ORCID Profile
0000-0003-4361-5622
Current Organisation
University of Ruhuna
Does something not look right? The information on this page has been harvested from data sources that may not be up to date. We continue to work with information providers to improve coverage and quality. To report an issue, use the Feedback Form.
Publisher: Sri Lanka Journals Online (JOL)
Date: 18-07-2015
Publisher: International Journal of Advanced and Applied Sciences
Date: 07-2023
DOI: 10.21833/IJAAS.2023.07.018
Abstract: The pollution of freshwater is a pressing global environmental concern, necessitating effective management strategies for polluted aquatic environments. Bioremediation has emerged as a highly promising environmentally friendly approach. However, the selection of suitable candidates capable of effectively degrading or removing pollutants remains a challenging task. The introduction of live candidates, particularly bacteria, into natural environments also poses its own set of difficulties. To address these challenges, immobilizing bacteria within carrier materials has emerged as a leading option. In this study, we meticulously assessed the suitability of four locally-available and low-cost agricultural and industrial waste materials as carriers to transport bacteria into water bodies. The selection criteria encompassed bacteria immobilization capacity, viability, and the resulting water quality after treatment. In order to facilitate comparison, the widely-used sodium alginate was included as a benchmark, and Escherichia coli was employed as the model bacterial inoculum. Our findings revealed that alkaline pre-treatment of corn husk, rice husk, rice straw, and sugarcane bagasse significantly enhanced the bacteria immobilization capacity of these materials. Notably, the viability of bacteria in carrier materials, including sodium alginate, exhibited remarkable resilience, with a count of 107 CFU/g material even after 49 days of storage at room temperature. Moreover, upon determining the quality parameters of the receiving water, the introduction of rice husk and sodium alginate materials demonstrated no significant adverse impact. The quality parameters were well within the acceptable range defined by the World Health Organization standards for drinking water and the Sri Lankan ambient water quality standards for various purposes. Based on the overall performance evaluation, we advocate for the application of rice husk and sodium alginate as superior carriers for delivering bacterial inocula to aquatic environments, particularly in polluted water bodies targeted for bioremediation efforts. Nonetheless, we recommend the collection of carrier materials only after the establishment of bio inoculum in the receiving water, as a precautionary measure to minimize any potential impact on the chemical oxygen demand of the water.
Publisher: Elsevier BV
Date: 2020
DOI: 10.1016/J.ECOENV.2019.109911
Abstract: Screening of plant species with an ability to grow on contaminated soil is the most critical step in the planning of a phytoremediation program. While flourishing growth of Impatiens balsamina L. and Crotalaria retusa L. has been observed in areas adjacent to automobile service stations in Sri Lanka, no systematic study of their tolerance to used lubricating oil (ULO) contaminated soil has been carried out. Therefore, the aim of the present study was to investigate the comparative responses of I. balsamina L. and C. retusa L. to soil contaminated with ULO. Both species exhibited 100% seed germination in soils treated with 1%-5% w/w ULO. After 120 h exposure, root lengths and biomass of germinated seedlings of both species were significantly (p < 0.05) reduced in all treatments above 3% w/w ULO. The measured growth parameters of plants following 90 d exposure to 0.5-3% w/w ULO, indicated significant (p 1% w/w and >2% w/w ULO, respectively. There were no significant effects on chlorophyll content or root anatomy of either species under any treatments. Therefore, we concluded that I. balsamina can tolerate up to 1% of ULO and C. retusa up to 2% w/w ULO without displaying any negative effects. Comparatively higher biodegradation of ULO in the rhizosphere, root nodule formation, increases in root length and root hair density are all possible strategies for the exhibited higher tolerance of C. retusa. Therefore, the overall results indicate that C. retusa has the greater potential to be used in phytoremediation of ULO contaminated soils. The findings of the present study will be beneficial in planning phytoremediation program for ULO contaminated soil.
Publisher: Springer Science and Business Media LLC
Date: 16-11-2020
DOI: 10.1186/S12915-020-00915-Z
Abstract: An amendment to this paper has been published and can be accessed via the original article.
Publisher: Sri Lanka Journals Online (JOL)
Date: 23-09-2020
Abstract: Research into cyanobacterial ersity dates back to more than 150 years. Advancement in modern molecular, ultrastructural, ecophysiological and in vitro culture techniques broadened our understanding in the cyanobacterial ersity. Molecular data, especially 16S rRNA gene sequence provide basic criteria for present day cyanobacterial taxonomy. As more DNA sequence data become available it came into notice that morphology-based taxonomic classification is unreliable and it could not infer evolutionary relationships. Some strains belonging to the previously assembled taxa which were classified based on traditional morphological distinctness appeared phylogenetically unrelated when their 16S rRNA gene was sequenced. Therefore, this editorial note was written with the objective of highlighting the necessity in revising present system of cyanobacterial classification and importance in establishment of universal criteria for future taxonomic proposals for cyanobacteria. A cyanobacterial phylogenetic tree was reconstructed using past and present 16S rRNA sequence assemblages from the database and from our studies. Phylogenetic tree revealed polyphyletic origin of unicellular order Chroococcales and filamentous order Oscillatoriales. Strains in the genera Pseudanabaena from the present study were phylogenetically more distant from rest of the Oscillatorialeans in the database and may have independently erged from the common ancestor at an early stage in the evolution. On the other hand, two Leptolyngbya strains from the present study clustered with Leptolyngbya accessions from the database, although two strains shared only 89% sequence identity. It appears that those two strains could be distinct species belong to the genera of Leptolyngbya and each may have independent evolutionary history. This hypothesis was supported by distinct morphological characters shown in axenic cultures. Present study highlight the importance in understanding that molecular data alone could only provide insights into genetic variability and phylogenetic relatedness, but could not recognize phenotypic variability and their ecological importance and ongoing ersification of strains etc. Thus, construction of an accurate taxonomic classification system requires a ‘polyphasic’ approach that combines molecular data with phenotypic, biochemical and ecophysiological data. Also it is necessary to revisit all past assemblages of taxa available in the database in order to avoid future taxonomic mislabelling.
Publisher: IWA Publishing
Date: 09-2022
DOI: 10.2166/WH.2022.093
Abstract: This study aimed to develop an empirical model to predict the spatial distribution of Aphanizomenon using the Ridiyagama reservoir in Sri Lanka with a dual-model strategy. In December 2020, a bloom was detected with a high density of Aphanizomenon and chlorophyll-a concentration. We generated a set of algorithms using in situ chlorophyll-a data with surface reflectance of Sentinel-2 bands on the same day using linear regression analysis. The in situ chlorophyll-a concentration was better regressed to the reflectance ratio of (1 + R665)/(1–R705) derived from B4 and B5 bands of Sentinel-2 with high reliability (R2 = 0.81, p & 0.001). The second regression model was developed to predict Aphanizomenon cell density using chlorophyll-a as the proxy and the relationship was strong and significant (R2 = 0.75, p& .001). Coupling the former regression models, an empirical model was derived to predict Aphanizomenon cell density in the same reservoir with high reliability (R2 = 0.71, p& .001). Furthermore, the predicted and observed spatial distribution of Aphanizomenon was fairly agreed. Our results highlight that the present empirical model has a high capability for an accurate prediction of Aphanizomenon cell density and their spatial distribution in freshwaters, which helps in the management of toxic algal blooms and associated health impacts.
Publisher: Scientific Societies
Date: 08-2010
Abstract: Leek (Allium porrum) has become one of the major leafy vegetable export crops in Sri Lanka during last few years. This year-round crop is cultivated in open fields at elevations between 1,000 and 2,000 m on approximately 1,600 ha with a production of 27,000 t per year (2). In August 2009, straw-colored spots (2 to 3 mm in diameter), surrounded by a greenish halo and a necrotic area, resembling symptoms to those caused by Iris yellow spot virus (IYSV) were observed on leek in Kandapola in the Nuwara Eliya District. Additional thrips damage consisting of silver-colored spots was observed on all plants. IYSV (family Bunyaviridae, genus Tospovirus) was first described and characterized in the Netherlands in 1998 (1). During the last few years, this virus was reported from Australia, Brazil, Chile, France, Germany, Guatemala, India, Israel, New Zealand, Peru, Reunion Island, Serbia, South Africa, Spain, the United States (4), and Japan. Collected s les were initially analyzed for IYSV infections using antisera raised against nucleocapsid (N) protein in a double-antibody sandwich (DAS)-ELISA. The presence of IYSV was confirmed by a reverse transcription (RT)-PCR using IYSV-F-373 (5′CTGCGGGCTTCTCTGG3′) and IYSV-R-779 (5′GACTCACCAATGTCTTCAAC3′) primers that lify a 400-bp fragment of the N gene. The entire N gene was not obtained when specific primers were used to retrieve the complete N gene. Four nucleotides of the reverse primer GAAAGATAGATATAATTAA (indicated in bold) did not match with sequence at the 3′end of the N gene. Hence, to obtain the remaining parts of the N gene, the primers UHP (5′CACTGGATCCTTTTGTTTTTGTTTTTTG3′) and Asian Termini (5′CCCGGATCCAGAGCAATCGAGGY3′) (3) were combined with IYSV-F and IYSV-R. The obtained licons were cloned into pGEM-T easy vector and sequenced. The N gene sequence has been deposited at the NCBI/GenBank (Accession No. GU901211). The deduced N protein sequence(s) were compared with other IYSV N protein sequences available in the GenBank and showed a 92% protein identity with the Brazilian strain (IYSV-BR) and 97% with the Dutch strain (IYSV-NL) with Accession Nos. AAF04199 and AAB61923, respectively. No data on the thrips vector species or on the disease incidence have been collected. The presence of IYSV in Sri Lanka can potentially be considered as a threat for the export of leek. To our knowledge, this is the first report that IYSV occurs in Sri Lanka. References: (1) I. Cortêz et al. Phytopathology 88:1276, 1998. (2) Department of Census and Statistics Sri Lanka. Retrieved from www.statistics.gov.lk , 2009. (3) A. Hassani-Mehraban et al. Phytopathology 95:852, 2005. (4) H. R. Pappu et al. Virus Res. 141:219, 2009.
Publisher: Public Library of Science (PLoS)
Date: 07-12-2018
Publisher: Springer Science and Business Media LLC
Date: 07-01-2015
DOI: 10.1007/S00705-014-2324-8
Abstract: The first complete genome sequence of capsicum chlorosis virus (CaCV) from Australia was determined using a combination of Illumina HiSeq RNA and Sanger sequencing technologies. Australian CaCV had a tripartite genome structure like other CaCV isolates. The large (L) RNA was 8913 nucleotides (nt) in length and contained a single open reading frame (ORF) of 8634 nt encoding a predicted RNA-dependent RNA polymerase (RdRp) in the viral-complementary (vc) sense. The medium (M) and small (S) RNA segments were 4846 and 3944 nt in length, respectively, each containing two non-overlapping ORFs in ambisense orientation, separated by intergenic regions (IGR). The M segment contained ORFs encoding the predicted non-structural movement protein (NSm 927 nt) and precursor of glycoproteins (GP 3366 nt) in the viral sense (v) and vc strand, respectively, separated by a 449-nt IGR. The S segment coded for the predicted nucleocapsid (N) protein (828 nt) and non-structural suppressor of silencing protein (NSs 1320 nt) in the vc and v strand, respectively. The S RNA contained an IGR of 1663 nt, being the largest IGR of all CaCV isolates sequenced so far. Comparison of the Australian CaCV genome with complete CaCV genome sequences from other geographic regions showed highest sequence identity with a Taiwanese isolate. Genome sequence comparisons and phylogeny of all available CaCV isolates provided evidence for at least two highly erged groups of CaCV isolates that may warrant re-classification of AIT-Thailand and CP-China isolates as unique tospoviruses, separate from CaCV.
Publisher: Frontiers Media SA
Date: 11-04-2017
Publisher: Wiley
Date: 2014
Publisher: Elsevier BV
Date: 10-2021
Publisher: Public Library of Science (PLoS)
Date: 11-07-2016
Publisher: Springer Science and Business Media LLC
Date: 19-10-2020
DOI: 10.1186/S12915-020-00862-9
Abstract: The western flower thrips, Frankliniella occidentalis (Pergande), is a globally invasive pest and plant virus vector on a wide array of food, fiber, and ornamental crops. The underlying genetic mechanisms of the processes governing thrips pest and vector biology, feeding behaviors, ecology, and insecticide resistance are largely unknown. To address this gap, we present the F. occidentalis draft genome assembly and official gene set. We report on the first genome sequence for any member of the insect order Thysanoptera. Benchmarking Universal Single-Copy Ortholog (BUSCO) assessments of the genome assembly (size = 415.8 Mb, scaffold N50 = 948.9 kb) revealed a relatively complete and well-annotated assembly in comparison to other insect genomes. The genome is unusually GC-rich (50%) compared to other insect genomes to date. The official gene set (OGS v1.0) contains 16,859 genes, of which ~ 10% were manually verified and corrected by our consortium. We focused on manual annotation, phylogenetic, and expression evidence analyses for gene sets centered on primary themes in the life histories and activities of plant-colonizing insects. Highlights include the following: (1) ergent clades and large expansions in genes associated with environmental sensing (chemosensory receptors) and detoxification (CYP4, CYP6, and CCE enzymes) of substances encountered in agricultural environments (2) a comprehensive set of salivary gland genes supported by enriched expression (3) apparent absence of members of the IMD innate immune defense pathway and (4) developmental- and sex-specific expression analyses of genes associated with progression from larvae to adulthood through neometaboly, a distinct form of maturation differing from either incomplete or complete metamorphosis in the Insecta. Analysis of the F. occidentalis genome offers insights into the polyphagous behavior of this insect pest that finds, colonizes, and survives on a widely erse array of plants. The genomic resources presented here enable a more complete analysis of insect evolution and biology, providing a missing taxon for contemporary insect genomics-based analyses. Our study also offers a genomic benchmark for molecular and evolutionary investigations of other Thysanoptera species.
No related grants have been discovered for Shirani Widana Gamage.