOI: 10.1038/2690
Abstract: The development of prophylactic vaccines against retroviral diseases has been impeded by the lack of obvious immune correlates for protection. Cytotoxic T-lymphocyte (CTL), CD4-lymphocyteS, chemokine and/or antibody responses have all been associated with protection against HIV and AIDS however, effective and safe vaccination strategies remain elusive. Here we show that vaccination with a minimal ovine CTL peptide epitope identified within gp51 of the retrovirus bovine leukemia virus (BLV), consistently induced peptide-specific CTLs. Only sheep whose CTLs were also capable of recognizing retrovirus-infected cells were fully protected when challenged with BLV. This retrovirus displays limited sequence variation thus, in the relative absence of confounding CTL escape variants, virus-specific CTLs targeting a single epitope were able to prevent the establishment of a latent retroviral infection.
Publisher: American Thoracic Society
Date: 08-2017
Publisher: Wiley
Date: 02-1993
DOI: 10.1111/J.1445-2197.1993.TB00060.X
Abstract: Bacillus Calmette-Guérin (BCG) is currently thought to act as a biological immune modifier in effecting antitumour activity. Recent evidence suggests that BCG binding to fibronectin (FN), a tissue glycoprotein, may be a prerequisite step in initiating this response. Drugs inhibiting the availability of exposed FN in the bladder after urothelial disruption may adversely affect the efficacy of BCG. Data are presented of 45 patients with tumour limited to mucosa (pTa) or carcinoma in situ (CIS) given intravesical BCG therapy, with (group 1) or without (group 2) fibrin clot-inhibiting drugs concurrently during treatment. The success rate of 11.1% for group 1 (1/9) patients was significantly less than that of 69.4% for group 2 (25/36), (chi 2 = 7.79, P < 0.01 Fisher's exact test) supporting the suggestion that the concurrent administration of fibrin-clot inhibiting drugs may adversely affect the outcome of BCG therapy.
Publisher: Elsevier BV
Date: 03-2012
DOI: 10.1016/J.TOXICON.2010.12.010
Abstract: Snake venoms are attractive for drug discovery and development, with a number of therapeutics derived from snake venom either in clinical use or in development. Recognising this opportunity, Australian biopharmaceutical company QRxPharma Ltd and its subsidiary Venomics Pty Ltd (VPL) has partnered with the University of Queensland (UQ) to screen and develop drug candidates from Australian elapid snake venoms. VPL has three haemostasis candidates in early preclinical development. Textilinin-1 (Q8008) is a 7 kDa potent and selective plasmin inhibitor that has application as an anti-fibrinolytic agent to reduce blood loss associated with complex surgeries. Haempatch™ (Q8009) is a Factor Xa-like protein that displays potent procoagulant effects and is being developed as a topical haemostatic agent to reduce blood loss resulting from surgery or trauma. CoVase™ (V0801) is a procoagulant cofactor that may have application as a systemic anti-bleeding agent in the treatment of internal bleeding and non-compressible haemorrhage. This review focuses on drug discovery from Australian elapid snake venoms, with emphasis on the QRxPharma/VPL drug discovery project undertaken in collaboration with UQ and candidates at further stages of development.
Publisher: Elsevier BV
Date: 03-2003
Publisher: Wiley
Date: 11-1997
DOI: 10.1002/(SICI)1097-0177(199711)210:3<264::AID-AJA7>3.0.CO;2-E
Abstract: Cerebral amyloid angiopathy (CAA) is an age-related small vessel disease, characterised pathologically by progressive deposition of amyloid β in the cerebrovascular wall. The Boston criteria are used worldwide for the in-vivo diagnosis of CAA but have not been updated since 2010, before the emergence of additional MRI markers. We report an international collaborative study aiming to update and externally validate the Boston diagnostic criteria across the full spectrum of clinical CAA presentations. In this multicentre, hospital-based, retrospective, MRI and neuropathology diagnostic accuracy study, we did a retrospective analysis of clinical, radiological, and histopathological data available to sites participating in the International CAA Association to formulate updated Boston criteria and establish their diagnostic accuracy across different populations and clinical presentations. Ten North American and European academic medical centres identified patients aged 50 years and older with potential CAA-related clinical presentations (ie, spontaneous intracerebral haemorrhage, cognitive impairment, or transient focal neurological episodes), available brain MRI, and histopathological assessment for CAA diagnosis. MRI scans were centrally rated at Massachusetts General Hospital (Boston, MA, USA) for haemorrhagic and non-haemorrhagic CAA markers, and brain tissue s les were rated by neuropathologists at the contributing sites. We derived the Boston criteria version 2.0 (v2.0) by selecting MRI features to optimise diagnostic specificity and sensitivity in a prespecified derivation cohort (Boston cases 1994-2012, n=159), then externally validated the criteria in a prespecified temporal validation cohort (Boston cases 2012-18, n=59) and a geographical validation cohort (non-Boston cases 2004-18 n=123), comparing accuracy of the new criteria to the currently used modified Boston criteria with histopathological assessment of CAA as the diagnostic standard. We also assessed performance of the v2.0 criteria in patients across all cohorts who had the diagnostic gold standard of brain autopsy. The study protocol was finalised on Jan 15, 2017, patient identification was completed on Dec 31, 2018, and imaging analyses were completed on Sept 30, 2019. Of 401 potentially eligible patients presenting to Massachusetts General Hospital, 218 were eligible to be included in the analysis of 160 patient datasets from other centres, 123 were included. Using the derivation cohort, we derived provisional criteria for probable CAA requiring the presence of at least two strictly lobar haemorrhagic lesions (ie, intracerebral haemorrhages, cerebral microbleeds, or foci of cortical superficial siderosis) or at least one strictly lobar haemorrhagic lesion and at least one white matter characteristic (ie, severe visible perivascular spaces in centrum semiovale or white matter hyperintensities in a multispot pattern). The sensitivity and specificity of these criteria were 74·8% (95% CI 65·4-82·7) and 84·6% (71·9-93·1) in the derivation cohort, 92·5% (79·6-98·4) and 89·5% (66·9-98·7) in the temporal validation cohort, 80·2% (70·8-87·6) and 81·5% (61·9-93·7) in the geographical validation cohort, and 74·5% (65·4-82·4) and 95·0% (83·1-99·4) in all patients who had autopsy as the diagnostic standard. The area under the receiver operating characteristic curve (AUC) was 0·797 (0·732-0·861) in the derivation cohort, 0·910 (0·828-0·992) in the temporal validation cohort, 0·808 (0·724-0·893) in the geographical validation cohort, and 0·848 (0·794-0·901) in patients who had autopsy as the diagnostic standard. The v2.0 Boston criteria for probable CAA had superior accuracy to the current Boston criteria (sensitivity 64·5% [54·9-73·4] specificity 95·0% [83·1-99·4] AUC 0·798 [0·741-0854] p=0·0005 for comparison of AUC) across all in iduals who had autopsy as the diagnostic standard. The Boston criteria v2.0 incorporate emerging MRI markers of CAA to enhance sensitivity without compromising their specificity in our cohorts of patients aged 50 years and older presenting with spontaneous intracerebral haemorrhage, cognitive impairment, or transient focal neurological episodes. Future studies will be needed to determine generalisability of the v.2.0 criteria across the full range of patients and clinical presentations. US National Institutes of Health (R01 AG26484).
Publisher: Elsevier BV
Date: 08-2013
DOI: 10.1016/J.DNAREP.2013.04.014
Abstract: Patients with ataxia-telangiectasia (A-T) are characterised by genome instability, cancer predisposition and a progressive neurodegeneration. A number of model systems have been developed for A-T but none recapitulate all the phenotype. The majority of these models have been generated in mice. While Atm deficient mouse models exhibit much of the phenotype described in patients with A-T, the broad consensus is that they do not display the most debilitating aspect of A-T, i.e. neurodegeneration. Cerebellar atrophy is one of the neuronal characteristics of A-T patients due to defects in neuronal development and progressive loss of Purkinje and granule cells. This is not evident in Atm-deficient mutants but there are multiple reports on neurological abnormalities in these mice. The focus of this review is to evaluate the appropriateness of Atm mutant mouse models for A-T, particularly with reference to neurological abnormalities and how they might relate to neurodegeneration.
Publisher: Springer Science and Business Media LLC
Date: 05-1997
DOI: 10.1038/387520A0
Abstract: The gene mutated in the autosomal recessive disorder ataxia telangiectasia (AT), designated ATM (for 'AT mutated'), is a member of a family of phosphatidylinositol-3-kinase-like enzymes that are involved in cell-cycle control, meiotic recombination, telomere length monitoring and DNA-damage response. Previous results have demonstrated that AT cells are hypersensitive to ionizing radiation and are defective at the G1/S checkpoint after radiation damage. Because cells lacking the protein tyrosine kinase c-Abl are also defective in radiation-induced G1 arrest, we investigated the possibility that ATM might interact with c-Abl in response to radiation damage. Here we show that ATM binds c-Abl constitutively in control cells but not in AT cells. Our results demonstrate that the SH3 domain of c-Abl interacts with a DPAPNPPHFP motif (residues 1,373-1,382) of ATM. The results also reveal that radiation-induction of c-Abl tyrosine kinase activity is diminished in AT cells. These findings indicate that ATM is involved in the activation of c-Abl by DNA damage and this interaction may in part mediate radiation-induced G1 arrest.
Publisher: No publisher found
Date: 1994
DOI: 10.1016/0378-1119(94)90796-X
Abstract: DNA encoding the major outer membrane protein (MOMP) of the koala type-I strain of Chlamydia psittaci (pathogen responsible for blindness and infertility in koalas) was cloned and sequenced. Comparison with momp gene sequences from other chlamydial species revealed a remarkable degree of homology (> 97%) with that of the human pathogen, Chlamydia pneumoniae. In comparison, the sequence only shared 75% DNA sequence homology with other C. psittaci members and 69% homology with C. trachomatis. The open reading frame consisted of 1167 bp encoding a 389-amino acid (aa) pre-MOMP including a leader sequence of 23 aa, similar to the C. pneumoniae gene. These genes were closely related even within the four variable domains (86-100% homology). Specific antibodies were capable of distinguishing between koala type I and C. pneumoniae. This very high degree of relatedness between C. pneumoniae, a human pathogen, and an in idual strain of C. psittaci in the momp gene raises further questions on the host specificity, classification and evolutionary relationships of the different chlamydial species.
Publisher: The Company of Biologists
Date: 28-10-2010
DOI: 10.1242/DMM.004689
Abstract: Ataxia telangiectasia (A-T) is a neurodegenerative disease caused by mutations in the large serine-threonine kinase ATM. A-T patients suffer from degeneration of the cerebellum and show abnormal elevation of serum alpha-fetoprotein. Here, we report a novel signaling pathway that links ATM via cAMP-responsive-element-binding protein (CREB) to the transcription factor ZFHX3 (also known as ATBF1), which in turn promotes survival of neurons by inducing expression of platelet-derived growth factor receptor β (PDGFRB). Notably, AG1433, an inhibitor of PDGFRB, suppressed the activation of ATM under oxidative stress, whereas AG1433 did not inhibit the response of ATM to genotoxic stress by X-ray irradiation. Thus, the activity of a membrane-bound tyrosine kinase is required to trigger the activation of ATM in oxidative stress, independent of the response to genotoxic stress. Kainic acid stimulation induced activation of ATM in the cerebral cortex, hippoc us and deep cerebellar nuclei (DCN), predominately in the cytoplasm in the absence of induction of γ-H2AX (a marker of DNA double-strand breaks). The activation of ATM in the cytoplasm might play a role in autophagy in protection of neurons against oxidative stress. It is important to consider DCN of the cerebellum in the etiology of A-T, because these neurons are directly innervated by Purkinje cells, which are progressively lost in A-T.
Publisher: Elsevier BV
Date: 03-2000
Publisher: Wiley
Date: 12-2009
DOI: 10.1002/PROS.21068
Publisher: Elsevier BV
Date: 09-2006
DOI: 10.1016/J.FREERADBIOMED.2006.06.018
Abstract: Mutations in the ATM gene (mutated in ataxia telangiectasia) in both humans and mice predispose to lymphoid tumors. A defect in this gene also causes neurodegeneration in humans and a less severe neurological phenotype in mice. There is some evidence that oxidative stress contributes to these defects, suggesting that antioxidants could alleviate the phenotype. We demonstrate here that the antioxidant 5-carboxy-1,1,3,3-tetramethylisoindolin-2-yloxyl (CTMIO) dramatically delays the onset of thymic lymphomas in Atm(-/-) mice which is not due to an enhancement of apoptosis by CTMIO. We also show that this compound corrects neurobehavioral deficits in these mice and reduces oxidative damage to Purkinje cells. The likely mechanism of action of CTMIO is due to a reduction in oxidative stress, which is protective against both the tumor progression and the development of neurological abnormalities. These data suggest that antioxidant therapy has considerable potential in the management of ataxia telangiectasia and possibly other neurodegenerative disorders where oxidative stress is implicated.
Publisher: American Society for Cell Biology (ASCB)
Date: 05-2001
Abstract: Exposure to DNA-damaging agents triggers signal transduction pathways that are thought to play a role in maintenance of genomic stability. A key protein in the cellular processes of nucleotide excision repair, DNA recombination, and DNA double-strand break repair is the single-stranded DNA binding protein, RPA. We showed previously that the p34 subunit of RPA becomes hyperphosphorylated as a delayed response (4–8 h) to UV radiation (10–30 J/m 2 ). Here we show that UV-induced RPA-p34 hyperphosphorylation depends on expression of ATM, the product of the gene mutated in the human genetic disorder ataxia telangiectasia (A-T). UV-induced RPA-p34 hyperphosphorylation was not observed in A-T cells, but this response was restored by ATM expression. Furthermore, purified ATM kinase phosphorylates the p34 subunit of RPA complex in vitro at many of the same sites that are phosphorylated in vivo after UV radiation. Induction of this DNA damage response was also dependent on DNA replication inhibition of DNA replication by aphidicolin prevented induction of RPA-p34 hyperphosphorylation by UV radiation. We postulate that this pathway is triggered by the accumulation of aberrant DNA replication intermediates, resulting from DNA replication fork blockage by UV photoproducts. Further, we suggest that RPA-p34 is hyperphosphorylated as a participant in the recombinational postreplication repair of these replication products. Successful resolution of these replication intermediates reduces the accumulation of chromosomal aberrations that would otherwise occur as a consequence of UV radiation.
Publisher: Elsevier BV
Date: 02-2001
Publisher: Springer Science and Business Media LLC
Date: 10-12-2007
Abstract: The recognition and repair of DNA double-strand breaks (DSBs) is a complex process that draws upon a multitude of proteins. This is not surprising since this is a lethal lesion if left unrepaired and also contributes to genome instability and the consequential risk of cancer and other pathologies. Some of the key proteins that recognize these breaks in DNA are mutated in distinct genetic disorders that predispose to agent sensitivity, genome instability, cancer predisposition and/or neurodegeneration. These include members of the Mre11 complex (Mre11/Rad50/Nbs1) and ataxia-telangiectasia (A-T) mutated (ATM), mutated in the human genetic disorder A-T. The mre11 (MRN) complex appears to be the major sensor of the breaks and subsequently recruits ATM where it is activated to phosphorylate in turn members of that complex and a variety of other proteins involved in cell-cycle control and DNA repair. The MRN complex is also upstream of ATM and ATR (A-T-mutated and rad3-related) protein in responding to agents that block DNA replication. To date, more than 30 ATM-dependent substrates have been identified in multiple pathways that maintain genome stability and reduce the risk of disease. We focus here on the relationship between ATM and the MRN complex in recognizing and responding to DNA DSBs.
Publisher: Oxford University Press (OUP)
Date: 28-06-2012
Abstract: Pluripotent stem cells can differentiate into every cell type of the human body. Reprogramming of somatic cells into induced pluripotent stem cells (iPSCs) therefore provides an opportunity to gain insight into the molecular and cellular basis of disease. Because the cellular DNA damage response poses a barrier to reprogramming, generation of iPSCs from patients with chromosomal instability syndromes has thus far proven to be difficult. Here we demonstrate that fibroblasts from patients with ataxia-telangiectasia (A-T), a disorder characterized by chromosomal instability, progressive neurodegeneration, high risk of cancer, and immunodeficiency, can be reprogrammed to bona fide iPSCs, albeit at a reduced efficiency. A-T iPSCs display defective radiation-induced signaling, radiosensitivity, and cell cycle checkpoint defects. Bioinformatic analysis of gene expression in the A-T iPSCs identifies abnormalities in DNA damage signaling pathways, as well as changes in mitochondrial and pentose phosphate pathways. A-T iPSCs can be differentiated into functional neurons and thus represent a suitable model system to investigate A-T-associated neurodegeneration. Collectively, our data show that iPSCs can be generated from a chromosomal instability syndrome and that these cells can be used to discover early developmental consequences of ATM deficiency, such as altered mitochondrial function, that may be relevant to A-T pathogenesis and amenable to therapeutic intervention.
Publisher: Elsevier BV
Date: 03-2016
Publisher: Oxford University Press (OUP)
Date: 14-12-2009
DOI: 10.1093/NAR/GKP1149
Publisher: Elsevier BV
Date: 12-1981
DOI: 10.1016/0027-5107(81)90209-8
Abstract: The ability of a number of Epstein-Barr virus-transformed lymphoblastoid cells from ataxia telangiectasis (AT) patients to repair gamma-radiation damage to DNA was determined. All of these AT cells were previously shown to be hypersensitive to gamma-radiation. Two methods were used to determine DNA-repair synthesis: isopycnic gradient analysis and a method employing hydroxyurea to inhibit semiconservative DNA synthesis. Control, AT heterozygote and AT homozygote cells were demonstrated to have similar capacities for repair of radiation damage to DNA. In addition at high radiation doses (10-40 krad) the extent of inhibition of DNA synthesis was similar in the different cell types.
Publisher: Springer Science and Business Media LLC
Date: 03-1991
DOI: 10.1007/BF01314319
Publisher: Informa UK Limited
Date: 1982
DOI: 10.1080/09553008214550561
Abstract: Previous results from this laboratory have shown that phytohaemagglutinin-stimulated bovine lymphocytes exhibit a peak of ultraviolet-induced DNA repair synthesis 3 to 4 days after addition of mitogen. The level of repair synthesis was approximately tenfold higher than that in unstimulated lymphocytes. We have extended these studies to examine the rate of repair of strand breaks in U.V.-irradiated bovine lymphocytes. The extent of breakage of DNA was shown to be the same in mitogen-stimulated and unstimulated lymphocytes from two breeds of cattle, when determined by sedimentation of nucleoids on sucrose gradients. However, in mitogen-stimulated cells the time taken to repair DNA strand breaks was 6 hours compared to 12 hours in stationary phase lymphocytes after a U.V. dose of 5 J/m2. These results suggest that the increased rate of repair of strand breaks is due to the induction of enzymes involved at the post-incision stage of DNA repair. Thus the increased level of repair synthesis observed in earlier work correlates with an increased rate of repair of DNA strand breaks in phytohaemagglutinin-stimulated bovine lymphocytes.
Publisher: Informa UK Limited
Date: 1976
DOI: 10.1080/09553007614550621
Abstract: Mouse neuroblastoma cells, which can be induced to undergo reversible differentiation in culture, have been used as a model to investigate the effects of ultra-violet (U.V.) radiation on terminally-differentiated nerve cells. Differentiated neuroblastoma cells were found to be extremely sensitive to U.V.-radiation when compared with proliferating cells from the same clone. However, normal resistance was regained if the differentiated cells were allowed to proceed to the next G1 phase of the cell-cycle before irradiation. Neuroblastoma cells in the differentiated mode are capable of carrying out soem excision repair of DNA damage, but they appear to lack a repair mechanism present in proliferating cells.
Publisher: Springer Science and Business Media LLC
Date: 26-08-2002
DOI: 10.1038/NG958
Publisher: Springer Science and Business Media LLC
Date: 19-07-2001
Abstract: There is evidence that ATM plays a wider role in intracellular signalling in addition to DNA damage recognition and cell cycle control. In this report we show that activation of the EGF receptor is defective in ataxia-telangiectasia (A-T) cells and that sustained stimulation of cells with EGF downregulates ATM protein in control cells but not in A-T cells expressing mutant protein. Concomitant with the downregulation of ATM, DNA-binding activity of the transcription factor Sp1 decreased in controls after EGF treatment but increased from a lower basal level in A-T cells to that in untreated control cells. Mutation in two Sp1 consensus sequences in the ATM promoter reduced markedly the capacity of the promoter to support luciferase activity in a reporter assay. Overexpression of anti-sense ATM cDNA in control cells decreased the basal level of Sp1, which in turn was increased by subsequent treatment of cells with EGF, similar to that observed in A-T cells. On the other hand full-length ATM cDNA increased the basal level of Sp1 binding in A-T cells, and in response to EGF Sp1 binding decreased, confirming that this is an ATM-dependent process. Contrary to that observed in control cells there was no radiation-induced change in ATM protein in EGF-treated A-T cells and likewise no alteration in Sp1 binding activity. The results demonstrate that EGF-induced downregulation of ATM (mutant) protein in A-T cells is defective and this appears to be due to less efficient EGFR activation and abnormal Sp1 regulation.
Publisher: Elsevier BV
Date: 03-1990
Publisher: Wiley
Date: 09-2005
Publisher: JSTOR
Date: 04-1994
DOI: 10.2307/3578761
Publisher: Elsevier BV
Date: 07-1999
DOI: 10.1016/S1357-2725(99)00028-X
Abstract: Ataxia-telangiectasia mutated (ATM) is the product of the gene mutated in the human genetic disorder ataxia-telangeictasia (A-T). It is a 370 kDa protein that is a member of the phosphatidyl inositol 3-kinases superfamily. A-T cells and those derived from Atm-/- mice are characterized by hypersensitivity to ionizing radiation and defective cell cycle checkpoints. Defects are observed at all cell cycle checkpoints in A-T cells post-irradiation including the G1/S interface where ATM plays an important role in the activation of the tumour suppressor gene product p53. Activation leads to the induction of p21/WAF1, inhibition of cyclin-dependent kinase activity, failure to phosphorylate key substrates such as the retinoblastoma protein and consequently G1 arrest. ATM also plays an important role in the regulation and surveillance of meiotic progression. Absence of ATM gives rise to a spectrum of defects including immunodeficiency, neurodegeneration, radiosensitivity and cancer predisposition. It is clear that a better definition of the role of ATM in DNA damage recognition, cell cycle control and cell signalling may assist in the treatment of the progressive neurodegeneration in this syndrome.
Publisher: Springer Science and Business Media LLC
Date: 18-02-2019
Publisher: Public Library of Science (PLoS)
Date: 12-08-2010
Publisher: Springer Science and Business Media LLC
Date: 1994
DOI: 10.1007/BF00686269
Publisher: Wiley
Date: 05-1982
DOI: 10.1111/J.1751-1097.1982.TB02630.X
Abstract: Dromedary camels are the most likely source for the coronavirus that sporadically causes Middle East respiratory syndrome (MERS) in humans. Serological results from archived camel sera provide evidence for circulation of MERS coronavirus (MERS-CoV) among dromedary camels in the Greater Horn of Africa as far back as 1983 and in Saudi Arabia as far back as 1992. High seroprevalences of MERS-CoV antibodies and the high virus prevalence in Saudi Arabian dromedary camels indicate an endemicity of the virus in the Arabian Peninsula, which predates the 2012 human MERS index case. Saudi Arabian dromedary camels show significantly higher MERS-CoV carrier rates than dromedary camels imported from Africa. Two MERS-CoV lineages identified in Nigerian camels were found to be genetically distinct from those found in camels and humans in the Middle East. This supports the hypothesis that camel imports from Africa are not of significance for circulation of the virus in camel populations of the Arabian Peninsula.
Publisher: Elsevier BV
Date: 05-1990
DOI: 10.1016/0006-2952(90)90528-S
Abstract: The biological effects of cytotoxic macrolide polyethers, the bistratenes, isolated from the ascidian Lissoclinum bistratum, have been examined. Bistratene A was toxic to HL-60 human promyelocytic leukemia cells with an IC50 value of 424 nM. At lower concentrations (10-100 nM), bistratene A induced the incomplete differentiation of these cells along the monocyte/macrophage pathway. These effects were not due to inhibition of DNA synthesis. Bistratene B had similar effects to bistratene A. At micromolar concentrations these compounds enhance the phospholipid-dependent activity of type II protein kinase C from bovine spleen. The bistratenes provide new probes for studying the molecular mechanisms governing cell growth and differentiation.
Publisher: Elsevier BV
Date: 03-2011
Publisher: Springer Science and Business Media LLC
Date: 1986
DOI: 10.1007/BF00419734
Abstract: This report details the case of a 67-year-old man who required intubation following a fall and multiple rib fractures and underwent surgical tracheostomy. Postoperatively, he deteriorated on the intensive care unit with airway obstruction. Bronchoscopy demonstrated tracheostomy cuff herniation obstructing airflow necessitating conventional orotracheal reintubation. On inspection of the tracheostomy an unusual cuff deformation was noted.
Publisher: Elsevier BV
Date: 09-2016
DOI: 10.1016/J.CCT.2016.06.014
Abstract: Atorvastatin and metformin are known energy restricting mimetic agents that act synergistically to produce molecular and metabolic changes in advanced prostate cancer (PCa). This trial seeks to determine whether these drugs favourably alter selected parameters in men with clinically-localized, aggressive PCa. This prospective phase II randomized, controlled window trial is recruiting men with clinically significant PCa, confirmed by biopsy following multiparametric MRI and intending to undergo radical prostatectomy. Ethical approval was granted by the Royal Brisbane and Women's Hospital Human and The University of Queensland Medical Research Ethics Committees. Participants are being randomized into four groups: metformin with placebo atorvastatin with placebo metformin with atorvastatin or placebo alone. Capsules are consumed for 8weeks, a duration selected as the most appropriate period in which histological and biochemical changes may be observed while allowing prompt treatment with curative intent of clinically significant PCa. At recruitment and prior to RP, participants provide blood, urine and seminal fluid. A subset of participants will undergo 7Tesla magnetic resonance spectroscopy to compare metabolites in-vivo with those in seminal fluid and biopsied tissue. The primary end point is biochemical evolution, defined using biomarkers (serum prostate specific antigen PCA3 and citrate in seminal fluid and prostatic tissue). Standard pathological assessment will be undertaken. This study is designed to assess the potential synergistic action of metformin and atorvastatin on PCa tumour biology. The results may determine simple methods of tumour modulation to reduce disease progression.
Publisher: Proceedings of the National Academy of Sciences
Date: 22-07-1997
Abstract: A gene mutated in the human genetic disorder ataxia-telangiectasia (A-T), ATM, was recently identified by positional cloning. ATM is a member of the phosphatidylinositol-3-kinase superfamily, some of which are protein kinases and appear to have important roles in cell cycle control and radiation signal transduction. We describe herein, to our knowledge, for the first time, the cloning of a full-length cDNA for ATM and correction of multiple aspects of the radio-sensitive phenotype of A-T cells by transfection with this cDNA. Overexpression of ATM cDNA in A-T cells enhanced the survival of these cells in response to radiation exposure, decreased radiation-induced chromosome aberrations, reduced radio-resistant DNA synthesis, and partially corrected defective cell cycle checkpoints and induction of stress-activated protein kinase. This correction of the defects in A-T cells provides further evidence of the multiplicity of effector functions of the ATM protein and suggests possible approaches to gene therapy.
Publisher: ScienceOpen
Date: 2010
Publisher: Radiation Research Society
Date: 06-2005
DOI: 10.1667/RR3374
Abstract: To study the dynamics of protein recruitment to DNA lesions, ion beams can be used to generate extremely localized DNA damage within restricted regions of the nuclei. This inhomogeneous spatial distribution of lesions can be visualized indirectly and rapidly in the form of radiation-induced foci using immunocytochemical detection or GFP-tagged DNA repair proteins. To analyze faster protein translocations and a possible contribution of radiation-induced chromatin movement in DNA damage recognition in live cells, we developed a remote-controlled system to obtain high-resolution fluorescence images of living cells during ion irradiation with a frame rate of the order of seconds. Using scratch replication labeling, only minor chromatin movement at sites of ion traversal was observed within the first few minutes of impact. Furthermore, time-lapse images of the GFP-coupled DNA repair protein aprataxin revealed accumulations within seconds at sites of ion hits, indicating a very fast recruitment to damaged sites. Repositioning of the irradiated cells after fixation allowed the comparison of live cell observation with immunocytochemical staining and retrospective etching of ion tracks. These results demonstrate that heavy-ion radiation-induced changes in subnuclear structures can be used to determine the kinetics of early protein recruitment in living cells and that the changes are not dependent on large-scale chromatin movement at short times postirradiation.
Publisher: Oxford University Press (OUP)
Date: 23-04-2014
DOI: 10.1093/HMG/DDU190
Publisher: Oxford University Press (OUP)
Date: 1990
Abstract: Ascidians, primitive chordates that have retained features of the likely progenitors to all vertebrates, are a useful model to study the evolutionary relationship of chordates to other animals. We have selected the well characterized ribosomal RNA (rRNA) genes to investigate this relationship, and we describe here the cloning and characterization of an entire ribosomal DNA (rDNA) tandem repeat unit from a lower chordate, the ascidian Herdmania momus. rDNA copy number and considerable sequence differences were observed between two H. momus populations. Comparison of rDNA primary sequence and rRNA secondary structures from H. momus with those from other well characterized organisms, demonstrated that the ascidians are more closely related to other chordates than invertebrates. The rDNA tandem repeat makes up a larger percentage (7%) of the genome of this animal than in other higher eukaryotes. The total length of the spacer and transcribed region in H. momus rDNA is small compared to most higher eukaryotes, being less than 8 kb, and the intergenic spacer region consists of smaller internal repeats. Comparative analysis of rDNA sequences has allowed the construction of secondary structures for the 18S, 5.8S and 26S rRNAs.
Publisher: Oxford University Press (OUP)
Date: 28-11-2017
DOI: 10.1189/JLB.4VMA0716-316R
Abstract: Mutations in the ataxia-telangiectasia (A-T)-mutated (ATM) gene give rise to the human genetic disorder A-T, characterized by immunodeficiency, cancer predisposition, and neurodegeneration. Whereas a series of animal models recapitulate much of the A-T phenotype, they fail to present with ataxia or neurodegeneration. We describe here the generation of an Atm missense mutant [amino acid change of leucine (L) to proline (P) at position 2262 (L2262P)] rat by intracytoplasmic injection (ICSI) of mutant sperm into oocytes. Atm-mutant rats (AtmL2262P/L2262P) expressed low levels of ATM protein, suggesting a destabilizing effect of the mutation, and had a significantly reduced lifespan compared with Atm+/+. Whereas these rats did not show cerebellar atrophy, they succumbed to hind-limb paralysis (45%), and the remainder developed tumors. Closer examination revealed the presence of both dsDNA and ssDNA in the cytoplasm of cells in the hippoc us, cerebellum, and spinal cord of AtmL2262P/L2262P rats. Significantly increased levels of IFN-β and IL-1β in all 3 tissues were indicative of DNA damage induction of the type 1 IFN response. This was further supported by NF-κB activation, as evidenced by p65 phosphorylation (P65) and translocation to the nucleus in the spinal cord and parahippoc us. Other evidence of neuroinflammation in the brain and spinal cord was the loss of motor neurons and the presence of increased activation of microglia. These data provide support for a proinflammatory phenotype that is manifested in the Atm mutant rat as hind-limb paralysis. This mutant represents a useful model to investigate the importance of neuroinflammation in A-T.
Publisher: Wiley
Date: 18-01-2015
DOI: 10.1002/PROS.22942
Abstract: Here, we report on the evaluation of the diagnostic performance of ejaculate-derived PCA3, Hepsin, and miRNAs to complement serum PSA to detect prostate cancer. cDNA was prepared from 152 candidate specimens following RNA isolation and lification for PSA, PCA3 and Hepsin qPCR, with 66 having adequate RNA for all three assays. Small RNA sequencing and examination of PCa-associated miRNAs miR-200b, miR-200c, miR-375 and miR-125b was performed on 20 specimens. We compared findings from prostate biopsies using D'Amico and PRIAS classifications and in relation to whole gland histopathology following radical prostatectomy. Multivariate logistic regression modeling and clinical risk (incorporating standard clinicopathological variables) were performed for all ejaculate-based markers. While Hepsin alone was not of predictive value, the Hepsin:PCA3 ratio together with serum PSA, expressed as a univariate composite score based on multivariate logistic regression, was shown to be a better predictor than PSA alone of prostate cancer status (AUC 0.724 vs. 0.676) and risk, using D'Amico (AUC 0.701 vs. 0.680) and PRIAS (AUC 0.679 vs. 0.659) risk stratification criteria as classified using prostate biopsies. It was also possible to analyse a subgroup of patients for miRNA expression with miR-200c (AUC 0.788) and miR-375 (AUC 0.758) showing best single marker performance, while a combination of serum PSA, miR-200c, and miR-125b further improved prediction for prostate cancer status when compared to PSA alone determined by biopsy (AUC 0.869 vs. 0.672 P < 0.05), and risk (D'Amico/PRIAS) as well as by radical prostatectomy histology (AUC 0.809 vs. 0.690). For prostate cancer status by biopsy, at a sensitivity of 90%, the specificity of the test increased from 11% for PSA alone to 67% for a combination of PSA, miR-200c, and miR-125b. These results show that use of a combination of different types of genetic markers in ejaculate together with serum PSA are at least as sensitive as those reported in DRE urine. Furthermore, a combination of serum PSA and selected miRNAs improved prediction of prostate cancer status. This approach may be helpful in triaging patients for MRI and biopsy, when confirmed by larger studies.
Publisher: Public Library of Science (PLoS)
Date: 21-07-2016
Publisher: Oxford University Press (OUP)
Date: 22-12-2017
DOI: 10.1093/HMG/DDW371
Abstract: Ataxia-telangiectasia (A-T), an autosomal recessive disease caused by mutations in the ATM gene is characterised by cerebellar atrophy and progressive neurodegeneration which has been poorly recapitulated in Atm mutant mice. Consequently, pathways leading to neurodegeneration in A-T are poorly understood. We describe here the generation of an Atm knockout rat model that does not display cerebellar atrophy but instead paralysis and spinal cord atrophy, reminiscent of that seen in older patients and milder forms of the disorder. Loss of Atm in neurons and glia leads to accumulation of cytosolic DNA, increased cytokine production and constitutive activation of microglia consistent with a neuroinflammatory phenotype. Rats lacking ATM had significant loss of motor neurons and microgliosis in the spinal cord, consistent with onset of paralysis. Since short term treatment with steroids has been shown to improve the neurological signs in A-T patients we determined if that was also the case for Atm-deficient rats. Betamethasone treatment extended the lifespan of Atm knockout rats, prevented microglial activation and significantly decreased neuroinflammatory changes and motor neuron loss. These results point to unrepaired damage to DNA leading to significant levels of cytosolic DNA in Atm-deficient neurons and microglia and as a consequence activation of the cGAS-STING pathway and cytokine production. This in turn would increase the inflammatory microenvironment leading to dysfunction and death of neurons. Thus the rat model represents a suitable one for studying neurodegeneration in A-T and adds support for the use of anti-inflammatory drugs for the treatment of neurodegeneration in A-T patients.
Publisher: Springer Science and Business Media LLC
Date: 20-09-2016
Publisher: Oxford University Press (OUP)
Date: 04-1996
DOI: 10.1093/HMG/5.4.433
Abstract: Ataxia-telangiectasia (A-T) is an autosomal recessive disorder involving cerebellar degeneration, immunodeficiency, chromosomal instability, radiosensitivity and cancer predisposition. The responsible gene, ATM, was recently identified by positional cloning and found to encode a putative 350 kDa protein with a Pl 3-kinase-like domain, presumably involved in mediating cell cycle arrest in response to radiation-induced DNA damage. The nature and location of A-T mutations should provide insight into the function of the ATM protein and the molecular basis of this pleiotropic disease. Of 44 A-T mutations identified by us to date, 39 (89%) are expected to inactivate the ATM protein by truncating it, by abolishing correct initiation or termination of translation, or by deleting large segments. Additional mutations are four smaller in-frame deletions and insertions, and one substitution of a highly conserved amino acid at the Pl 3-kinase domain. The emerging profile of mutations causing A-T is thus dominated by those expected to completely inactivate the ATM protein. ATM mutations with milder effects may result in phenotypes related, but not identical, to A-T.
Publisher: Elsevier BV
Date: 07-1991
DOI: 10.1016/0006-291X(91)90171-3
Abstract: In this report we describe the isolation and characterization of a cDNA clone overexpressed tenfold during the induction of apoptosis in the glucocorticoid-sensitive human leukaemia cell line CEM C7. This clone was shown by DNA sequence analysis to represent the human HL14 gene, encoding a beta-galactoside binding protein, the mouse homologue of which has recently been reported to act as a cell growth inhibitory factor.
Publisher: Elsevier BV
Date: 05-1988
DOI: 10.1016/0167-8817(88)90030-2
Abstract: The molecular basis of sensitivity of ionizing radiation and other damaging agents is not clearly defined in eukaryotes. While a large number of mutants have been described only a few have been demonstrated to have a defect in the repair of damage to DNA. An interesting characteristic of a sub-group of these mutants, in different species extending throughout the phylogenetic scale, is the presence of damage-resistant DNA synthesis. This phenomenon is observed in cells from in iduals with the genetic disorder ataxia telangiectasia, in HeLa cells treated with fluorodeoxyuridine prior to UV irradiation, in mutants of the fungus Neurospora crassa, the slime mould Dictyostelium discoideum, the fruit fly Drosophila melanogaster and possibly in the "wasted" mouse mutant. In the case of ataxia telangiectasia sensitivity is only observed to ionizing radiation or radiomimetic chemicals whereas sensitivity to a wider spectrum of mutagens is reported for the lower eukaryotic mutants. In all cases a reduced inhibition of DNA synthesis is obtained after exposure to an agent to which the cell type is hypersensitive. It is unclear how damage-resistant DNA synthesis contributes to increased sensitivity in these cells, but is unlikely to be the major mechanism predisposing to radiation-induced cell death. The description of a derivative of an ataxia telangiectasia cell line with normal sensitivity to radiation but still maintaining resistant DNA synthesis partially uncouples radioresistant DNA synthesis and radiosensitivity. This paper is designed to review the phenomenon of damage-resistant DNA synthesis in a number of mutants.
Publisher: Elsevier BV
Date: 12-1997
DOI: 10.1016/S0165-022X(97)00041-9
Abstract: Two dimensional gel electrophoresis of proteins from HL-60 human leukaemia cells treated with bistratene A, a specific activator of protein kinase C (PKC) delta, was performed in conjunction with sequencing in order to identify components of the signal transduction pathway of this isoform of PKC. Stathmin (oncoprotein 18) was identified in this way and the phosphorylation of this protein after treatment with bistratene A, was confirmed by Western blotting of 2D gels. Since stathmin has phosphorylation sites for mitogen activated protein (MAP) kinases, cyclin dependent kinases and calcium/calmodulin dependent protein kinases, it is assumed that one of these enzymes, acting downstream from PKC delta, is responsible for the phosphorylation. Another approach to determining the role of PKC delta involves the identification of interacting proteins using the yeast two hybrid screen. The sequence of nine out of ten independently isolated clones from a two hybrid screen showed perfect homology to human ribosomal protein L8. This protein has previously been shown to exist in complexes with ribosomal RNA, aminoacyl-tRNA and elongation factor-1 alpha, a known substrate of PKC delta, suggesting a role for PKC delta in protein synthesis regulation.
Publisher: Wildlife Disease Association
Date: 04-1988
DOI: 10.7589/0090-3558-24.2.282
Abstract: A population of free-ranging koalas in southeastern Queensland was examined to determine the prevalence of Chlamydia psittaci infections. Although C. psittaci was isolated from 46 of 65 (71%) koalas studied, only six (9%) of these had clinical signs of disease. Most adult females (82%) had back or pouch young present even though 67% of them were infected. There were no significant correlations between age, sex or site of s ling (urogenital versus conjunctival tissues) and the isolation of C. psittaci. No other important bacterial or fungal pathogens were isolated. The complement fixation test had a sensitivity of 7% and a specificity of 94% in detecting chlamydial infections, suggesting that it is unsuitable for use as a screening test. Chlamydia psittaci infection within this population appeared to represent a generally well-balanced host-parasite relationship and few animals had clinical signs of disease. Only four of 27 (15%) healthy koalas infected with C. psittaci followed for 24 wk after s ling developed eye disease or "dirty tail." Two koalas with keratoconjunctivitis recovered without treatment during the study period. Additional factors, including the stresses imposed by loss of habitat, may act to produce overt disease in koalas with latent C. psittaci infections.
Publisher: Springer Science and Business Media LLC
Date: 08-06-2013
DOI: 10.1007/S10565-013-9247-0
Abstract: Hydroquinone (HQ) is found in natural and anthropogenic sources including food, cosmetics, cigarette smoke, and industrial products. In addition to ingestion and dermal absorption, human exposure to HQ may also occur by inhaling cigarette smoke or polluted air. The adverse effects of HQ on respiratory systems have been studied, but genotoxicity HQ on human lung cells is unclear. The aim of this study was to investigate the cytotoxicity and genotoxicity of HQ in human lung alveolar epithelial cells (A549). We found that HQ induced a dose response in cell growth inhibition and DNA damage which was associated with an increase in oxidative stress. Cytotoxicity results demonstrated that HQ was most toxic after 24 h (LC50 = 33 μM) and less toxic after 1 h exposure (LC50 = 59 μM). Genotoxicity of HQ was measured using the Comet assay, H2AX phosphorylation, and chromosome aberration formation. Results from the comet assay revealed that DNA damage was highest during the earlier hours of exposure (1 and 6 h) and thereafter was reduced. A similar pattern was observed for H2AX phosphorylation suggesting that damage DNA may be repaired in later exposure hours. An increase in chromosomal aberration corresponded with maximal DNA damage which further confirmed the genotoxic effects of HQ. To investigate whether oxidative stress was involved in the cytotoxic and genotoxic effects of HQ, cellular glutathione and 8-Oxo-deoguanisone (8-Oxo-dG) formation were measured. A decrease in the reduced glutathione (GSH) and an increase oxidized glutathione (GSSG) was observed during the early hours of exposure which corresponded with elevated 8-Oxo-dG adducts. Together these results demonstrate that HQ exerts its cytotoxic and genotoxic effects in A549 lung cells, probably through DNA damage via oxidative stress.
Publisher: Public Library of Science (PLoS)
Date: 23-01-2019
Publisher: Elsevier BV
Date: 12-1996
Abstract: Bistratene A is a marine toxin which induces phosphorylation of cellular proteins. Our current evidence indicates that this occurs through activation of protein kinase C-delta. In fibroblasts bistratene A causes rounding up of the cells and a rapid disappearance of vinculin staining and actin stress fibers as detected by fluorescence immunohistochemistry. Phosphorylation of the focal adhesion protein, talin, is increased after bistratene A treatment and this is inhibited by calphostin C, a specific inhibitor of PKC. No changes in the phosphorylation status of vinculin, tubulin, or vimentin were observed in the presence of the toxin. Treatment with bistratene A caused a redistribution of PKC-delta from cytosolic and membrane compartments to the nuclear fraction. There was no effect on the subcellular distribution of any other PKC isoform. These results demonstrate that phosphorylation of talin is implicated in the disruption of actin microfilaments in fibroblasts by bistratene A and that this is most likely mediated by PKC-delta.
Publisher: Elsevier BV
Date: 05-2013
DOI: 10.1016/J.MITO.2012.11.006
Abstract: Defects in the recognition and/or repair of damage to DNA are responsible for a sub-group of autosomal recessive ataxias. Included in this group is a novel form of ataxia with oculomotor apraxia characterised by sensitivity to DNA damaging agents, a defect in p53 stabilisation, oxidative stress and resistance to apoptosis. We provide evidence here that the defect in this patient's cells is at the level of the mitochondrion. Mitochondrial membrane potential was markedly reduced in cells from the patient and ROS levels were elevated. This was accompanied by lipid peroxidation of mitochondrial proteins involved in electron transport and RNA synthesis. However, no gross changes or alteration in composition or activity of mitochondrial electron transport complexes was evident. Sequencing of mitochondrial DNA revealed a mutation, I349T, in the mitochondrial cytochrome b gene. These results describe a patient with an apparently novel form of AOA characterised by a defect at the level of the mitochondrion.
Publisher: Elsevier BV
Date: 04-03-2004
Publisher: American Association for Cancer Research (AACR)
Date: 15-03-2006
DOI: 10.1158/0008-5472.CAN-05-3428
Abstract: Ataxia-telangiectasia mutated (ATM), the protein defective in ataxia-telangiectasia, plays a central role in DNA damage response and signaling to cell cycle checkpoints. We describe here a cell line from a patient with an ataxia-telangiectasia–like clinical phenotype defective in the p53 response to radiation but with normal ATM activation and efficient downstream phosphorylation of other ATM substrates. No mutations were detected in ATM cDNA. A normal level of interaction between p53 and peptidyl-prolyl-isomerase Pin1 suggests that posttranslational modification was intact in these cells but operating at reduced level. Defective p53 stabilization was accompanied by defective induction of p53 effector genes and failure to induce apoptosis in response to DNA-damaging agents. Continued association between p53 and murine double minute-2 (Mdm2) occurred in irradiated ATL2ABR cells in response to DNA damage, and incubation with Mdm2 antagonists, nutlins, increased the stabilization of p53 and its transcriptional activity but failed to induce apoptosis. These results suggest that ATM-dependent stabilization of p53 and induction of apoptosis by radiation involve an additional factor(s) that is defective in ATL2ABR cells. (Cancer Res 2006 66(6): 2907-12)
Publisher: Wiley
Date: 11-1987
DOI: 10.1111/J.1751-0813.1987.TB06064.X
Abstract: Pseudoaneurysm of the cavernosal artery is quite rare. Herein, we describe color Doppler findings of post-traumatic pseudoaneurysm of the right cavernosal artery in a 19-year-old adolescent boy who presented with right hip pain. Doppler showed turbulence of flow with arterial inflow and outflow from the aneurysm. Selective transarterial catheterization of the internal iliac and internal pudental artery with microcatheter and embolization of pseudoaneurysm using histocryl resulted in alleviation of symptoms.
Publisher: Rockefeller University Press
Date: 08-1996
Abstract: Cytotoxic T cells (CTL) represent the major defense mechanism against the spread of virus infection. It is believed that the pore-forming protein, perforin, facilitates the entry of a series of serine proteases (particularly granzyme B) into the target cell which ultimately leads to DNA fragmentation and apoptosis. We demonstrate here that during CTL-mediated cytolysis the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), an enzyme implicated in the repair of double strand breaks in DNA, is specifically cleaved by an interleukin (IL)-1 beta-converting enzyme (ICE)-like protease. A serine protease inhibitor, 3,4-dichloroisocoumarin (DCl), which is known to block granzyme B activity, inhibited CTL-induced apoptosis and prevented the degradation of DNA-PKcs in cells but failed to prevent the degradation of purified DNA-PKcs by CTL extracts. However, Tyr-Val-Ala-Asp-CH2Cl (YVAD-CMK) and other cysteine protease inhibitors prevented the degradation of purified DNA-PKcs by CTL extracts. Furthermore, incubation of DNA-PKcs with granzyme B did not produce the same cleavage pattern observed in cells undergoing apoptosis and when this substrate was incubated with either CTL extracts or the ICE-like protease, CPP32. Sequence analysis revealed that the cleavage site in DNA-PKcs during CTL killing was the same as that when this substrate was exposed to CPP32. This study demonstrates for the first time that the cleavage of DNA-PKcs in this intact cell system is exclusively due to an ICE-like protease.
Publisher: Elsevier BV
Date: 11-1999
Publisher: Mary Ann Liebert Inc
Date: 07-1988
Abstract: We have cloned a 147-bp Hind III fragment from a marine ascidian Pyura stolonifera. This sequence is arranged in tandem in arrays up to 20 kb in size and represents more than 5% of the total genomic DNA. The basic 147-bp unit was isolated from Hind III-digested genomic DNA and cloned into M13. Sequence analysis of seven clones revealed that the sequence is AT rich (75%) and can be separated from main band DNA by equilibrium density gradient centrifugation in the presence of the ligand dye Hoechst 33258. The sequence is highly conserved and is changed only by single base substitution mutations in the different clones. Use of this sequence as a probe demonstrated varying degrees of hybridization with DNA isolated from a wide range of other ascidians. Northern blot analysis revealed the presence of RNA hybridizing to the repeat in unfertilized eggs but transcription of this sequence was not evident in the adult organism.
Publisher: Elsevier BV
Date: 03-2014
DOI: 10.1016/J.EURURO.2013.10.031
Abstract: A randomised trial of robotic and open prostatectomy commenced in October 2010 and is progressing well. Clinical and quality of life outcomes together with economic costs to in iduals and the health service are being examined critically to compare outcomes.
Publisher: Springer Science and Business Media LLC
Date: 08-10-1998
Abstract: The signaling pathway through which ionizing radiation induces NF-kappaB activation is not fully understood. IkappaB-alpha, an inhibitory protein of NF-kappaB mediates the activation of NF-kappaB in response to various stimuli, including cytokines, mitogens, oxidants and other stresses. We have now identified an ionizing radiation-induced signaling pathway that is independent of TNF-alpha. IkappaB-alpha degradation is rapid in response to TNF-alpha induction, but it is absent in response to ionizing radiation exposure in cells from in iduals with ataxia-telangiectasia (AT). Overexpression of wild-type ATM, the product of the gene defective in AT patients, restores radiation-induced degradation of IkappaB-alpha. Furthermore, phosphorylation of IkappaB-alpha by immunoprecipitated ATM kinase is increased in control fibroblasts and transfected AT cells following ionizing radiation exposure. These data provide support for a novel ionizing radiation-induced signaling pathway for activation of NF-kappaB and a molecular basis for the sensitivity of AT patients to oxidative stresses.
Publisher: Ovid Technologies (Wolters Kluwer Health)
Date: 06-2000
DOI: 10.1097/00001721-200006000-00011
Abstract: The incidence of vein-graft occlusion associated with myocardial infarction and thrombosis following the use of the plasmin inhibitor, aprotinin, to reduce blood loss during vascular surgery has prompted the isolation of an alternative kinetically distinct inhibitor of plasmin from the venom of Pseudonaja textilis. This inhibitor has been called textilinin (Txln) and two distinct forms have been isolated from the Brown-snake venom (molecular weight, 6688 and 6692). A comparison of plasmin inhibitor constants for aprotinin and the Txlns 1 and 2 indicated that the former bound very tightly (inhibitor constant, Ki approximately 10(-11) mol/l), while both of the latter bound less tightly (Ki approximately 10(-9) mol/l). Homogeneity of Txlns 1 and 2 was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and mass spectrometry. A sequence difference of six amino acids was observed between the two forms of Txln. Txln 1 and 2 showed, respectively, 45 and 43% homology with aprotinin, while there was 58 and 55% homology, respectively, with a plasmin inhibitor from the venom of eastern Taipan, Oxyuranus scutellatus. Both Txlns have six cysteines, like other inhibitors of this group, and homology was determined by alignment of these cysteines. Both have been shown to reduce blood loss by about 60% in a murine tail vein bleeding model. It is proposed that the kinetic profiles of Txln 1 and 2 for plasmin allow the arrest of haemorrhage without the possible threat of thrombosis.
Publisher: Elsevier BV
Date: 05-1998
DOI: 10.1016/S0167-8140(98)00014-0
Abstract: To determine if clinical radiosensitivity in breast cancer patients is related to mutations of the ataxia telangiectasia gene (ATM). Fifteen patients who had developed a severe late reaction to a standard radiotherapy schedule were examined for evidence of increased in vitro radiosensitivity using the MTT assay. Mutation analysis was performed using a protein truncation assay. No mutations were detected in the 15 patients despite evidence of increased in vitro radiosensitivity. Testing for the ATM gene is unlikely to be useful for predicting clinical response to radiotherapy in breast cancer patients.
Publisher: Oxford University Press (OUP)
Date: 30-07-2015
DOI: 10.1093/HMG/DDV296
Publisher: Public Library of Science (PLoS)
Date: 06-09-2013
Publisher: Hindawi Limited
Date: 2009
DOI: 10.1002/HUMU.20805
Publisher: Elsevier BV
Date: 08-2018
Publisher: Radiation Research Society
Date: 11-2005
DOI: 10.1667/RR3454.1
Abstract: Cells respond to genotoxic insults such as ionizing radiation by halting in the G2 phase of the cell cycle. Delayed cell death (mitotic death) can occur when the cell is released from G2, and specific spindle defects form endopolyploid cells (endoreduplication/tetraploidy). Enhanced G2 chromosomal radiosensitivity has been observed in many cancers and genomic instability syndromes, and it is manifested by radiation-induced chromatid aberrations observed in lymphocytes of patients. Here we compare the G2 chromosomal radiosensitivity in prostate patients with benign prostatic hyperplasia (BPH) or prostate cancer with disease-free controls. We also investigated whether there is a correlation between G2 chromosomal radiosensitivity and aneuploidy (tetraploidy and endoreduplication), which are indicative of mitotic cell death. The G2 assay was carried out on all human blood s les. Metaphase analysis was conducted on the harvested chromosomes by counting the number of aberrations and the mitotic errors (endoreduplication/tetraploidy) separately per 100 metaphases. A total of 1/14 of the controls were radiosensitive in G2 compared to 6/15 of the BPH patients and 15/17 of the prostate cancer patients. Radiation-induced mitotic inhibition was assessed to determine the efficacy of G2 checkpoint control in the prostate patients. There was no significant correlation of G2 radiosensitivity scores and mitotic inhibition in BPH patients (P = 0.057), in contrast to prostate cancer patients, who showed a small but significant positive correlation (P = 0.029). Furthermore, there was no significant correlation between G2 radiosensitivity scores of BPH patients and endoreduplication/ tetraploidy (P = 0.136), which contrasted with an extremely significant correlation observed in prostate cancer patients (P < 0.0001). In conclusion, cells from prostate cancer patients show increased sensitivity to the induction of G2 aberrations from ionizing radiation exposure but paradoxically show reduced mitotic indices and aneuploidy as a function of aberration frequency.
Publisher: Oxford University Press (OUP)
Date: 1993
DOI: 10.1111/J.1574-695X.1993.TB00299.X
Abstract: Emerging evidence indicates that circular RNAs (circRNAs), which form as covalently closed loops, play a regulatory role in various types of cancer, including prostate cancer (PCa). CircSLC19A1, one kind of circRNA, was subjected to the study and its role in PCa was explored. Expressions of circSLC19A1, miR-326 and MAPK1 in PCa tissues and cells were assessed by qRT-PCR. CircSLC19A1 was identified by RNase R treatment. The binding relations between circSLC19A1 and miR-326 and between miR-326 and MAPK1 were predicted by RegRNA2.0 or Targetscan7.2 and further confirmed by dual-luciferase reporter assay. Pearson correlation analysis of the correlation among circSLC19A1, miR-326 and MAPK1 was performed. CCK-8, cell colony formation, wound healing and Transwell assays were used to assess PCa cell viability, proliferation, migration and invasion, respectively. CircSLC19A1 expression was up-regulated in PCa tissue and cell cytoplasm. Silencing circSLC19A1 inhibited PCa cell viability, proliferation, migration, invasion and miR-326 expression. MiR-326 inhibitor promoted the luciferase activities of circSLC19A1 and MAPK1, increased MAPK1 expression and facilitated PCa cell progression. MiR-326 expression was down-regulated in PCa tissue and there was a negative correlation between miR-326 and circSLC19A1 expressions. MAPK1 expression was up-regulated in PCa tissue. There was a negative correlation between MAPK1 and miR-326 expressions as well as a positive correlation between MAPK1 and circSLC19A1 expressions. Silencing MAPK1 promoted the viability, proliferation, migration, and invasion of PCa cells co-transfected with siRNA-circSLC19A1a and miR-326 inhibitor. CircSLC19A1 silencing inhibited PCa cell proliferation, migration and invasion through regulating miR-326/MAPK1 axis.
Publisher: Elsevier BV
Date: 09-2013
DOI: 10.1038/MT.2013.177
Publisher: Elsevier BV
Date: 05-2008
DOI: 10.1016/J.JOCN.2007.04.022
Abstract: In experimental neuro-oncology there remains a need for animal models that can be used to assess the efficacy of new and innovative treatment methodologies for glioblastoma multiforme (GBM). Rat models have remained the mainstay of neuro-oncology research for over 30 years however, despite extensive experimentation, there is no one rat model that truly reflects the features of human tumours. We have developed a novel rat brain tumour model that closely resembles human GBM in biological behaviour and that utilizes bioluminescence imaging (BLI) to follow day-to-day in vivo progress of the tumour. F98 glioma cells were transfected with the firefly luciferase gene and injected orthotopically into the brains of 24 rats. Weekly BLI after subcutaneous injection of luciferin allowed for in vivo monitoring of the progress of the brain tumours. Euthanasia and histological analysis of the rodent brains at varying stages post-implantation, allowed for statistically significant correlation between tumour size and luminescence (p=0.002). The utility of this model is readily apparent, allowing us a way of examining the effects of new and novel therapeutics in these rats.
Publisher: Elsevier BV
Date: 11-1989
DOI: 10.1016/0165-2427(89)90116-5
Abstract: Direct immunofluorescence and fluorescence-activated cell sorter techniques were used for the detection of surface immunoglobulin positive (SIg+) cells in peripheral blood lymphocytes (PBL's) of bovine leukaemia virus (BLV) infected cattle with or without persistent lymphocytosis (PL+, PL-) and in BLV-free cattle. The percentage of SIg+ cells was more than twice as high in BLV+PL+ cattle than in BLV-free and BLV+PL- cattle. Bovine T cells, and T cell subsets were identified indirectly by the same techniques using three monoclonal antibodies (MAb's) specific for all T cells (IL-A43), T helper (BoT4) cells (IL-A12) and T cytotoxic (BoT8) cells (IL-A17). The major histocompatibility complex (MHC) determinants of both class II (BoT4) and class I (BoT8) as well as all T cells were significantly reduced in BLV+PL+ compared to BLV-free cattle. The actual decrease in the BoT8 cell subset or the dilution effect that would change effector:target cell ratio suggests that a resultant decrease in cytotoxic activity in BLV+PL+ cattle may play an important role in the progress of BLV infection in cattle.
Publisher: Elsevier BV
Date: 06-2007
DOI: 10.1016/J.RADONC.2007.04.032
Abstract: ATM, the protein mutated in the human genetic disorder ataxia-telangiectasia, functions by responding to radiation damage to DNA, primarily DNA double strand breaks (dsb), to reduce the risk of genome instability, cancer and neurodegeneration. ATM is rapidly activated as an existing protein to phosphorylate a number of downstream proteins that are involved in DNA repair and cell cycle checkpoint activation. While the exact mechanism of activation of ATM has not been determined, it is now evident that it relies heavily on the Mre11 complex (Mre11/Rad50/Nbs1) and a series of post-translational events for this activation. The Mre11 complex acts as a sensor for the break, recruits ATM to this site where it is autophosphorylated and then is capable of phosphorylating substrates that participate in DNA repair and cell cycle control. A greater understanding of how ATM is activated and functions through different signalling pathways is paramount to devising therapeutic strategies for the treatment of A-T patients. This knowledge can also be used to advantage in sensitizing cells to radiation and ultimately deriving novel therapeutic approaches for the treatment of cancer.
Publisher: Elsevier BV
Date: 1991
DOI: 10.1016/0921-8734(91)90029-B
Abstract: Radiosensitivity was studied in a series of Alzheimer's disease (AD) patients and normal controls by examining clonogenic survival and radiation-induced chromosome aberrations in lymphoblastoid cell lines. D0 values based on colony survival for AD and normals following exposure to gamma-rays were 0.86 +/- 0.04 and 1.14 +/- 0.03 Gy respectively. However, 2 of the AD cell lines had D0 values in the normal range. This increased radiosensitivity in AD cells was confirmed by an increased number of gamma-ray-induced chromosome aberrations in these cells. Cell fusion was employed to investigate the presence of different complementation groups for the radiosensitive phenotype in AD using frequency of radiation-induced chromosome aberrations as a means of distinguishing different groups. Four complementation groups were found among 5 AD cell lines. These findings provide additional experimental evidence in support of heterogeneity in AD.
Publisher: Elsevier BV
Date: 11-1990
DOI: 10.1016/0378-1135(90)90071-3
Abstract: Bovine leukaemia virus (BLV) is the causative agent in enzootic bovine leukosis a disease occurring worldwide. This virus is normally detected by the agar gel immunodiffusion or ELISA assays which rely on the appearance of antibodies to a major surface protein of the virus, gp51, present in the serum of infected cattle. We have used the polymerase chain reaction, which depends on the lification of specific DNA sequences as a sensitive assay for the detection of BLV. It was possible to detect proviral DNA in 100 pg of tumour DNA from an infected host using agarose gel electrophoresis followed by ethidium bromide staining. The sensitivity of the assay was increased by two log orders when hybridization analysis, using a BLV proviral DNA probe, was used in combination with lification of the DNA. Proviral DNA was detected in both lymphocytic and tumour DNA and at all stages of infection in cattle.
Publisher: Elsevier BV
Date: 11-1987
DOI: 10.1016/0165-1218(87)90061-9
Abstract: Several analgesic compounds and mixtures of analgesics were examined for both cytotoxicity and ability to induce chromosomal damage in the normal rat-kidney cell line NRK-49F. Chromosomal damage was assessed using an in vitro micronucleus assay. Of all the compounds tested, only N-hydroxyparacetamol caused a high degree of cell death at the concentrations used. 4 analgesic compounds were found to be inducers of micronuclei in NRK cells in order of decreasing potency these were: N-hydroxyparacetamol, N-hydroxyphenacetin, caffeine and paracetamol. An aspirin, phenacetin, caffeine mixture (APC) failed to induce micronuclei above the background level, and a paracetamol-codeine combination did not increase the level of micronuclei induction above that induced by paracetamol alone. This report suggests paracetamol and some related compounds are capable of inducing chromosomal damage in mammalian cells in vitro, which is consistent with recent reports of a possible paracetamol-DNA interaction.
Publisher: Elsevier BV
Date: 04-2007
DOI: 10.1016/J.NEUROSCIENCE.2006.12.010
Abstract: A subgroup of human autosomal recessive ataxias is also characterized by disturbances of eye movement or oculomotor apraxia. These include ataxia telangiectasia (A-T) ataxia telangiectasia like disorder (ATLD) ataxia oculomotor apraxia type 1 (AOA1) and ataxia oculomotor apraxia type 2 (AOA2). What appears to be emerging is that all of these have in common some form of defect in DNA damage response which could account for the neurodegenerative changes seen in these disorders. We describe here sensitivity to DNA damaging agents in AOA1 and evidence that these cells have a defect in single strand break repair. Comparison is made with what appears to be a novel form of AOA (AOA3) which also shows sensitivity to agents that lead to single strand breaks in DNA as well as a reduced capacity to repair these breaks. AOA3 cells are defective in the DNA damage-induced p53 response. This defect can be overcome by incubation with the mdm2 antagonists, nutlins, but combined treatment with nutlins and DNA damage does not enhance the response. We also show that AOA3 cells are deficient in p73 activation after DNA damage. These data provide further evidence that different forms of AOA have in common a reduced capacity to cope with damage to DNA, which may account for the neurodegeneration observed in these syndromes.
Publisher: Springer Science and Business Media LLC
Date: 1998
DOI: 10.1038/BJC.1998.2
Abstract: The human melanoma cell lines MM96L, A2058 and HT144 were examined for sensitivity to ionizing radiation and UVB radiation. HT144 demonstrated a significant increase in sensitivity to ionizing and UVB radiation compared with the MM96L and A2058 cells. Sensitivity to both agents was associated with susceptibility to apoptosis. Using a protein truncation assay, a mutation for the gene for ataxia telangiectasia (ATM) was identified in HT144 cells. This was confirmed to be a homozygous mutation by subsequent sequencing of the abnormal region. Protein truncation assay of the other two cell lines showed no abnormality. The results suggest that somatic mutation of the A-T gene may be important in determining tumour radiosensitivity.
Publisher: Elsevier BV
Date: 10-1990
DOI: 10.1016/0168-1702(90)90074-L
Abstract: Recombinant vaccinia viruses (VV) containing the envelope gene of bovine leukaemia virus (BLV) were constructed. Three virus constructs were designed: VV-BLV1 which contained the open reading frame for envelope glycoprotein gp51 alone, under control of VVP7.5 promoter VV-BLV2 and VV-BLV3 contained the entire gene (gp51 + gp30) coding sequence downstream of VP7.5 and the fowlpox virus early/late promoter (PFE/L) respectively. All three VV recombinants expressed envelope glycoproteins as determined by the agar gel diffusion assay. By immunofluorescence techniques it was shown that while VV-BLV2 and VV-BLV3 expressed envelope glycoprotein on the surface of virus-infected cells, VV-BLV1 failed to do so. Rabbits inoculated with VV-BLV1 failed to show an anti envelope glycoprotein antibody response, however, significant levels of antibodies against envelope glycoprotein were detected in sera from rabbits inoculated with VV-BLV2 and VV-BLV3.
Publisher: Springer Science and Business Media LLC
Date: 05-1997
Abstract: We describe here the further characterisation of the radiation response of a pair of isogenic Burkitt's lymphoma cell lines which differ significantly in their susceptibility to radiation-induced apoptosis. In both cases a marked inhibition of cyclin A-dependent kinase activity was observed at 4 h post-irradiation which recovered to normal levels in the susceptible line by 12 h but remained inhibited in the resistant cell line. Under these conditions the cellular abundance of p58cyclinA and p33cdk2 did not significantly change in the two cell types and there was no evidence for phosphorylation changes in p33cdk2 which might account for the activity differences. In parallel with the changes in activity, p21WAF1 increased initially in both cell lines, declined in the sensitive cell line as the activity recovered but remained high in the resistant cell line. This appears to be explained by a more rapid turn-over of p21WAF1 in the sensitive cell line and an increased association of p21WAF1 with cyclin kinase as determined by immunoprecipitation. These results implicate p21WAF1 in the regulation of cyclin-dependent kinases during radiation-induced apoptosis, with persistence of induced p21WAF1 being associated with a more resistant phenotype.
Publisher: MDPI AG
Date: 04-06-2010
Publisher: Elsevier BV
Date: 03-2011
DOI: 10.1016/J.BIOCHI.2010.11.006
Abstract: C-type lectins are calcium-dependent sugar binding proteins and are distributed ubiquitously amongst vertebrate organisms. As part of a wider study on Australian snake venom components, we have identified and characterised a C-type lectin from the venom of Oxyuranus scutellatus (Australian coastal taipan) with mannose-binding activity. This protein exhibited a subunit molecular mass of 15 kDa and was found to bind mannose and also bind to and agglutinate erythrocytes in a Ca(2+)-dependent manner. cDNA transcripts coding for C-lectin proteins were cloned and sequenced from six Australian elapid snake species and an antibody generated against the O. scutellatus mannose-binding C-lectin identified C-lectin proteins in the venom of 13 Australian elapid snakes by immunoblotting. Experimental evidence and molecular modelling also suggest that this protein exhibits a unique dimeric structure. This is the first confirmed ex le of a snake venom C-lectin with mannose-binding activity.
Publisher: Springer Science and Business Media LLC
Date: 03-11-2008
DOI: 10.1007/S00018-008-8573-5
Abstract: The venoms of Australian snakes contain a myriad of pharmacologically active toxin components. This study describes the identification and comparative analysis of two distinct toxin families, the kunitztype serine protease inhibitors and waprins, and demonstrates a previously unknown evolutionary link between the two. Multiple cDNA and full-length gene isoforms were cloned and shown to be composed of three exons separated by two introns. A high degree of identity was observed solely within the first exon which coded for the propeptide sequence and its cleavage site, and indicates that each toxin family has arisen from a gene duplication event followed by ersification only within the portion of the gene coding for the functional toxin. It is proposed that while the mechanism of toxin secretion is highly conserved, ersification of mature toxin sequences allows for the existence of multiple protein isoforms in the venom to adapt to variations within the prey environment.
Publisher: Public Library of Science (PLoS)
Date: 25-03-2009
Publisher: Elsevier BV
Date: 2001
Publisher: Wiley
Date: 14-06-2002
DOI: 10.1002/IJC.10468
Abstract: The current approach to prostate cancer diagnosis has major limitations including the inability of prostate-specific antigen (PSA) assays to accurately differentiate between prostate cancer and benign prostate hyperplasia (BPH) and the imprecision of transrectal ultrasound (TRUS) biopsy s ling. We have employed cDNA microarray screening to compare gene expression patterns in BPH and tumour s les to identify expression markers that may be useful in discriminating between these conditions. Screening of 3 in idual cDNA arrays identified 8 genes with expression 3-fold greater in 6 tumour tissues than in 1 nontumour s le and 1 BPH s le. Real-time PCR was used to confirm the overexpression of these 8 genes and 12 genes selected from the literature against a panel of 17 tumours and 11 BPH s les. Two genes, delta-catenin (delta-catenin CTNND2) and prostate-specific membrane antigen (PSMA FOLH1), were significantly overexpressed in prostate cancer compared to BPH. Prostate epithelial cells stained positively for delta-catenin and PSMA in our prostate cancer tissues, whereas the majority of our BPH tissues were negative for both markers. Thus we have identified delta-catenin (not previously associated with prostatic adenocarcinoma) and confirmed the potential of PSMA as potential candidates for the diagnosis and management of prostate cancer.
Publisher: Public Library of Science (PLoS)
Date: 07-12-2011
Publisher: Proceedings of the National Academy of Sciences
Date: 31-12-2013
Abstract: SMG1 is a member of the phosphoinositide kinase-like kinase family of proteins that includes ATM, ATR, and DNA-PK, proteins with known roles in DNA damage and cellular stress responses. SMG1 has a well-characterized role in nonsense-mediated decay as well as suggested roles in the DNA damage response, resistance to oxidative stress, regulation of hypoxic responses, and apoptosis. To understand the roles of SMG1 further, we generated a Genetrap Smg1 mouse model. Smg1 homozygous KO mice were early embryonic lethal, but Smg1 heterozygous mice showed a predisposition to a range of cancers, particularly lung and hematopoietic malignancies, as well as development of chronic inflammation. These mice did not display deficiencies in known roles of SMG1, including nonsense-mediated decay. However, they showed elevated basal tissue and serum cytokine levels, indicating low-level inflammation before the development of tumors. Smg1 heterozygous mice also showed evidence of oxidative damage in tissues. These data suggest that the inflammation observed in Smg1 haploinsufficiency contributes to susceptibility to cancer and that Smg1 -deficient animals represent a model of inflammation-enhanced cancer development.
Publisher: Public Library of Science (PLoS)
Date: 11-04-2013
Publisher: Annual Reviews
Date: 04-1997
DOI: 10.1146/ANNUREV.IMMUNOL.15.1.177
Abstract: ▪ Abstract The autosomal recessive human disorder ataxia-telangiectasia (A-T) was first described as a separate disease entity 40 years ago. It is a multisystem disease characterized by progressive cerebellar ataxia, oculocutaneous telangiectasia, radiosensitivity, predisposition to lymphoid malignancies and immunodeficiency, with defects in both cellular and humoral immunity. The pleiotropic nature of the clinical and cellular phenotype suggests that the gene product involved is important in maintaining stability of the genome but also plays a more general role in signal transduction. The chromosomal instability and radiosensitivity so characteristic of this disease appear to be related to defective activation of cell cycle checkpoints. Greater insight into the nature of the defect in A-T has been provided by the recent identification, by positional cloning, of the responsible gene, ATM. The ATM gene is related to a family of genes involved in cellular responses to DNA damage and/or cell cycle control. These genes encode large proteins containing a phosphatidylinositol 3-kinase domain, some of which have protein kinase activity. The mutations causing A-T completely inactivate or eliminate the ATM protein. This protein has been detected and localized to different subcellular compartments.
Publisher: Proceedings of the National Academy of Sciences
Date: 07-01-1997
Abstract: A small number of cellular proteins present in the nucleus, cytosol, and membrane fraction are specifically cleaved by the interleukin-1β-converting enzyme (ICE)-like family of proteases during apoptosis. Previous results have demonstrated that one of these, the cytoskeletal protein actin, is degraded in rat PC12 pheochromocytoma cells upon serum withdrawal. Extracts from etoposide-treated U937 cells are also capable of cleaving actin. It was assumed that cleavage of actin represented a general phenomenon, and a mechanism coordinating proteolytic, endonucleolytic, and morphological aspects of apoptosis was proposed. We demonstrate here that actin is resistant to degradation in several different human cells induced to undergo apoptosis in response to a variety of stimuli, including Fas ligation, serum withdrawal, cytotoxic T-cell killing, and DNA damage. On the other hand, cell-free extracts from these cells and the ICE-like protease CPP32 were capable of cleaving actin in vitro . We conclude that while actin contains cleavage sites for ICE-like proteases, it is not degraded in vivo in human cells either because of lack of access of these proteases to actin or due to the presence of other factors that prevent degradation.
Publisher: Springer Science and Business Media LLC
Date: 12-2000
DOI: 10.1038/35046628
Publisher: Wiley
Date: 07-08-1993
DOI: 10.1136/VR.133.6.136
Abstract: The sensitivity and specificity of an immunoscreening test for anti-chlamydial antibodies in koala (Phasolarctos cinereus) serum were determined after the adsorption of non-specific antibodies. The results of the test were compared with complement fixation tests, tissue culture, gene probe analysis and dot blot immunoscreening for host-borne chlamydial antigen. The immunoscreening test was the most sensitive test for the identification of chlamydial infection in koala serum s les, furthermore it was rapid, taking approximately 16 hours to complete, and inexpensive. However, for the assay of swab material from koalas, gene probe analysis remains the most sensitive method of detection of chlamydiae.
Publisher: Elsevier BV
Date: 09-2016
Publisher: Elsevier BV
Date: 10-1993
Abstract: In this report we describe the isolation, by differential screening, and characterization of a cDNA clone downregulated fivefold in association with the induction of apoptosis in the human leukaemic cell line CEM C7. DNA sequence analysis identified this clone as representing the gene encoding the S20 ribosomal protein. Interestingly, the expression of the S20 mRNA was downregulated early during the induction of apoptosis in this model system, prior to the onset of DNA fragmentation and other morphological changes associated with cell death, suggesting some degree of involvement of this particular gene in the biochemical events that occur during the onset of cell death.
Publisher: Elsevier BV
Date: 02-2000
Publisher: Elsevier BV
Date: 09-1988
DOI: 10.1016/0378-1135(88)90112-5
Abstract: DNA-spot hybridization, cell culture and direct immunofluorescence staining were compared for the detection of avian Chlamydia psittaci strains in cell culture dilutions and in routine s les submitted for diagnosis. With dilutions of infected cell culture material, growth in BGM cells was by far the most sensitive technique, detecting 0.01 infected cells (20 elementary bodies) ml-1. DNA-spot hybridization and direct immunofluorescence staining were of approximately equal sensitivity, both detecting 16 infected cells (3.2 x 10(4) elementary bodies) per ml-1. When 27 avian liver and spleen s les were assayed, all 3 tests performed similarly (13 positive and 12 negative by all 3 tests). This suggests that in most avian s les presented for diagnosis, sufficient numbers of chlamydiae are present to allow any of the test to the be used. Thus, the direct immunofluorescence staining method is currently the test of choice for routine diagnosis since it is available in kit form, is relatively simple and quick to perform, and like DNA-spot hybridization, detects non-viable as well as viable organisms. However, if low levels of chlamydiae are to be effectively detected, such as in carrier birds or birds with recently acquired infections, then cell culture should be used.
Publisher: Wiley
Date: 27-06-2014
Publisher: Elsevier BV
Date: 04-1982
DOI: 10.1016/0006-2952(82)90038-7
Abstract: p-Aminophenol a structural analog and minor metabolite of phenacetin has previously been shown to be a potent nephrotoxic agent. In this report we have shown that p-aminophenol has a marked effect on DNA function and structure. DNA synthesis was inhibited in a dose-dependent manner in human lymphoblastoid cells after exposure to p-aminophenol. Results suggest that DNA synthesis is inhibited by the action of p-aminophenol on DNA structure. At low concentrations of p-aminophenol a reduction in the degree of supercoiling of cellular DNA is observed, as determined by sedimentation under neutral conditions. However at higher concentrations an increase in sedimentation of nucleoids (supercoiled molecules) is obtained which is indicative of an increased level of supercoiling or a more compact structural form of DNA due to folding or aggregation. The number of single strand breaks in DNA, when determined by sedimentation in alkaline sucrose gradients, increases with increasing dose of p-aminophenol. The increase in strand breakage observed at lower concentrations of p-aminophenol agrees with the reduced sedimentation rate obtained under neutral conditions. At higher concentrations of p-aminophenol the extent of breakage of DNA increases under alkaline conditions but an increase in sedimentation occurs under neutral conditions.
Publisher: Elsevier BV
Date: 05-2009
Publisher: Elsevier BV
Date: 05-1981
DOI: 10.1016/S0006-291X(81)80100-3
Abstract: An overview is given of the development of sorbent materials for hydrogen storage. Understanding the surface properties of the adsorbed film is crucial to optimize hydrogen storage capacities. In this work, the lattice gas model (Ono-Kondo) is used to determine the properties of the adsorbed hydrogen film from a single supercritical hydrogen isotherm at 77 K. In addition, this method does not require a conversion between gravimetric excess adsorption and absolute adsorption. The overall average binding energy of hydrogen is 4.4 kJ/mol and the binding energy at low coverage is 9.2 kJ/mol. The hydrogen film density at saturation is 0.10 g/mL corresponding to a local pressure of 1500 bar in the adsorbed phase.
Publisher: Elsevier BV
Date: 06-2007
Publisher: American Society of Hematology
Date: 16-07-2009
DOI: 10.1182/BLOOD-2009-02-202663
Abstract: Venomous snakes produce an array of toxic compounds, including procoagulants to defend themselves and incapacitate prey. The Australian snake Pseudonaja textilis has a venom-derived prothrombin activator homologous to coagulation factors V (FV) and Xa (FXa). Here we show that the FV component (pt-FV) has unique biologic properties that subvert the normal regulatory restraints intended to restrict an unregulated procoagulant response. Unlike human FV, recombinant pt-FV is constitutively active and does not require proteolytic processing to function. Sequence comparisons show that it has shed a large portion of the central B-domain, including residues that stabilize the inactive procofactor state. Remarkably, pt-FV functions in the absence of anionic membranes as it binds snake-FXa with high affinity in solution. Furthermore, despite cleavage in the heavy chain, pt-FV is functionally resistant to activated protein C, an anticoagulant. We speculate this stability is the result of noncovalent interactions and/or a unique disulfide bond in pt-FV linking the heavy and light chains. Taken together, these findings provide a biochemical rationale for the strong procoagulant nature of venom prothrombinase. Furthermore, they illustrate how regulatory mechanisms designed to limit the hemostatic response can be uncoupled to provide a sustained, disseminated procoagulant stimulus for use as a biologic toxin.
Publisher: Elsevier BV
Date: 10-1986
DOI: 10.1016/0006-2952(86)90620-9
Abstract: N-hydroxyparacetamol treatment of rat kidney cells gave rise to a dose-dependent decrease in DNA synthesis. A concentration of 1.0 mM N-hydroxyparacetamol at pH 7.2 decreased the level of DNA synthesis to 13.0 +/- 2.3% of the control value after 1 hr incubation. This compound also caused a perturbation of cell cycle progression. A concentration of 0.44 mM N-hydroxyparacetamol induced G1/S and S phase blocks. These delays became evident at approximately 12 hr after treatment and persisted until about 15 hr when cells started to recover. It seems unlikely that N-hydroxyparacetamol inhibits DNA synthesis and perturbs cycle progression through alterations to DNA structure as such, since this compound failed to alter the migration pattern of naked plasmid DNA.
Publisher: Rockefeller University Press
Date: 03-1991
Abstract: Epstein-Barr virus-specific cytotoxic T lymphocyte clones were shown to be an effective target for their own lysis when incubated in the presence of their specific epitopes but not in the presence of irrelevant epitopes. The mode of cell killing appeared to be by apoptosis and was prevented by previously described inhibitors of the process. Degranulation, as measured by serine esterase activity, was involved in this form of T cell-T cell killing. This is the first report of T cell-T cell killing by apoptosis and is only observed in the presence of a specific epitope. This result may be of significance in the use of peptide-based vaccines.
Publisher: Informa UK Limited
Date: 11-08-2012
DOI: 10.3109/15622975.2011.565073
Abstract: Cancer incidence in schizophrenia is not increased commensurate with higher rates of risk exposures. Here we report an investigation of the DNA damage response, an anti-tumorigenic defence, in immortalised lymphoblasts from patients with schizophrenia. Unirradiated and irradiated (5Gy) lymphoblasts from schizophrenia patients (n = 28) and healthy controls (n = 28) were immunostained for the phosphorylated histone variant H2AX (γH2AX), an index of DNA double-strand breaks. Flow cytometry was used to assess cell cycle distribution and γH2AX immunofluorescence. Rate of DNA repair was quantified by determining the temporal change in γH2AX values following irradiation. In unirradiated lymphoblasts, γH2AX levels were significantly increased in the schizophrenia group compared with controls (effect size = 0.86). This increase was most evident in patients with cognitive deficits. In irradiated lymphoblasts, peak radiation-induced γH2AX levels were significantly reduced in patients. No differences between patients and controls were found in the rate of DNA repair or in cell cycle distribution. The significant differences in DNA damage response signalling observed involve modification of histone variant H2AX and thereby implicate regulatory processes determining chromatin structure in iding lymphoblasts from patients with schizophrenia. The role that aberrant DNA damage response signalling plays in protecting patients from cancer is unclear.
Publisher: Informa UK Limited
Date: 12-2009
DOI: 10.3109/09553000903261263
Abstract: Ionising radiation exposure gives rise to a variety of lesions in DNA that result in genetic instability and potentially tumourigenesis or cell death. Radiation extends its effects on DNA by direct interaction or by radiolysis of H(2)O that generates free radicals or aqueous electrons capable of interacting with and causing indirect damage to DNA. While the various lesions arising in DNA after radiation exposure can contribute to the mutagenising effects of this agent, the potentially most damaging lesion is the DNA double strand break (DSB) that contributes to genome instability and/or cell death. Thus in many cases failure to recognise and/or repair this lesion determines the radiosensitivity status of the cell. DNA repair mechanisms including homologous recombination (HR) and non-homologous end-joining (NHEJ) have evolved to protect cells against DNA DSB. Mutations in proteins that constitute these repair pathways are characterised by radiosensitivity and genome instability. Defects in a number of these proteins also give rise to genetic disorders that feature not only genetic instability but also immunodeficiency, cancer predisposition, neurodegeneration and other pathologies. In the past 50 years our understanding of the cellular response to radiation damage has advanced enormously with insight being gained from a wide range of approaches extending from more basic early studies to the sophisticated approaches used today. In this review we discuss our current understanding of the impact of radiation on the cell and the organism gained from the array of past and present studies and attempt to provide an explanation for what it is that determines the response to radiation.
Publisher: Elsevier BV
Date: 08-2002
Publisher: Informa UK Limited
Date: 1994
Publisher: Elsevier BV
Date: 05-1985
DOI: 10.1016/0024-3205(85)90454-0
Abstract: p-Aminophenol inhibits DNA synthesis and alters the structure of DNA. A decrease in sedimentation of nucleoids from cells treated with p-aminophenol was observed and this decrease in sedimentation was considerably less when cells were incubated with p-aminophenol in an atmosphere of nitrogen or at lower pH values. This compound was also shown to be cytotoxic to cells in culture. These results demonstrate that conditions retarding the autoxidation of p-aminophenol lead to reduced effects on DNA structure and a lesser cytotoxic effect.
Publisher: Wiley
Date: 31-08-1998
DOI: 10.1002/(SICI)1097-0215(19980831)77:5<755::AID-IJC15>3.0.CO;2-0
Abstract: Burkitt's lymphoma cells that vary in their phenotypic characteristics show significantly different degrees of susceptibility to radiation-induced apoptosis. Propensity to undergo apoptosis is reflected in the degradation of substrates such as DNA-dependent protein kinase but the status of bcl-2, c-myc and p53 has been uninformative. In this study, we have focused on 2 Epstein-Barr virus (EBV)-associated Burkitt's cell lines, one (WW2) susceptible and the other (BL29) resistant to etoposide-induced apoptosis. Differences in expression of BHRF1, an EBV gene that is homologous to the Bcl-2 proto-oncogene and known to inhibit apoptosis, or changes in apoptosis inhibitory proteins (IAPs), did not appear to account for the difference in susceptibility in the 2 cell lines. Cytoplasmic extracts from etoposide-treated WW2 cells caused apoptotic changes in nuclei isolated from either BL29 or WW2 cells, whereas extracts from BL29 cells failed to do so. In addition, extracts from etoposide-treated WW2 cells degraded the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), an important indicator of apoptosis, but this protein was resistant to degradation by BL29 extracts. It appears likely that caspase 3 (CPP32) is involved in this degradation since it was activated only in the apoptosis susceptible cells and the pattern of cleavage of DNA-PKcs was similar to that reported previously with recombinant caspase 3. As observed previously, addition of caspase 3 to nuclei failed to induce morphological changes indicative of apoptosis, but addition of caspase 3 to nuclei in the presence of extract from the resistant cells led to apoptotic changes. We conclude that resistance to apoptosis in BL29 cells is due to a failure of etoposide to activate upstream effectors of caspase activity.
Publisher: Elsevier BV
Date: 12-1986
DOI: 10.1016/0161-5890(86)90020-9
Abstract: Rearrangements of the T-cell receptor (TCR), beta-chain genes and immunoglobulin (Ig) heavy chain genes in several T-cell leukaemias (T-ALL and ATL), and some B-cell and myelogenous leukaemias were investigated. Two out of 15 cases of T-cell leukaemia tested failed to show a rearrangement pattern of TCR beta genes although both expressed mRNA for this gene. The remaining 13 cases showed erse patterns of rearrangements involving either C beta 1, C beta 2 or both. C beta 1 but not C beta 2 was deleted in some of the T-cell leukaemias. Polyclonal T cells from four normal in iduals showed the germ line pattern and an additional two bands in Hind III digested DNA. Except for one, all cases of C-ALL (B-cell leukaemia) showed a rearranged JH locus which was not evident in any of T-cell leukaemias studied. One case of B-cell leukaemia showed a rearrangement of both TCR beta genes and JH genes. The results of these studies suggest that rearrangement of TCR and Ig genes occurs at a very early stage of differentiation of stem cells and does not appear to play a direct role in leukaemogenesis per se.
Publisher: Hindawi Limited
Date: 2005
DOI: 10.1002/HUMU.9341
Abstract: Mutations in the ATM gene are responsible for the autosomal recessive disorder, ataxia telangiectasia (A-T). Mutations in different ethnic groups are distributed along the entire length of the large, 66 exon ATM gene. In this study, A-T patients from 16 Russian families were assessed for immunological status and ATM haplotype analysis, and screened for ATM mutations. Haplotype analysis was performed to enhance the efficiency of mutation detection. Mutations predicted to cause disease were identified in 19 of 32 alleles (59%), including a truncating mutation (c.5932G>T) that was identified in 8/32 (25%) alleles both by haplotype analysis and mutation screening. This mutation has been found in low abundance in other European A-T cohorts suggesting that this founder-effect mutation may be of Russian origin. The abundance of this mutation may allow for large-scale screening of cancer patients to help clarify the role of ATM in breast and other cancers. Nine of the remaining mutations were previously unreported, and add to the multitude of unique mutations found throughout the gene.
Publisher: Elsevier BV
Date: 06-1995
Abstract: Several studies support a role for the multiple tumor suppressor gene (MTS1) in the malignant progression of different tumor types. In this study we have examined the status of the MTS1 gene in a variety of non-astrocytic tumors of the central nervous system. It was not possible, using multiplex PCR with primers for MTS1 and D9S196, a chromosome 9q marker, to demonstrate deletions of MTS1 in 59 primary non-astrocytic tumors. Two out of 5 (40%) secondary tumors showed evidence of homozygous deletion of MTS1. The results obtained here for primary non-astrocytic tumors contrast with those previously described for astrocytic tumors where a high frequency of deletions of MTS1 was associated with tumor progression.
Publisher: Elsevier BV
Date: 07-2008
DOI: 10.1016/J.DNAREP.2008.03.008
Abstract: Failure to maintain the integrity of DNA/chromatin can result in genome instability and an increased risk of cancer. The description of a number of human genetic disorders characterised not only by cancer predisposition but by a broader phenotype including neurodegeneration suggests that maintaining genome stability is also important for preserving post-mitotic neurons. The identification of genes associated with other neurodegenerative disorders provides further evidence for the importance of DNA damage response and DNA repair genes in protecting against neurodegeneration. This theme is further developed in this review.
Publisher: Oxford University Press (OUP)
Date: 02-11-1994
Abstract: The description of genes and genetic syndromes, such as ataxia-telangiectasia, that predispose some women to breast cancer will provide greater insight into the genetic basis of cancer susceptibility. Our goal was to establish cell lines from patients with breast and bladder cancers, to screen for enhanced levels of radiation-induced arrest in the G2 phase of the cell cycle such as is observed in ataxia-telangiectasia heterozygotes, and to correlate G2 arrest with other prognostic indicators of these cancers and in vivo radiosensitivity. Epstein-Barr virus-transformed lymphoblastoid cells were established from 108 female patients with breast cancer and 24 age-matched female control subjects, and from 45 patients with bladder cancer and 18 age-matched control subjects. Cells were exposed to 3 Gy of gamma radiation, and the percentages of cells in G1 and G2 phases were determined at 18 and 24 hours after irradiation by fluorescence-activated cell sorter analysis. Postirradiation delay in G2 phase was determined by calculating the percentage of cells in G2 and by using the ratio G2/G1. When we determined the percentage of cells in G2 phase at 18 hours after irradiation in 108 lymphoblastoid cells from breast cancer patients, we observed an increase of between 3% and 38% in the number of cells in G2 phase in comparison with cells that were not irradiated. Comparison with previous G2-phase arrest data for ataxia-telangiectasia heterozygotes using a cutoff point at 29% delay demonstrated that 20% and 8% of the breast cancer cell lines of the case patients and control subjects, respectively, fell into that category (P < .001). At the same time after irradiation, it was not possible to distinguish between bladder cancer cell lines (7%) and those of the corresponding control group (6%). Assessment of radiation effects by G2/G1 ratio showed that 18% of the breast cancer patients and 8% of the control subjects were in the high range. When G2 arrest was correlated with other prognostic factors, we found that case patients with a greater G2 block were more likely to have had a family history of breast cancer (P < .006) and more aggressive tumors when assessed by number of involved lymph nodes (P < .002) and tumor size (P < .05). Furthermore, an adverse response to radiotherapy was observed in a group of patients with high G2 arrest. While the postirradiation increase in G2-phase arrest in cells from breast cancer patients observed in this study may indicate genetic heterozygosity for ataxia-telangiectasia, it might also reflect other genetic abnormalities important to breast cancer.
Publisher: American Chemical Society (ACS)
Date: 06-1989
DOI: 10.1021/JM00126A034
Abstract: The isolation and structures of a new patellamide (patellamide D) and two new lissoclinamides (lissoclinamides 4 and 5) from the aplousobranch ascidian Lissoclinum patella are described. Structures were determined largely by using two-dimensional NMR techniques and mass spectrometry. These peptides and other members of the patellamide and lissoclinamide families that have been reported previously are found within the obligate algal symbiont of the genus Prochloron. The cytotoxicities of the compounds toward fibroblast and tumor cell lines are reported. One of these compounds, lissoclinamide 4, is markedly more toxic than other members of the family. Structure-activity relationships are discussed.
Publisher: American Chemical Society (ACS)
Date: 06-1989
DOI: 10.1021/JM00126A035
Abstract: The isolation and structures of two new cyclic hexapeptides and two new macrocyclic ethers from the aplousobranch ascidian Lissoclinum bistratum are described. Their structures were determined by two-dimensional NMR techniques. The hexapeptides, named bistratamide A and bistratamide B, differ only by the presence or absence of one double bond. They were tested for cytotoxicity toward human fibroblast and tumor cell lines and displayed similar toxicities to the octapeptides called patellamides from Lissoclinum patella. The peptides are found within the obligate algal symbiont Prochloron but clearly differ from peptides isolated from the same Prochloron of L. patella. The macrocyclic ethers isolated from L. bistratum are exceedingly potent in cytotoxicity. They have been named bistratenes A and B, and structures for these compounds are proposed.
Publisher: Springer Science and Business Media LLC
Date: 08-1978
DOI: 10.1038/274484A0
Publisher: Proceedings of the National Academy of Sciences
Date: 18-11-2013
Abstract: The cysteine protease caspase-2 has been implicated in the suppression of oncogene-mediated tumor formation. However, the mechanisms underlying the function of caspase-2 as a tumor suppressor are not well defined. In this study, we use a well-characterized mouse lymphoma model and demonstrate a critical role for caspase-2 in maintaining genome stability and in the suppression of tumorigenesis following loss of the essential DNA repair gene ataxia telangiectasia mutated ( Atm ). Our findings suggest that caspase-2 cooperates with ATM to suppress genomic instability, oxidative stress, and tumor progression.
Publisher: Oxford University Press (OUP)
Date: 1990
DOI: 10.1269/JRR.31.340
Abstract: We describe here the use of the Van de Graaff accelerator as a source of high energy neutrons for biological irradiation. Single-stranded bacteriophage M13 DNA was chosen as the system to determine the relative biological effectiveness of monoenergetic neutrons. A Standard Neutron Irradiation Facility (SNIF) was established using a 3 MV Van de Graaff accelerator. The 2D (d,n)3He nuclear reaction was used to produce neutron fluxes of 3 x 10(8) cm 2 sec-1 yielding dose rates as high as 50 Gy h-1. A detailed description of the neutron source, neutron fluence measurement, dose calculation and calibration are included. Exposure of single-stranded bacteriophage M13 DNA to 90 Gy of neutrons reduced survival to 0.18% of the unirradiated value. 500 Gy of gamma-rays were required for the same level of killing, and RBE was estimated at 6 based on Do values. Determination of the extent of DNA damage after exposure to cleavage using gel electrophoresis, gave RBE values of 6-8 which was very similar to that observed for bacteriophage survival. The facility described here provides a reproducible source of high energy monoenergetic neutrons and dose levels suitable for experiments designed to measure DNA damage and effects on DNA synthesis.
Publisher: Springer New York
Date: 2017
DOI: 10.1007/978-1-4939-6955-5_10
Abstract: ATM (ataxia-telangiectasia mutated) protein kinase is a key regulator of cellular responses to DNA damage and oxidative stress. DNA damage triggers complex cascade of signaling events leading to numerous posttranslational modification on multitude of proteins. Understanding the regulation of ATM kinase is therefore critical not only for understanding the human genetic disorder ataxia-telangiectasia and potential treatment strategies, but essential for deciphering physiological responses of cells to stress. These responses play an important role in carcinogenesis, neurodegeneration, and aging. We focus here on the identification of DNA damage inducible ATM phosphorylation sites to understand the importance of autophosphorylation in the mechanism of ATM kinase activation. We demonstrate the utility of using immunoprecipitated ATM in quantitative LC-MS/MS workflow with stable isotope dimethyl labeling of ATM peptides for identification of phosphorylation sites.
Publisher: Spandidos Publications
Date: 05-07-2019
Publisher: Elsevier BV
Date: 10-1995
DOI: 10.1016/0378-1119(95)00502-W
Abstract: Arginyl-tRNA synthetase (ArgRS) plays a key role in protein synthesis as part of a multienzyme complex with a number of other aminoacyl-tRNA synthetase (aaRS) enzymes. We have isolated a full-length cDNA encoding ArgRS as part of a project on complementation of radiosensitivity in human cells with an Epstein-Barr Virus (EBV) vector-based human cDNA library. DNA sequence analysis identified an open reading frame of 1983 nucleotides with 87% homology to other mammalian ArgRS genes. The deduced amino acid (aa) sequence (661 aa) showed 87.7% identity to the Chinese hamster ovary (CHO) enzyme and 37.7% identity to the homologous Escherichia coli enzyme. Northern blot analysis revealed the presence of a single mRNA species of approx. 2.2 kb. The results described here demonstrate that ArgRS is highly conserved in mammalian cells and confirm the presence of a hydrophobic N-terminal region in the higher-molecular-weight complexed form of ArgRS.
Publisher: Wiley
Date: 1995
Abstract: In addition to a role for de novo protein synthesis in apoptosis we have previously shown that activation of a protein phosphatase or loss of activity of a kinase is also important in radiation-induced apoptosis in human cells [Baxter, and Lavin (1992): J Immunol 148:149-1954]. We show here that some inhibitors of protein kinases exacerbate radiation-induced apoptosis in the human cell line BM13674. The specific protein kinase A inhibitor isoquinoline sulfonamide (20 microM) gave rise to significantly increased levels of apoptosis at 2-6 h postirradiation compared to values after radiation exposure only. The same concentration of isoquinolinesulfonamide, which was effective in increasing apoptosis, reduced activity markedly. A 66% inhibition of cyclic AMP-dependent protein kinase A activity occurred in unirradiated cells at this concentration of H89 and activity was reduced to 58% in irradiated cells. Calphostin C, a specific inhibitor of protein kinase C, at a concentration of 0.1 microM, which caused 68% inhibition of enzyme activity in irradiated cells, failed to enhance the level of radiation-induced apoptosis. Other kinase inhibitors did not lead to an additional increase in apoptosis over and above that observed after irradiation. The results obtained here provide further support for an important role for modification of existing proteins during radiation-induced apoptosis.
Publisher: Informa UK Limited
Date: 1977
DOI: 10.1080/09553007714550121
Abstract: The effect of ultra-violet (U.V.)-irradiation on DNA replication was studied in a U.V.-resistant, human melanoma cell-line (MM96). Semi-conservative synthesis of DNA was decreased about five-fold by a U.V.-dose of 100 ergs/mm2. The size of DNA fragments synthesized in irradiated cells at short times after U.V. was smaller than those synthesized in unirradiated cells. Elongation of these fragments occurred with time, and 6 hours after irradiation cells synthesized DNA in fragments of the same size as obtained in unirradiated cells. In this post-replication repair process, elongation appeared to involve de novo synthesis and was not inhibited by theophylline.
Publisher: Informa UK Limited
Date: 1976
DOI: 10.1080/09553007614550781
Abstract: Mouse neuroblastoma cells differentiate when grown in the absence of serum differentiation is reversed on the addition of serum. Differentiated cells are more sensitive to U.V.-radiation than proliferating cells. Whereas addition of serum to differentiated neuroblastoma cells normally results in immediate, synchronous entry into S phase, irradiation just before the addition of serum results in a long delay in the onset of DNA replication. During this lag period, incorporated 3H-thymidine appears in the light density region of CsCl gradientss, reflecting either repair synthesis or abortive replication. Post-replication repair (gap-filling) was found to be present in proliferating cells and at certain times in differentiated cells. It is suggested that the sensitivity of differentiated neuroblastoma cells to U.V.-radiation may be due to ineffective post-replication repair or to deficiencies in more than one repair mechanism, with reduction in repair capacity beyond a critical threshold.
Publisher: Wiley
Date: 06-1989
Abstract: We have previously demonstrated that when freshly isolated childhood T-cell acute lymphoblastic leukaemia cells are incubated in growth medium after isolation from blood, chromatin is rapidly cleaved into nucleosomal sized fragments that are multiples of 200 bp. The fragmentation is similar to that observed in other types of cells undergoing apoptosis or programmed cell death. In this study we describe a more comprehensive approach to the study of DNA fragmentation in leukaemia. Fragmentation was observed in freshly isolated cells from patients with T-cell acute lymphoblastic leukaemia and in one with common acute lymphoblastic leukaemia. Frozen s les of T-cell acute lymphoblastic leukaemia, common acute lymphoblastic leukaemia, and acute myeloid leukaemia cells also showed fragmentation of DNA. However, no fragmentation was evident in normal leukocytes treated under the same conditions. Ultrastructural studies on the isolated leukaemia cells demonstrate that the chromatin cleavage observed biochemically is associated with morphological changes characteristic of apoptosis.
Publisher: Public Library of Science (PLoS)
Date: 21-10-2010
Publisher: Elsevier BV
Date: 11-1987
DOI: 10.1016/0006-291X(87)91629-9
Abstract: DNA topoisomerase type I and II activities were determined by serial dilution in nuclear extracts from control and ataxia-telangiectasia lymphoblastoid cells. Topoisomerase I activity, assayed by relaxation of supercoiled plasmid DNA, was found to be approximately the same in both cell types. In order to remove interference from topoisomerase I, the activity of topoisomerase II was measured by the unknotting of knotted P4 phage DNA in the presence of ATP. The activity of topoisomerase II was markedly reduced in two ataxia-telangiectasia cell lines, AT2ABR and AT8ABR, compared to controls. This reduction in activity was detected with increasing concentration of protein and in time course experiments at a single protein concentration. A third cell line, AT3ABR, did not have a detectably lower activity of topoisomerase II when assayed under these conditions. The difference in topoisomerase II activity in the ataxia-telangiectasia cell lines examined may reflect to some extent the heterogeneity observed in this syndrome.
Publisher: International Union of Crystallography (IUCr)
Date: 10-06-2006
Publisher: Elsevier BV
Date: 10-1995
Publisher: Elsevier BV
Date: 08-1996
DOI: 10.1016/S0952-7915(96)80030-6
Abstract: The gene responsible for the defect in the human genetic disorder ataxia-telangiectasia, ATM, was cloned recently. The part of the gene coding for a phosphatidylinositol 3-kinase domain showed it to be related to a family of genes involved in signal transduction, cell cycle control and the response to DNA damage. The elucidation of the role of the ATM gene product will provide valuable insight into the radiosensitivity, cancer predisposition, immunodeficiency and neuropathology that characterize this syndrome.
Publisher: Wiley
Date: 08-1992
Abstract: Bistratene A, a polyether toxin isolated from the colonial ascidian Lissoclinum bistratum, causes incomplete differentiation of human leukemia (HL-60) cells apparently through a mechanism not involving protein kinase C. In view of the importance of phosphorylation/dephosphorylation in cellular growth and differentiation we have investigated protein phosphorylation in these cells following exposure to bistratene A, using two-dimensional polyacrylamide gel electrophoresis. Marked increases in the phosphorylation of a protein of 20 kDa, pl 6.7, and a basic protein of 25 kDa were observed after incubation with bistratene A. A comparison was made with cells treated with 12-O-tetradecanoylphorbol 13-acetate and bryostatin 5. While changes in phosphorylation patterns were observed with these two compounds, the 20 kDa and 25 kDa proteins did not undergo phosphorylation changes. The 20 kDa protein was induced rapidly by very low concentrations of bistratene A reaching near maximal levels with 10 nM at 15 min exposure. This protein was found to be localised to the cytoplasm. Phosphoaminoacid analysis demonstrated that the majority of 32P was present in serine and tyrosine residues. The increased phosphorylation of the 20 kDa protein appeared to be due to hyperphosphorylation of existing protein although there was some increase in the amount of the protein. These results suggest that bistratene A will be a useful tool with which to investigate cellular differentiation mechanisms.
Publisher: American Chemical Society (ACS)
Date: 12-1987
DOI: 10.1021/BI00399A009
Publisher: Elsevier BV
Date: 08-1995
DOI: 10.1016/0360-3016(94)00659-9
Abstract: To determine whether the quality of ionizing radiation is critical for activation of a radiation-specific DNA binding protein. We have previously shown that after exposing Epstein Barr virus-transformed lymphoblastoid cells to ionizing radiation, a specific DNA binding factor appears in the nucleus apparently as a result of translocation from the cytoplasm. This protein binds to a number of different genomic sequences and a consensus motif has been identified. Because the protein was not activated by UV light, it was of interest whether high linear energy transfer (LET) radiation was capable of activation. We describe here the activation of a specific DNA binding protein by high LET neutron radiation. The protein binds a region adjacent to and overlapping with the distal repeat within a 179 base-pair fragment of the well-characterized Simian Virus (SV40) bidirectional promoter/enhancer element. The appearance of the DNA binding activity was dose dependent and reached a maximum level by 90 min postirradiation. A reduction in DNA binding activity was evident at later times after irradiation. The specific nature of this response and the rapidity of activation may indicate a pivotal role for this protein in repair or in some other aspect of the cellular response to radiation damage.
Publisher: Elsevier BV
Date: 03-1991
DOI: 10.1016/0003-2697(91)90012-I
Abstract: We describe a simple and rapid method for the isolation of specific genomic DNA sequences recognized by DNA-binding proteins. This procedure consists of four steps: (1) restriction enzyme digestion and size fractionation of genomic DNA (2) DNA--protein binding using the gel mobility-shift assay (3) ligation of isolated DNA fragments followed by transformation of Escherichia coli and (4) screening of recombinant clones for inserts containing specific DNA--protein binding sequences. We have used this protocol to isolate human DNA sequences, 100-200 bp in size, that are recognized by both partially purified and affinity purified proteins. Unlike other procedures designed to identify genomic target sequences, the method described does not require polymerase chain reaction or successive immunoprecipitations.
Publisher: Elsevier BV
Date: 12-2019
DOI: 10.1016/J.TOXLET.2019.09.021
Abstract: Toluene-diisocyanate (TDI) is mainly used in the manufacturing process of polyurethane foams, and is a potent inducer of occupational asthma characterized by airway inflammation and airway hyperreactivity. Thymic stromal lymphopoietin (TSLP) plays an important role in the development of asthma, and correlating with the differentiation of Th2 and Th17 cells. However, the role of TSLP in TDI-induced asthma remains unclear. In this study, 96 TDI-exposed workers as well as a mouse model of TDI-induced asthma were investigated. The air exposure assessment result of TDI in the workplace showed that workers were exposed to inhalation of a very high concentration of TDI, approximately 8 times the recommended level, leading to a decrease in pulmonary function and an increase in inflammatory cells, as well as TSLP and IgE levels in the supernatant of sputum obtained from exposed workers. In order to further investigate the role of TSLP in the pathogenesis of TDI-induced asthma, a mouse model of TDI-induced asthma was also employed. Histopathological analysis of mouse lung and bronchus showed an obvious infiltration of inflammatory cells around the bronchus. The levels of inflammatory cells, IFN-γ, IL-4 and IL-17 in bronchoalveolar lavage fluid (BALF), the expression levels of TSLP protein and ROR-γt and IL-17 mRNA in mouse lung tissues were also significantly increased. However, after treatment with TSLP neutralizing antibody (TSLP-Ab), the degree of pulmonary and bronchial inflammation in mice was significantly alleviated, and the levels of inflammatory cells, IFN-γ, IL-4 and IL-17 in BALF, and the expression levels of ROR-γt and IL-17 mRNA in lung tissue were significantly decreased. Our data shows that TSLP plays an important role in the pathogenesis of TDI-induced asthma, and that TSLP-Ab can effectively alleviate TDI-induced airway inflammation of asthma.
Publisher: Elsevier BV
Date: 07-1989
DOI: 10.1016/0921-8777(89)90045-1
Abstract: Inhibition of DNA synthesis was studied in gamma-irradiated lymphoblastoid cells from patients with Alzheimer's disease and Down's syndrome. A normal biphasic pattern of inhibition was observed over a dose range of 0-4 krad of gamma-rays in all of the cell lines. 3 out of 4 Down's and all the Alzheimer's cell lines were shown to be hypersensitive to ionizing radiation based on induced chromosomal aberrations. Increased G2 phase delay, comparable to that occurring in ataxia-telangiectasia cells, was observed for some of the cell lines, after exposure to gamma-rays. Contrary to other data in the literature these results demonstrate that radioresistant DNA synthesis is not an intrinsic feature of all disorders characterized by radiosensitivity.
Publisher: Oxford University Press (OUP)
Date: 07-03-2013
DOI: 10.1093/HMG/DDT101
Abstract: The autosomal recessive disorder ataxia-telangiectasia (A-T) is characterized by genome instability, cancer predisposition and neurodegeneration. Although the role of ataxia-telangiectasia mutated (ATM) protein, the protein defective in this syndrome, is well described in the response to DNA damage, its role in protecting the nervous system is less clear. We describe the establishment and characterization of patient-specific stem cells that have the potential to address this shortcoming. Olfactory neurosphere (ONS)-derived cells were generated from A-T patients, which expressed stem cell markers and exhibited A-T molecular and cellular characteristics that included hypersensitivity to radiation, defective radiation-induced signaling and cell cycle checkpoint defects. Introduction of full-length ATM cDNA into these cells corrected defects in the A-T cellular phenotype. Gene expression profiling and pathway analysis revealed defects in multiple cell signaling pathways associated with ATM function, with cell cycle, cell death and DNA damage response pathways being the most significantly dysregulated. A-T ONS cells were also capable of differentiating into neural progenitors, but they were defective in neurite formation, number of neurites and length of these neurites. Thus, ONS cells are a patient-derived neural stem cell model that recapitulate the phenotype of A-T, do not require genetic reprogramming, have the capacity to differentiate into neurons and have potential to delineate the neurological defect in these patients.
Publisher: Wiley
Date: 05-1994
DOI: 10.1111/J.1464-410X.1994.TB07638.X
Abstract: To determine whether p53 expression is a marker of tumour progression in superficially invasive (pT1) transitional cell carcinoma of the bladder. The immunohistochemical status of the p53 protein in 28 pT1 primary bladder cancers was determined on frozen tissue and archival paraffin block sections using three primary antibodies (CM-1, PAB1801 and D07). The findings were compared with the patients' progress. All the patients, except for those who died during the course of the study, were followed up by check cystoscopy for a minimum of 2 years. Immediately adjacent frozen sections stained identically in 10 of 16 cases for CM-1 and PAB1801. For paraffin sections, identical staining patterns were seen for PAB1801 and D07 in 21 of 26 sections. However, inter- and intra-tumour staining for p53 was very variable, even with the same antibody. The heterogeneity of p53 positive cell distribution in the tumours indicates potential for significant s ling errors if random sections are chosen as representative of p53 status. The p53 status of the primary tumours did not relate to patient outcome. The results obtained do not support the use of immunohistological p53 expression as a discriminating prognostic indicator in pT1 transitional cell carcinoma of the bladder.
Publisher: Wiley
Date: 02-1989
DOI: 10.1038/ICB.1989.7
Abstract: Immunoglobulin and T cell receptor gene probes have been used to investigate cell lineage and monoclonality in lymphoid malignancies. In the present study we have used T cell receptor beta- and gamma-chain gene probes to screen for abnormal rearrangements of these genes in B lymphoblastoid cells from patients with ataxia-telangiectasia (A-T). No rearrangement of either gene was observed but deletion of a beta-chain gene allele is described for one A-T cell line. Expression of mRNA hybridizing to the beta-chain gene probe was demonstrated for two A-T homozygotes (brother and sister) as well as for their mother (heterozygote). This transcript was found to be truncated in all three cases.
Publisher: Elsevier BV
Date: 07-1978
Publisher: Springer Science and Business Media LLC
Date: 1988
DOI: 10.1007/BF00264622
Abstract: Lissencephaly is a devastating neurological disorder caused by defective neuronal migration. The LIS1 (or PAFAH1B1) gene was identified as the gene mutated in lissencephaly patients, and was found to regulate cytoplasmic dynein function and localization. In particular, LIS1 is essential for anterograde transport of cytoplasmic dynein as a part of the cytoplasmic dynein-LIS1-microtubule complex in a kinesin-1-dependent manner. However, the underlying mechanism by which a cytoplasmic dynein-LIS1-microtubule complex binds kinesin-1 is unknown. Here, we report that mNUDC (mammalian NUDC) interacts with kinesin-1 and is required for the anterograde transport of a cytoplasmic dynein complex by kinesin-1. mNUDC is also required for anterograde transport of a dynactin-containing complex. Inhibition of mNUDC severely suppressed anterograde transport of distinct cytoplasmic dynein and dynactin complexes, whereas motility of kinesin-1 remained intact. Reconstruction experiments clearly demonstrated that mNUDC mediates the interaction of the dynein or dynactin complex with kinesin-1 and supports their transport by kinesin-1. Our findings have uncovered an essential role of mNUDC for anterograde transport of dynein and dynactin by kinesin-1.
Publisher: Spandidos Publications
Date: 31-12-2019
Publisher: Elsevier BV
Date: 03-2016
DOI: 10.1016/J.TOXICON.2015.12.017
Abstract: Pseudechis australis is one of the most venomous and lethal snakes in Australia. Numerous phospholipase A2 (PLA2) isoforms constitute a major portion of its venom, some of which have previously been shown to exhibit not only enzymatic, but also haemolytic, neurotoxic and anticoagulant activities. Here, we have purified a potent anticoagulant PLA2 (identified as PA11) from P. australis venom to investigate its phospholipase, anticoagulant, haemolytic and cytotoxic activities and shown that addition of 11 nM PA11 resulted in a doubling of the clotting time of recalcified whole blood. We have also demonstrated that PA11 has high PLA2 enzymatic activity (10.9 × 10(4) Units/mg), but low haemolytic activity (0.6% of red blood cells hydrolysed in the presence of 1 nM PA11). PA11 at a concentration lower than 600 nM is not cytotoxic towards human cultured cells. Chemical modification experiments using p-bromophenacyl bromide have provided evidence that the catalytic histidine of PA11 is critical for the anticoagulant activity of this PLA2. PA11 that was subjected to trypsin digestion without previous reduction and alkylation of the disulfide bonds maintained enzymatic and anticoagulant activity, suggesting that proteolysis alone cannot abolish these properties. Consistent with these results, administration of PA11 by gavage in a rabbit stasis thrombosis model increased the clotting time of recalcified citrated whole blood by a factor of four. These data suggest that PA11 has potential to be developed as an anticoagulant in a clinical setting.
Publisher: Wiley
Date: 06-1991
DOI: 10.1111/J.1365-2052.1991.TB00678.X
Abstract: The bacteriophage M13 DNA was used to detect hypervariable minisatellites in several families of Booroola sheep as well as Merino and Suffolk sheep. Digestion of sheep DNA gave rise to three to eight fragments with different restriction enzymes demonstrating considerable polymorphism between the different breeds. The length of informative DNA fragments varied in size from 6 to 20kb. The DNA fingerprints generated were in idual specific and allowed for differentiation between closely related animals. The pattern obtained with sheep DNA was different from that observed with humans and other vertebrates in the proportion of high molecular weight DNA fragments present. Pedigree analysis of DNA patterns of dams and their offspring for several sets of twins and triplets showed a clear distinction between in iduals and failed to reveal the presence of monozygosity.
Publisher: Elsevier BV
Date: 06-1992
DOI: 10.1016/0165-4608(92)90014-Y
Abstract: Ataxia telangiectasia (AT) is a multiform genetic disease characterized by immunodeficiency, cerebellar abnormalities, and cancer predisposition. Heterozygotes also have an increased risk of developing several different cancers. It has been estimated that as many as 18% of all patients with breast cancer, the cancer most clearly associated with AT heterozygotes, may be carriers of the AT gene. We describe an assay for AT heterozygotes that relies on the previous observation that cells from AT homozygotes show a greater and more prolonged radiation-induced accumulation in the G2 phase of the cell cycle than do normal controls. We showed that all 6 A-T heterozygotes show a greater extent of G2 phase delay at different times postirradiation than do controls. The degree of accumulation was less than that observed in AT homozygotes. Only two of 22 controls showed overlap with heterozygotes at 18 hours postirradiation, and that number was reduced to one at the 24-hour point. As a group, AT heterozygotes were intermediate between controls and AT homozygotes at both time points after irradiation. This assay is relatively simple and reliable and can be performed in any laboratory with access to both Epstein-Barr virus (EBV) for transformation of lymphocytes and a fluorescence-activated cell analyzer.
Publisher: Elsevier BV
Date: 12-2017
Publisher: Informa UK Limited
Date: 11-11-2016
Publisher: Springer Science and Business Media LLC
Date: 12-1998
DOI: 10.1038/3882
Abstract: The human genetic disorder ataxia-telangiectasia (AT) is characterized by immunodeficiency, progressive cerebellar ataxia, radiosensitivity, cell cycle checkpoint defects and cancer predisposition. The gene mutated in this syndrome, ATM (for AT mutated), encodes a protein containing a phosphatidyl-inositol 3-kinase (PI-3 kinase)-like domain. ATM also contains a proline-rich region and a leucine zipper, both of which implicate this protein in signal transduction. The proline-rich region has been shown to bind to the SH3 domain of c-Abl, which facilitates its phosphorylation and activation by ATM. Previous results have demonstrated that AT cells are defective in the G1/S checkpoint activated after radiation damage and that this defect is attributable to a defective p53 signal transduction pathway. We report here direct interaction between ATM and p53 involving two regions in ATM, one at the amino terminus and the other at the carboxy terminus, corresponding to the PI-3 kinase domain. Recombinant ATM protein phosphorylates p53 on serine 15 near the N terminus. Furthermore, ectopic expression of ATM in AT cells restores normal ionizing radiation (IR)-induced phosphorylation of p53, whereas expression of ATM antisense RNA in control cells abrogates the rapid IR-induced phosphorylation of p53 on serine 15. These results demonstrate that ATM can bind p53 directly and is responsible for its serine 15 phosphorylation, thereby contributing to the activation and stabilization of p53 during the IR-induced DNA damage response.
Publisher: Croatian Society for Medical Biochemistry and Laboratory Medicine
Date: 15-10-2019
Abstract: Introduction: Failure to obtain complete blood clotting in serum is a common laboratory problem. Our aim was to determine whether snake prothrombin activators are effective in clotting blood and producing quality serum for analyte measurement in anticoagulated patients. Materials and methods: Whole blood clotting was studied in a total of 64 blood s les (41 controls, 20 Warfarin patients, 3 anticoagulated patients using snake venom prothrombin activator (OsPA)) with plain tubes. Coagulation was analysed using a visual assay, Hyland-Clotek and thromboelastography. Healthy control blood was spiked with a range of anticoagulants to determine the effectiveness of OsPa-induced clotting. A paired analysis of a Dabigatran patient and a control investigated the effectiveness of the OsPA clotting tubes. Biochemical analytes (N = 31) were determined for 7 s les on chemistry and immunoassay analysers and compared with commercial tubes. Results: Snake venom prothrombin activators efficiently coagulated blood and plasma spiked with heparin and commonly used anticoagulants. Clotting was observed in the presence of anticoagulants whereas no clotting was observed in BDRST tubes containing 3 U/mL of heparin. Snake venom prothrombin activator enhanced heparinised blood clotting by shortening substantially the clotting time and improving significantly the strength of the clot. Comparison of 31 analytes from the blood of five healthy and two anticoagulated participants gave very good agreement between the analyte concentrations determined. Conclusions: Our results showed that the snake venom prothrombin activators OsPA and PtPA efficiently coagulated recalcified and fresh bloods with or without added anticoagulants. These procoagulants produced high quality serum for accurate analyte measurement.
Publisher: Elsevier BV
Date: 04-1997
Abstract: Recent evidence suggests that the growing family of cysteine proteases related to the interleukin-1beta-converting enzyme (ICE) is of central importance in mediating apoptosis. Proteolytic cleavage of a small group of cellular substrates by these enzymes in association with the onset of apoptosis has been reported. In the present study, we searched a protein data base for potential death substrates possessing the CPP32 cleavage site, DEVD, and identified several candidates including RFC140, the large subunit of replication factor C, which we subsequently demonstrated to be specifically cleaved in a variety of cell types undergoing apoptosis in response to different cytotoxic agents, whereas no degradation is observed in a cell line resistant to etoposide-induced apoptosis. The abrogation of RFC140 cleavage in apoptotic extracts by Ac-DEVD-CHO, a potent inhibitor of CPP32, together with the finding that a CPP32 consensus cleavage sequence, DEVD, exists in RFC140, suggests that CPP32 or a close relative is responsible for RFC140 degradation in apoptosis.
Publisher: American Chemical Society (ACS)
Date: 06-1990
DOI: 10.1021/JM00168A016
Abstract: Two new lissoclinamides (lissoclinamides 7 and 8) have been isolated from the aplousobranch ascidian Lissoclinum patella. These lissoclinamides are cyclic heptapeptides with the same structural features as lissoclinamides 4 and 5 reported earlier, containing an oxazoline ring, one proline, one valine, two phenylalanine residues, and thiazole and/or thiazoline rings. All four peptides have the same sequence of amino acids around the ring and differ from one another only in their stereochemistry or the number of thiazole and thiazoline rings. The cytotoxicities of the compounds were tested with human fibroblast and bladder carcinoma cell lines and normal lymphocytes. Slight changes in structure resulted in marked differences in the cytotoxicities of these compounds. The most potent is lissoclinamide 7, containing two thiazoline rings, which rivals didemnin B in cytotoxicity in vitro.
Publisher: Wiley
Date: 16-12-2013
DOI: 10.1096/FJ.13-236984
Abstract: Faithful chromosome segregation is required for preserving genomic integrity. Failure of this process may entail chromatin bridges preventing normal cytokinesis. To test whether RAD50, a protein normally involved in DNA double-strand break repair, is involved in abnormal cytokinesis and formation of chromatin bridges, we used immunocytochemical and protein interaction assays. RAD50 localizes to chromatin bridges during aberrant cytokinesis and subsequent stages of the cell cycle, either decorating the entire bridge or focally accumulating at the midbody zone. Ionizing radiation led to an ∼4-fold increase in the rate of chromatin bridges in an ataxia telangiectatica mutated (ATM)-dependent manner in human RAD50-proficient fibroblasts but not in RAD50-deficient cells. Cells with a RAD50-positive chromatin bridge were able to continue cell cycling and to progress through S phase (44%), whereas RAD50 knockdown caused a deficiency in chromatin bridges as well as an ∼4-fold prolonged duration of mitosis. RAD50 colocalized and directly interacted with Aurora B kinase and phospho-histone H3, and Aurora B kinase inhibition led to a deficiency in RAD50-positive bridges. Based on these observations, we propose that RAD50 is a crucial factor for the stabilization and shielding of chromatin bridges. Our study provides evidence for a hitherto unknown role of RAD50 in abnormal cytokinesis.
No related grants have been discovered for Martin Lavin.