ORCID Profile
0000-0002-9510-4181
Current Organisations
Murdoch Children's Research Institute
,
Murdoch Childrens Research Institute
Does something not look right? The information on this page has been harvested from data sources that may not be up to date. We continue to work with information providers to improve coverage and quality. To report an issue, use the Feedback Form.
Research Topics
In Research Link Australia (RLA), "Research Topics" refer to ANZSRC FOR and SEO codes. These topics are either sourced from ANZSRC FOR and SEO codes listed in researchers' related grants or generated by a large language model (LLM) based on their publications.
Top 5 Research Topics
ANZSRC Field of Research (FoR)
Molecular Evolution | Genetics | Cell Development (Incl. Cell Division And Apoptosis) | Genetic Development (Incl. Sex Determination)
ANZSRC Socio-Economic Objective (SEO)
Related Links
Publications
The threat among us: significance and scale of diabetic chronic kidney disease in Australia.
Publisher: Wiley
Date: 12-2017
DOI: 10.1111/IMJ.13640
Epigenetics and depressive disorders: A review of current progress and future directions
Publisher: Oxford University Press (OUP)
Date: 24-02-2015
DOI: 10.1093/IJE/DYU273
Abstract: Several broad lines of evidence support the involvement of epigenetic processes in neurodevelopment and psychiatric disorders. Epigenetic disruption also provides a potential mechanism to account for the numerous gene-environment interactions that have been reported in association with neuropsychiatric phenotypes. A review of the literature was performed with keywords 'depression', 'depressive disorder' or 'antidepressants' and 'DNA methylation', or 'epigenetics' in humans. Citations were limited to those written in English and published prior to July 2014. We present a summary of results to date. Most studies have focused on DNA methylation in various CNS or peripheral tissue, with almost universally small s le sizes. Although seven epigenome-wide association studies have now been reported, the majority of studies have used a candidate-gene approach. Three genes (SLC6A4, BDNF, NR3C1) have been investigated in more than one study, but replication of findings is generally lacking. Recent evidence provides insights to epigenetic processes in psychiatric disorders however, replication is lacking and care must be taken in the interpretation of current findings. This applies to epigenetic epidemiology generally, which is subject to various limitations that no single approach can address in isolation. Due to limited focus of most depression studies to date, placing the findings within the broader context of mood disorder pathophysiology may prove challenging. However, identifying peripheral biomarkers for depressive disorder remains a tantalising possibility, especially given the potential for carefully-designed longitudinal studies with multiple biospecimens and ongoing advances in epigenetic technologies.
Advanced Maternal Age‐associated SIRT1 Deficiency Compromises Trophoblast Epithelial−Mesenchymal Transition through an Increase in Vimentin Acetylation
Publisher: Wiley
Date: 10-2021
DOI: 10.1111/ACEL.13491
Abstract: Advanced maternal age (AMA) pregnancies are rapidly increasing and are associated with aberrant trophoblast cell function, poor placentation, and unfavorable pregnancy outcomes, presumably due to premature placental senescence. SIRT1 is an NAD + ‐dependent deacetylase with well‐known antiaging effects, but its connection with placental senescence is unreported. In this study, human term placentas and first‐trimester villi were collected from AMA and normal pregnancies, and a mouse AMA model was established by cross breeding young and aged male and female C57 mice. SIRT1 expression and activity in HTR8/SVneo cells were genetically or pharmacologically manipulated. Trophoblast‐specific Sirt1 ‐knockout (KO) mouse placentas were generated by mating Elf5 ‐Cre and Sirt1 fl/fl mice. Trophoblast cell mobility was assessed with transwell invasion and wound‐healing assays. SIRT1‐binding proteins in HTR8/SVneo cells and human placental tissue were identified by mass spectrometry. We identified SIRT1 as the only differentially expressed sirtuin between AMA and normal placentas. It is downregulated in AMA placentas early in the placental life cycle and is barely impacted by paternal age. SIRT1 loss upregulates P53 acetylation and P21 expression and impairs trophoblast invasion and migration. Sirt1 ‐KO mouse placentas exhibit senescence markers and morphological disruption, along with decreased fetal weight. In trophoblasts, SIRT1 interacts with vimentin, regulating its acetylation. In conclusion, SIRT1 promotes trophoblast epithelial−mesenchymal transition (EMT) to enhance invasiveness by modulating vimentin acetylation. AMA placentas are associated with premature senescence during placentation due to SIRT1 loss. Therefore, SIRT1 may be an antiaging therapeutic target for improving placental development and perinatal outcomes in AMA pregnancies.
IFPA Meeting 2009 Workshops Report
Publisher: Elsevier BV
Date: 03-2010
DOI: 10.1016/J.PLACENTA.2009.12.008
Abstract: Workshops are an important part of the annual meeting of the International Federation of Placenta Associations (IFPA). At IFPA Meeting 2009 erse topics were discussed in twelve themed workshops. Topics covered included: immune response to pregnancy signaling between fetus and placenta bioactive lipids in placenta placenta in agricultural species epigenetics and placentation trophoblast deportation glucocorticoids and placental function endothelium placental transport genes and placenta uteroplacental blood flow and placental stem cells. This report is a full summary of the various topics covered.
Household size, T regulatory cell development, and early allergic disease: a birth cohort study
Publisher: Wiley
Date: 06-2022
DOI: 10.1111/PAI.13810
Abstract: Children born to larger households have less allergic disease. T regulatory cell (Treg) development may be a relevant mechanism, but this has not been studied longitudinally. We aim to (i) describe how prenatal and postnatal environmental factors are associated with Treg development and (ii) investigate whether serial Treg measures predict allergic outcomes at 1 year of age. A birth cohort ( n = 1074) with information on prenatal and postnatal early life factors. Both naïve Treg (nTreg) and activated Treg (aTreg) cell populations (as a proportion of CD4 + T cells) were available in 463 infants at birth (cord blood), 600 at 6 months, and 675 at 12 months. 191 infants had serial measures. Measures of allergic status at 12 months were polysensitization (sensitization to 2 or more allergens), clinically proven food allergy, atopic eczema, and atopic wheeze. Infants born to larger households (3 or more residents) had higher longitudinal nTreg proportions over the first postnatal year with a mean difference (MD) of 0.67 (95% CI 0.30–1.04)%. Higher nTreg proportions at birth were associated with a reduced risk of infant allergic outcomes. Childcare attendance and breastfeeding were associated with higher longitudinal nTreg proportions (MD 0.48 (95% CI 0.08–0.80)%. Multiple prenatal and postnatal microbial factors are associated with nTreg and aTreg development. Larger household size was associated with higher nTreg at birth which in turn was associated with reduced allergic sensitization and disease at 12 months of age.
Sex and puberty-related differences in metabolomic profiles associated with adiposity measures in youth with obesity
Publisher: Springer Science and Business Media LLC
Date: 05-2019
DOI: 10.1007/S11306-019-1537-Y
Abstract: Specific patterns of metabolomic profiles relating to cardiometabolic disease are associated with increased weight in adults. In youth with obesity, metabolomic data are sparse and associations with adiposity measures unknown. Primary, to determine associations between adiposity measures and metabolomic profiles with increased cardiometabolic risks in youth with obesity. Secondary, to stratify associations by sex and puberty. Participants were from COBRA (Childhood Overweight BioRepository of Australia a paediatric cohort with obesity). Adiposity measures (BMI, BMI z-score, %truncal and %whole body fat, waist circumference and waist/height ratio), puberty staging and NMR metabolomic profiles from serum were assessed. Statistics included multivariate analysis (principal component analysis, PCA) and multiple linear regression models with false discovery rate adjustment. 214 participants had metabolomic profiles analyzed, mean age 11.9 years (SD ± 3.1), mean BMI z-score 2.49 (SD ± 0.24), 53% females. Unsupervised PCA identified no separable clusters of in iduals. Positive associations included BMI z-score and phenylalanine, total body fat % and lipids in medium HDL, and waist circumference and tyrosine negative associations included total body fat % and the ratio of docosahexaenoic acid/total fatty acids and histidine. Stratifying by sex and puberty, patterns of associations with BMI z-score in post-pubertal males included positive associations with lipid-, cholesterol- and triglyceride-content in VLDL lipoproteins total fatty acids total triglycerides isoleucine, leucine and glycoprotein acetyls. In a paediatric cohort with obesity, increased adiposity measures, especially in post-pubertal males, were associated with distinct patterns in metabolomic profiles.
Roadmap for investigating epigenome deregulation and environmental origins of cancer
Publisher: Wiley
Date: 13-09-2017
DOI: 10.1002/IJC.31014
Effects of the in utero environment on the epigenome
Publisher: Future Medicine Ltd
Date: 03-2017
Epigenetic regulation of human placental function and pregnancy outcome: Considerations for causal inference
Publisher: Elsevier BV
Date: 10-2015
Cannabis use by women during pregnancy does not influence infant DNA methylation of the dopamine receptor DRD4
Publisher: Informa UK Limited
Date: 27-04-2017
Exposure to adversity and inflammatory outcomes in mid and late childhood
Publisher: Elsevier BV
Date: 12-2020
Correction: Adolescence and the next generation (Nature (2018) DOI: 10.1038/nature25759)
Publisher: Springer Science and Business Media LLC
Date: 02-05-2018
DOI: 10.1038/S41586-018-0069-3
Abstract: In Fig. 4a of this Analysis, owing to an error during the production process, the year in the header of the right column was '2016' rather than '2010'. In addition, in the HTML version of the Analysis, Table 1 was formatted incorrectly. These errors have been corrected online.
Innate cell profiles during the acute and convalescent phase of SARS-CoV-2 infection in children.
Publisher: Springer Science and Business Media LLC
Date: 17-02-2021
DOI: 10.1038/S41467-021-21414-X
Abstract: Children have mild severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) confirmed disease (COVID-19) compared to adults and the immunological mechanisms underlying this difference remain unclear. Here, we report acute and convalescent innate immune responses in 48 children and 70 adults infected with, or exposed to, SARS-CoV-2. We find clinically mild SARS-CoV-2 infection in children is characterised by reduced circulating subsets of monocytes (classical, intermediate, non-classical), dendritic cells and natural killer cells during the acute phase. In contrast, SARS-CoV-2-infected adults show reduced proportions of non-classical monocytes only. We also observe increased proportions of CD63+ activated neutrophils during the acute phase to SARS-CoV-2 in infected children. Children and adults exposed to SARS-CoV-2 but negative on PCR testing display increased proportions of low-density neutrophils that we observe up to 7 weeks post exposure. This study characterises the innate immune response during SARS-CoV-2 infection and household exposure in children.
Fat-Soluble Vitamers: Parent-Child Concordance and Population Epidemiology in the Longitudinal Study of Australian Children
Publisher: MDPI AG
Date: 24-11-2022
DOI: 10.3390/NU14234990
Abstract: Fat-soluble vitamers (FSV) are a class of erse organic substances important in a wide range of biological processes, including immune function, vision, bone health, and coagulation. Profiling FSV in parents and children enables insights into gene-environment contributions to their circulating levels, but no studies have reported on the population epidemiology of FSV in these groups as of yet. In this study, we report distributions of FSV, their parent-child concordance and variation by key characteristics for 2490 children (aged 11–12 years) and adults (aged 28–71 years) in the Child Health CheckPoint of the Longitudinal Study of Australian Children. Ten A, D, E and K vitamers were quantified using a novel automated LC-MS/MS method. All three K vitamers (i.e., K1, MK-4, MK-7) and 1-α-25(OH)2D3 were below the instrument detection limit and were removed from the present analysis. We observed a strong vitamer-specific parent-child concordance for the six quantifiable A, D and E FSVs. FSV concentrations all varied by age, BMI, and sex. We provide the first cross-sectional population values for multiple FSV. Future studies could examine relative genetic vs. environmental determinants of FSV, how FSV values change longitudinally, and how they contribute to future health and disease.
Strategies for engineering human chromosomes with therapeutic potential
Publisher: Wiley
Date: 2002
DOI: 10.1002/JGM.236
Abstract: Human engineered chromosomes (HECs) have several potential advantages over currently used vectors for gene therapy applications. Firstly, there is no upper size limit to DNA that can be cloned in these vectors. Secondly, their extrachromosomal nature ensures that introduced genes are neither disruptive to, nor affected by, the genome of the host cell. Finally, being solely human in origin, HEC vectors should not evoke adverse host immunogenic responses. Recent advances have produced a variety of HECs via several different approaches. This review focuses on the current methodologies for making HEC vectors, the advantages and problems associated with each strategy, and discusses the outlook for HEC vectors as ex vivo therapeutic agents.
Associations Between Telomere Length and Hearing Status in Mid-Childhood and Midlife: Population-Based Cross-Sectional study
Publisher: Ovid Technologies (Wolters Kluwer Health)
Date: 2019
Perinatal outcomes and offspring growth profiles in twin pregnancies complicated by gestational diabetes mellitus: A longitudinal cohort study
Publisher: Elsevier BV
Date: 2021
DNA methylation landscape of ocular tissue relative to matched peripheral blood
Publisher: Springer Science and Business Media LLC
Date: 13-04-2017
DOI: 10.1038/SREP46330
Abstract: Epigenetic variation is implicated in a range of non-communicable diseases, including those of the eye. However, investigating the role of epigenetic variation in central tissues, such as eye or brain, remains problematic and peripheral tissues are often used as surrogates. In this study, matched human blood and eye tissue (n = 8) were obtained post-mortem and DNA methylation profiling performed on blood, neurosensory retina, retinal pigment epithelium (RPE)/choroid and optic nerve tissue using the Illumina Infinium HumanMethylation450 platform. Unsupervised clustering and principal components analysis revealed tissue of origin as the main driver of methylation variation. Despite this, there was a strong correlation of methylation profiles between tissues with ,000 CpG sites found to have similar methylation levels. An additional ~16,000 show similarity across ocular tissues only. A small proportion of probes showing inter-in idual variation in blood co-varied with eye tissues within in iduals, however much of this variation may be genetically driven. An improved understanding of the epigenetic landscape of the eye will have important implications for understanding eye disease. Despite a generally high correlation irrespective of origin, tissue type is the major driver of methylation variation, with only limited covariation between blood and any specific ocular tissue.
What’s in a name? Context-dependent significance of ‘global’ methylation measures in human health and disease
Publisher: Springer Science and Business Media LLC
Date: 13-01-2017
Cognitive Behavioral Therapy for Antenatal Depression in a Pilot Randomized Controlled Trial and Effects on Neurobiological, Behavioral and Cognitive Outcomes in Offspring 3–7 Years Postpartum: A Pers
Publisher: Frontiers Media SA
Date: 13-02-2020
DNA methylation mediated up-regulation ofTERRAnon-coding RNA is coincident with elongated telomeres in the human placenta
Publisher: Oxford University Press (OUP)
Date: 07-09-2016
Abstract: What factors regulate elongated telomere length in the human placenta? Hypomethylation of TERRA promoters in the human placenta is associated with high TERRA expression, however, no clear mechanistic link between these phenomena and elongated telomere length in the human placenta was found. Human placenta tissue and trophoblasts show longer telomere lengths compared to gestational age-matched somatic cells. However, telomerase (hTERT) expression and activity in the placenta is low, suggesting a role for an alternative lengthening of telomeres (ALT). While ALT is observed in 10-15% of human cancers and in some mouse stem cells, ALT has never been reported in non-cancerous human tissues. Human term placental tissue and matched cord blood mononuclear cells (CBMCs) were collected as part of the Peri/Postnatal Epigenetic Twins study (PETS). In addition, first trimester placental villi, purified cytotrophoblasts, choriocarcinoma cell lines and a panel of ALT-positive cancer cell lines were tested. Telomere length was determined using the Terminal Restriction Fragment (TRF) assay and a relative quantitative PCR method. DNA methylation levels at several CpG rich subtelomeric TERRA promoters were determined using bisulfite conversion and the SEQUENOM EpiTYPER platform. Expression of TERRA and hTERT was determined using quantitative RT-PCR. ALT was assessed using the C-circle assay (CCA). The human placenta tissue and purified first trimester trophoblasts showed low subtelomeric (TERRA) DNA methylation compared to matched CBMCs and other somatic cells. Interestingly placental TERRA methylation was lower than ALT-cancer cell lines, previously reported to be hypomethylated at these loci. Low TERRA methylation was associated with higher expression of TERRA RNA in placenta compared to matched CBMCs. Detectable levels of C-circles were observed in first trimester placental villi, but not term placenta, suggesting that the ALT mechanism may be active in specific placental cells in early gestation. C-circle analysis of purified first trimester trophoblasts and ALT-associated PML bodies (APB) staining of first trimester villi cross-sections failed to identify this specific cell type population. While first trimester villi showed detectable levels of C-circles, these levels were very low compared with those observed in ALT-positive tumours and cell lines. This is consistent with a small sub-population of ALT-positive cells but this requires further investigation. Finally, no mechanistic link was established between TERRA DNA methylation, the presence of C-circles and longer telomere length. Given the previously described role of TERRA ncRNA as a negative regulator of telomerase, the finding of elevated TERRA and long telomeres is counterintutive. ALT as a mechanism for telomere length maintenance has only been reported in certain human cancers, and recently in mouse embryonic stem cells and embryos. As with many aspects of cancer, it appears that ALT activity in tumours may be the inappropriate activation of a pathway found in very specific cell types in human development. Our data are the first supportive evidence for ALT in a non-cancerous human tissue, a result that requires further investigation and replication. The level of TERRA methylation in the human placenta is significantly lower than found in ALT cancer cell lines and somatic cells, raising the possibility of a novel mechanism in maintaining low methylation at subtelomeric regions. Not applicable. This study was supported by NHMRC early career fellowship (B.N.), NHMRC Senior Research Fellowship (R.S.) and the Victoria Government Infrastructure Grant. R.R. holds a patent for the C-circle assay. No other conflicts declared.
Epigenetic modifications in trinucleotide repeat diseases
Publisher: Elsevier BV
Date: 11-2013
DOI: 10.1016/J.MOLMED.2013.07.007
Abstract: Accumulating evidence supports the important role for epigenetic changes in modulating clinical parameters of complex disorders, including neurodegenerative disease. Several conditions, including fragile X syndrome and Huntington's disease are caused by trinucleotide repeat (TNR) expansions in or near specific genes. Highlighting the link between epigenetic disruption and disease phenotype, recent studies have established significant correlations between clinical features, expansion size, gene expression, the chromatin profile, and DNA methylation in regions surrounding the TNR. Given the debilitating and sometimes fatal consequences of TNR disorders, understanding how an altered epigenetic profile impacts clinical outcome warrants further attention, and could provide key insights for developing novel epigenetic therapies and biomarkers. This review presents the current evidence of epigenetic changes in several TNR diseases.
The end of the beginning: epigenetic variation in utero as a mediator of later human health and disease.
Publisher: Future Medicine Ltd
Date: 03-2017
DNA methylation-mediated down-regulation of DNA methyltransferase-1 (DNMT1) is coincident with, but not essential for, global hypomethylation in human placenta
Publisher: Elsevier BV
Date: 03-2010
Complex patterns of circulating fatty acid levels in gestational diabetes mellitus subclasses across pregnancy
Publisher: Elsevier BV
Date: 06-2021
DOI: 10.1016/J.CLNU.2021.01.046
Abstract: To investigate the relationship between maternal serum fatty acid levels and gestational diabetes mellitus (GDM) subtypes across pregnancy. A total of 680 singleton mothers enrolled in the Complex Lipids in Mothers and Babies (CLIMB) study in Chongqing, China were included. Clinical information and serum s les were collected at gestational weeks (GWs) 11-14, 22-28, and 32-34. 75 g Oral Glucose Tolerance Test (OGTT) was conducted at GW 24-28 and GDM subtypes ided into three groups using International Association of Diabetes and Pregnancy Study Group (IADPSG) guidelines criteria: elevated fasting plasma glucose (FPG group n = 59) 1-h and/or 2-h post-load glucose (1h/2h-PG group n = 94) combined group (FPG h/2h-PG group n = 42). Non-GDM pregnancies were included (n = 485) as controls. Twenty fatty acids were quantified in serum using gas chromatography-mass spectrometry (GC-MS) analysis. Overall, most serum fatty acid concentrations increased rapidly from the first to second trimester, followed by a plateauing or reduction in the third trimester (p < 0.001). In cross sectional analysis, fatty acid concentrations were significantly higher in the FPG group at GW 11-14 and decreased in the 1h/2h-PG group at GW 32-34, relative to controls. Moreover, higher α-linolenic acid (ALA the second tertile: adjusted odds ratio [aOR] = 2.53, 95% CI: 1.17 to 5.47 the third tertile: aOR = 2.60, 95% CI: 1.20 to 5.65) and docosahexaenoic acid (DHA the second tertile: aOR = 2.34, 95% CI: 1.10 to 4.97 the third tertile: aOR = 2.16, 95% CI: 1.00 to 4.63) were significantly associated with a higher risk of GDM in women with elevated fasting plasma glucose at GW 11-14 (first tertile as reference). Our findings highlight the importance of considering GDM subtypes for the in idualised management of GDM in pregnancy. ALA and DHA in early pregnancy are associated with a higher risk of FPG-GDM subtype. This has widespread implications when recommending n-3 PUFAs supplementation for women with GDM.
Objectively measured sleep and telomere length in a population-based cohort of children and midlife adults
Publisher: Oxford University Press (OUP)
Date: 16-11-2020
DOI: 10.1093/SLEEP/ZSZ200
Abstract: Poor sleep patterns in older adults are associated with chromosomal telomere shortening, a marker of cellular senescence. However, studies have relied on self-reported sleep characteristics, with few data for younger in iduals. We investigated whether sleep measured via actigraphy was cross-sectionally associated with telomere length in children and midlife adults. A population-based s le of 1874 11–12 year olds and midlife adults (mean age 44 years, SD 5.1) had biological and physical assessments at centers across Australia in 2015–2016. Sleep characteristics, including duration, onset, offset, day-to-day variability, and efficiency, were derived from actigraphy. Relative telomere length (T/S ratio) was measured by quantitative polymerase chain reaction on genomic DNA from peripheral blood. Multivariable regression models estimated associations, adjusting for prespecified confounders. Both sleep and telomere data were available for 728 children and 1070 adults. Mean (SD) T/S ratio was 1.09 (0.55) in children and 0.81 (0.38) in adults. T/S ratio was not predicted by sleep duration (β 0.04, 95% confidence interval [CI] −0.02 to 0.09, p = .16, children β −0.004, 95% CI −0.03 to 0.02, p = .70, adults) or most other sleep metrics. The only exception was a weak association between later sleep timing (the midpoint of sleep onset and offset) and longer telomeres in adults (β 0.03, 95% CI 0.01 to 0.06, p = .01). Objective sleep characteristics show no convincing associations with telomere length in two largely healthy populations up to at least midlife. Sleep–telomere associations may be a late-life occurrence or may present only with a trigger such as presence of other morbidities.
Evaluation of MicroRNA Expression in Patient Bone Marrow Aspirate Slides
Publisher: Public Library of Science (PLoS)
Date: 13-08-2012
Protocol for a longitudinal twin birth cohort study to unravel the complex interplay between early-life environmental and genetic risk factors in health and disease: the Chongqing Longitudinal Twin St
Publisher: BMJ
Date: 02-2018
DOI: 10.1136/BMJOPEN-2017-017889
Abstract: Non-communicable diseases (NCD) now represent the major burden of adverse health in most countries. It is clear that much of the risk of such conditions begins very early in life, potentially in utero. Given their complex aetiology, an understanding of the origins of NCD requires an in-depth analysis of the interplay between genetic variation and environment, preferably over time. For decades, twin studies have played a key role in understanding such traits. Their strength lies in the ability to disentangle genetic and environmental factors that contribute to a phenotype. This is done by comparing genetically identical monozygotic (MZ) with dizygotic twins, who share on average 50% of genetic variation, or by comparing MZ twins within a pair. This study aims to determine the relative contributions of genes and environment to early-onset intermediate phenotypes related to later adult onset disease (such as growth and neurodevelopment) and to identify specific biomarkers and time points for emergence of phenotypes from infancy, largely independent of underlying genetic factors. The Chongqing Longitudinal Twin Study ( LoTiS ) will recruit 300 women pregnant with twins, enriched for MZ pregnancies, with follow-up to 3 years of age. Data collection will be undertaken at key time points in gestation (×3), at delivery and postnatally (×9). Maternal and infant biospecimens including blood, urine, hair, nails and buccal swabs along with measures such as fetal scans and body measurements will be collected. Additional information from questionnaires and medical records includes pregnancy, diet, sociodemographics, maternal stress, and infant growth and neurodevelopment. This study has been approved by the Ethics Committee of Chongqing Medical University (record no: 201530) and has been registered with the Chinese Clinical Trial Registry (registry no: ChiCTR-OOC-16008203). Results of the recruitment and all subsequent analyses will be submitted for publication in peer-reviewed journals. ChiCTR-OOC-16008203 Results.
Cord blood immune profile: Associations with higher prenatal plastic chemical levels
Publisher: Elsevier BV
Date: 12-2022
DOI: 10.1016/J.ENVPOL.2022.120332
Abstract: Prenatal exposure to plastic chemicals has been associated with alterations to early-life immune function in children. However, previous studies have generally been small and focused on limited repertoires of immune indices. In a large population-based pre-birth cohort (n = 1074), third-trimester measurements of eight phthalate metabolites and three analogues of bisphenols were used to estimate prenatal exposure to phthalate and bisphenol compounds. In cord blood, immune cell populations were measured by flow cytometry and an extensive panel of cytokines and chemokines were measured by multiplex immunoassay. We used these cord blood analytes to estimate "early life" immune profiles. The full study s le comprises data from 774 infants with prenatal plastic metabolite measurements and any cord blood immune data. Multiple linear regression analysis was used to evaluate whether prenatal phthalate and bisphenol exposure was prospectively associated with cord blood immune cell populations and cytokine and chemokine levels. Generally, inverse associations were observed between prenatal phthalate exposure and cord blood immune indices. Higher exposure to di-n-butyl phthalate was associated with lower cord blood levels of platelet-derived growth factor (PDGF) and interferon gamma-induced protein 10 (IP-10) higher exposure to the sum of dibutyl phthalates was associated with lower cord blood levels of IP-10 and higher exposure to benzyl butyl phthalate was associated with lower cord blood levels of interleukin 1 beta (IL-1β). There was less evidence of associations between bisphenols and cord blood immune indices. These results extend previous work examining prenatal plastic chemical exposure and early-life immune development and highlight the importance of further examination of potential associations with health-related outcomes.
Chromosome size and origin as determinants of the level of CENP-A incorporation into human centromeres
Publisher: Springer Science and Business Media LLC
Date: 12-2004
DOI: 10.1007/S10577-005-5377-4
Abstract: We have expressed an EGFP-CENP-A fusion protein in human cells in order to quantitate the level of CENP-A incorporated into normal and variant human centromeres. The results revealed a 3.2-fold difference in the level of CENP-A incorporation into alpha-satellite repeat DNA-based centromeres, with the Y centromere showing the lowest level of all normal human chromosomes. Identification of in idual chromosomes revealed a statistically significant, though not absolute, correlation between chromosome size and CENP-A incorporation. Analysis of three independent neocentromeres revealed a significantly reduced level of CENP-A compared to normal centromeres. Truncation of a neocentric marker chromosome to produce a minichromosome further reduced CENP-A levels, indicating a remodelling of centromeric chromatin. These results suggest a role for increased CENP-A incorporation in the faithful segregation of larger chromosomes and support a model of centromere evolution in which neocentromeres represent ancestral centromeres that, through adaptive evolution, acquire satellite repeats to facilitate the incorporation of higher numbers of CENP-A containing nucleosomes, thereby facilitating the assembly of larger kinetochore structures.
Association of in vitro fertilization with global and IGF2/H19 methylation variation in newborn twins
Publisher: Cambridge University Press (CUP)
Date: 04-2015
DOI: 10.1017/S2040174415000161
Abstract: In vitro fertilization (IVF) and its subset intracytoplasmic sperm injection (ICSI), are widely used medical treatments for conception. There has been controversy over whether IVF is associated with adverse short- and long-term health outcomes of offspring. As with other prenatal factors, epigenetic change is thought to be a molecular mediator of any in utero programming effects. Most studies focused on DNA methylation at gene-specific and genomic level, with only a few on associations between DNA methylation and IVF. Using buccal epithelium from 208 twin pairs from the Peri/Postnatal Epigenetic Twin Study (PETS), we investigated associations between IVF and DNA methylation on a global level, using the proxies of Alu and LINE-1 interspersed repeats in addition to two locus-specific regulatory regions within IGF2 / H19 , controlling for 13 potentially confounding factors. Using multiple correction testing, we found strong evidence that IVF-conceived twins have lower DNA methylation in Alu, and weak evidence of lower methylation in one of the two IGF2 / H19 regulatory regions and LINE-1, compared with naturally conceived twins. Weak evidence of a relationship between ICSI and DNA methylation within IGF2 / H19 regulatory region was found, suggesting that one or more of the processes associated with IVF/ICSI may contribute to these methylation differences. Lower within- and between-pair DNA methylation variation was also found in IVF-conceived twins for LINE-1, Alu and one IGF2 / H19 regulatory region. Although larger s le sizes are needed, our results provide additional insight to the possible influence of IVF and ICSI on DNA methylation. To our knowledge, this is the largest study to date investigating the association of IVF and DNA methylation.
Functionally distinct roles for different miR-155 expression levels through contrasting effects on gene expression, in acute myeloid leukaemia.
Publisher: Springer Science and Business Media LLC
Date: 14-10-2017
DOI: 10.1038/LEU.2016.279
Abstract: Enforced expression of microRNA-155 (miR-155) in myeloid cells has been shown to have both oncogenic or tumour-suppressor functions in acute myeloid leukaemia (AML). We sought to resolve these contrasting effects of miR-155 overexpression using murine models of AML and human paediatric AML data sets. We show that the highest miR-155 expression levels inhibited proliferation in murine AML models. Over time, enforced miR-155 expression in AML in vitro and in vivo, however, favours selection of intermediate miR-155 expression levels that results in increased tumour burden in mice, without accelerating the onset of disease. Strikingly, we show that intermediate and high miR-155 expression also regulate very different subsets of miR-155 targets and have contrasting downstream effects on the transcriptional environments of AML cells, including genes involved in haematopoiesis and leukaemia. Furthermore, we show that elevated miR-155 expression detected in paediatric AML correlates with intermediate and not high miR-155 expression identified in our experimental models. These findings collectively describe a novel dose-dependent role for miR-155 in the regulation of AML, which may have important therapeutic implications.
A room-temperature X-ray diffuse scattering study of form (II) of the trimorphic molecular system p-(N-methylbenzylidene)-p-methylaniline
Publisher: International Union of Crystallography (IUCr)
Date: 15-09-2008
DOI: 10.1107/S0108768108023264
Abstract: Three-dimensional X-ray diffuse scattering data have been collected at room temperature for form (II) of the trimorphic molecular system p -( N -methylbenzylidene)- p -methylaniline. Although this polymorph has been reported to have a perfectly normal ordered average structure, strong and highly structured diffuse scattering was observed, indicating that substantial thermal disorder is present. A diffuse scattering analysis has been carried out using Monte Carlo simulation techniques. Narrow streaks of intensity extending between Bragg peaks in the h0l section were found to arise from planes of diffuse scattering in three dimensions. These are caused by highly correlated molecular displacements along chains of end-to-end disposed molecules running in the a\\!-\\!c direction, corresponding to methyl–methyl intermolecular interactions. A second significant feature – rods of diffuse scattering running in the b^* direction – indicates that molecular layers normal to b have a tendency to undergo lateral displacements with little correlation between layers. Finally, the internal flexibility of the molecule is required for a best fit. Changes in the two dihedral angles are found to be strongly correlated and show large excursions (\\gt\\pm20^{\\circ}) from the average values. All of these features suggest possible mechanisms for the way in which form (II) might transform to other polymorphs.
The role of epigenetic dysregulation in the epidemic of allergic disease
Publisher: Springer Science and Business Media LLC
Date: 13-04-2011
Hypomethylation of the IL17RC Promoter in Peripheral Blood Leukocytes Is Not A Hallmark of Age-Related Macular Degeneration
Publisher: Elsevier BV
Date: 12-2013
Genetic and environmental causes of variation in epigenetic aging across the lifespan.
Publisher: Springer Science and Business Media LLC
Date: 22-10-2020
DOI: 10.1186/S13148-020-00950-1
Abstract: DNA methylation-based biological age (DNAm age) is an important biomarker for adult health. Studies in specific age ranges have found widely varying results about its genetic and environmental causes of variation. However, these studies are not able to provide a comprehensive view of the causes of variation over the lifespan. In order to investigate the genetic and environmental causes of DNAm age variation across the lifespan, we pooled genome-wide DNA methylation data for 4217 people aged 0–92 years from 1871 families. DNAm age was calculated using the Horvath epigenetic clock. We estimated familial correlations in DNAm age for monozygotic (MZ) twin, dizygotic (DZ) twin, sibling, parent–offspring, and spouse pairs by cohabitation status. Genetic and environmental variance components models were fitted and compared. We found that twin pair correlations were − 0.12 to 0.18 around birth, not different from zero (all P 0.29). For all pairs of relatives, their correlations increased with time spent living together (all P 0.02) at different rates (MZ DZ and siblings parent–offspring P 0.001) and decreased with time spent living apart ( P = 0.02) at similar rates. These correlation patterns were best explained by cohabitation-dependent shared environmental factors, the effects of which were 1.41 (95% confidence interval [CI] 1.16 to 1.66) times greater for MZ pairs than for DZ and sibling pairs, and the latter were 2.03 (95% CI 1.13 to 9.47) times greater than for parent–offspring pairs. Genetic factors explained 13% (95% CI − 10 to 35%) of variation ( P = 0.27). Similar results were found for another two epigenetic clocks, suggesting that our observations are robust to how DNAm age is measured. In addition, results for the other clocks were consistent with there also being a role for prenatal environmental factors in determining their variation. Variation in DNAm age is mostly caused by environmental factors, including those shared to different extents by relatives while living together and whose effects persist into old age. The equal environment assumption of the classic twin study might not hold for epigenetic aging.
Early life infection and proinflammatory, atherogenic metabolomic and lipidomic profiles at 12 months of age: a population-based cohort study
Publisher: Cold Spring Harbor Laboratory
Date: 02-12-2021
DOI: 10.1101/2021.12.02.21267173
Abstract: The risk of adult onset cardiovascular and metabolic (cardiometabolic) disease accrues from early life. Infection is ubiquitous in infancy and induces inflammation, a key cardiometabolic risk factor, but the relationship between infection, inflammation, and metabolic profiles in early childhood remains unexplored. We investigated relationships between infection and plasma metabolomic and lipidomic profiles at age 12 months, and mediation of these associations by inflammation. Matched infection, metabolomics and lipidomics data were generated from 555 infants in a pre-birth longitudinal cohort. Infection data from birth to 12 months were parent-reported (total infections at age 1, 3, 6, 9, and 12 months), inflammation markers (high-sensitivity C-reactive protein, hsCRP) glycoprotein acetyls GlycA) were quantified at 12 months. Metabolic profiles were 12-month plasma nuclear magnetic resonance metabolomics (228 metabolites) and liquid-chromatography/mass-spectrometry lipidomics (776 lipids). Associations were evaluated with multivariable linear regression models. Frequent infant infections were associated with adverse metabolomic (elevated inflammation markers, triglycerides, phenylalanine, and lower HDL cholesterol, apolipoprotein A1, and omega-3 fatty acids) and lipidomic profiles (elevated phosphatidylethanolamines and lower hexosylceramides, trihexosylceramides, and cholesteryl esters). Similar, more marked, profiles were observed with higher GlycA, but not hsCRP. GlycA, but not hsCRP, mediated a substantial proportion of the relationship between infection and metabolome/lipidome. Infants with a greater infection burden from birth to 12 months had pro-inflammatory and pro-atherogenic plasma metabolomic/lipid profiles, indicative of heightened risk of cardiovascular disease, obesity, and type 2 diabetes in adults. These findings suggest potentially modifiable pathways linking early life infection and inflammation with subsequent cardiometabolic risk. The establishment work and infrastructure for the BIS was provided by the Murdoch Children’s Research Institute (MCRI), Deakin University and Barwon Health. Subsequent funding was secured from National Health and Medical Research Council of Australia (NHMRC), The Shepherd Foundation, The Jack Brockhoff Foundation, the Scobie & Claire McKinnon Trust, the Shane O’Brien Memorial Asthma Foundation, the Our Women’s Our Children’s Fund Raising Committee Barwon Health, the Rotary Club of Geelong, the Minderoo Foundation, the Ilhan Food Allergy Foundation, GMHBA, Vanguard Investments Australia Ltd, and the Percy Baxter Charitable Trust, Perpetual Trustees. In-kind support was provided by the Cotton on Foundation and CreativeForce. The study sponsors were not involved in the collection, analysis, and interpretation of data writing of the report or the decision to submit the report for publication. Research at MCRI is supported by the Victorian Government’s Operational Infrastructure Support Program. This work was also supported by NHMRC Senior Research Fellowships (1008396 to ALP 1064629 to DB 1045161 to RS), NHMRC Investigator Grants to ALP (1110200) and DB (1175744), NHMRC-A*STAR project grant (1149047). TM is supported by an MCRI ECR Fellowship. SB is supported by the Dutch Research Council (452173113).
The association of PTPN22 rs2476601 with juvenile idiopathic arthritis is specific to females
Publisher: Springer Science and Business Media LLC
Date: 20-08-2015
DOI: 10.1038/GENE.2015.32
Abstract: A preponderance of females develop autoimmune disease, including juvenile idiopathic arthritis (JIA), yet the reason for this bias remains elusive. Evidence suggests that genetic risk of disease may be influenced by sex. PTPN22 rs2476601 is associated with JIA and numerous other autoimmune diseases, and has been reported to show female-specific association with type 1 diabetes. We performed main effect and sex-stratified association analyses to determine whether a sex-specific association exists in JIA. As expected, rs2476601 was associated with JIA in our discovery (413 cases and 690 controls) and replication (1008 cases and 9284 controls) s les. Discovery s le sex-stratified analyses demonstrated an association specifically in females (odds ratio (OR)=2.35, 95% confidence interval (CI)=1.52-3.63, P=0.00011) but not males (OR=0.91, 95% CI=0.52-1.60, P=0.75). This was similarly observed in the replication s le. There was evidence for genotype-by-sex interaction (Pinteraction=0.009). The association between rs2476601 and JIA appears restricted to females, partly accounting for the predominance of females with this disease.
BDNF promoter methylation and genetic variation in late-life depression
Publisher: Springer Science and Business Media LLC
Date: 18-08-2015
DOI: 10.1038/TP.2015.114
Abstract: The regulation of the brain-derived neurotrophic factor (BDNF) is important for depression pathophysiology and epigenetic regulation of the BDNF gene may be involved. This study investigated whether BDNF methylation is a marker of depression. One thousand and twenty-four participants were recruited as part of a longitudinal study of psychiatric disorders in general population elderly (age⩾65). Clinical levels of depression were assessed using the Mini International Neuropsychiatric Interview for the diagnosis of major depressive disorder according to the Diagnostic and Statistical Manual of Mental Disorder IV criteria, and the Centre for Epidemiologic Studies Depression Scale (CES-D) for assessment of moderate to severe depressive symptoms. Buccal DNA methylation at the two most widely studied BDNF promoters, I and IV, was investigated using the Sequenom MassARRAY platform that allows high-throughput investigation of methylation at in idual CpG sites within defined genomic regions. In multivariate linear regression analyses adjusted for a range of participant characteristics including antidepressant use, depression at baseline, as well as chronic late-life depression over the 12-year follow-up, were associated with overall higher BDNF methylation levels, with two sites showing significant associations (promoter I, Δ mean=0.4%, P =0.0002 promoter IV, Δ mean=5.4%, P =0.021). Three single-nucleotide polymorphisms ( rs6265 , rs7103411 and rs908867 ) were also found to modify the association between depression and promoter I methylation. As one of the largest epigenetic studies of depression, and the first investigating BDNF methylation in buccal tissue, our findings highlight the potential for buccal BDNF methylation to be a biomarker of depression.
Integrating trials into a whole-population cohort of children and parents: statement of intent (trials) for the Generation Victoria (GenV) cohort
Publisher: Springer Science and Business Media LLC
Date: 24-09-2020
DOI: 10.1186/S12874-020-01111-X
Abstract: Very large cohorts that span an entire population raise new prospects for the conduct of multiple trials that speed up advances in prevention or treatment while reducing participant, financial and regulatory burden. However, a review of literature reveals no blueprint to guide this systematically in practice. This Statement of Intent proposes how erse trials may be integrated within or alongside Generation Victoria (GenV), a whole-of-state Australian birth cohort in planning, and delineates potential processes and opportunities. Parents of all newborns (estimated 160,000) in the state of Victoria, Australia, will be approached for two full years from 2021. The cohort design comprises four elements: (1) consent soon after birth to follow the child and parent/s until study end or withdrawal retrospective and prospective (2) linkage to clinical and administrative datasets and (3) banking of universal and clinical bios les and (4) GenV-collected bios les and data. GenV-collected data will focus on overarching outcome and phenotypic measures using low-burden, universal-capable electronic interfaces, with funding-dependent face-to-face assessments tailored to universal settings during the early childhood, school and/or adult years. For population or registry-type trials within GenV, GenV will provide all outcomes data and consent via traditional, waiver, or Trials Within Cohorts models. Trials alongside GenV consent their own participants born within the GenV window GenV may help identify potential participants via opt-in or opt-out expression of interest. Data sharing enriches trials with outcomes, prior data, and/or access to linked data contingent on custodian’s agreements, and supports modeling of causal effects to the population and between-trials comparisons of costs, benefits and utility. Data access will operate under the Findability, Accessibility, Interoperability, and Reusability (FAIR) and Care and Five Safes Principles. We consider governance, ethical and shared trial oversight, and expectations that trials will adhere to the best practice of the day. Children and younger adults can access fewer trials than older adults. Integrating trials into mega-cohorts should improve health and well-being by generating faster, larger-scale evidence on a longer and/or broader horizon than previously possible. GenV will explore the limits and details of this approach over the coming years.
Virology and immune dynamics reveal high household transmission of ancestral SARS-CoV-2 strain
Publisher: Wiley
Date: 07-2022
DOI: 10.1111/PAI.13824
Abstract: Household studies are crucial for understanding the transmission of SARS‐CoV‐2 infection, which may be underestimated from PCR testing of respiratory s les alone. We aim to combine the assessment of household mitigation measures nasopharyngeal, saliva, and stool PCR testing along with mucosal and systemic SARS‐CoV‐2–specific antibodies, to comprehensively characterize SARS‐CoV‐2 infection and transmission in households. Between March and September 2020, we obtained s les from 92 participants in 26 households in Melbourne, Australia, in a 4‐week period following the onset of infection with ancestral SARS‐CoV‐2 variants. The secondary attack rate was 36% (24/66) when using nasopharyngeal swab (NPS) PCR positivity alone. However, when respiratory and nonrespiratory s les were combined with antibody responses in blood and saliva, the secondary attack rate was 76% (50/66). SARS‐CoV‐2 viral load of the index case and household isolation measures were key factors that determine secondary transmission. In 27% (7/26) of households, all family members tested positive by NPS for SARS‐CoV‐2 and were characterized by lower respiratory Ct values than low transmission families (Median 22.62 vs. 32.91 IQR 17.06–28.67 vs. 30.37–34.24). High transmission families were associated with enhanced plasma antibody responses to multiple SARS‐CoV‐2 antigens and the presence of neutralizing antibodies. Three distinguishing saliva SARS‐CoV‐2 antibody features were identified according to age (IgA1 to Spike 1, IgA1 to nucleocapsid protein (NP)), suggesting that adults and children generate distinct mucosal antibody responses during the acute phase of infection. Utilizing respiratory and nonrespiratory PCR testing, along with the measurement of SARS‐CoV‐2–specific local and systemic antibodies, provides a more accurate assessment of infection within households and highlights some of the immunological differences in response between children and adults.
Complex Interactions Between Circulating Fatty Acid Levels, Desaturase Activities, and the Risk of Gestational Diabetes Mellitus: A Prospective Cohort Study
Publisher: Frontiers Media SA
Date: 11-07-2022
Abstract: Maternal abnormal fatty acid desaturation has previously been linked to gestational diabetes mellitus (GDM). However, few studies have investigated this relationship longitudinally throughout pregnancy. In this study, we investigated the relationship between GDM and desaturase activities across the pregnancy trimesters. A total of 661 women (GDM = 189, non-GDM = 472) were selected from the Complex Lipids in Mothers and Babies (CLIMB) cohort study. Clinical information and maternal serum were collected at 11–14, 22–28, and 32–34 weeks of gestation. Totally, 20 serum fatty acids were quantified using gas chromatography–mass spectrometry (GC-MS) analysis at each timepoint. Polyunsaturated fatty acid (PUFA) product-to-precursor ratios were used to estimate desaturase and elongase activities including delta-5 desaturase, delta-6 desaturase, stearoyl-CoA desaturase, and elongase. After adjusting for major potential confounders including maternal age, BMI, primiparity, smoking, and alcohol consumption, we observed a significant increase in the levels of γ-linolenic acid (GLA) and eicosatrienoic acid (DGLA) in the first trimester of women with GDM, whereas GLA and DGLA were reduced in the third trimester, when compared to the non-GDM group. Arachidonic acid (AA) showed an upward trend in the GDM group throughout pregnancy. Estimated delta-6 desaturase and delta-5 desaturase activity were elevated in the first trimester (OR = 1.40, 95% CI 1.03–1.91 OR = 0.56, 95% CI 0.32–0.96) but attenuated in the third trimester (OR = 0.78, 95% CI 0.58–1.07 OR = 2.64, 95% CI 1.46–4.78) in GDM pregnancies, respective to controls. Estimated delta-9–18 desaturase activity (OR = 3.70, 95% CI 1.49–9.19) was increased in women with GDM in later pregnancy. Our study highlights the potential importance of fatty acid desaturase activities, particularly estimated delta-5 desaturase and delta-9–18 desaturase in the pathophysiology of GDM. These findings may have applications for the early diagnosis and management of GDM.
The Australian and New Zealand Children's Haematology/Oncology Group Biobanking Network.
Publisher: Mary Ann Liebert Inc
Date: 04-2019
The Potent Antioxidant MitoQ Protects Against Preeclampsia During Late Gestation but Increases the Risk of Preeclampsia When Administered in Early Pregnancy
Publisher: Mary Ann Liebert Inc
Date: 10-01-2021
Neonatal DNA methylation profile in human twins is specified by a complex interplay between intrauterine environmental and genetic factors, subject to tissue-specific influence
Publisher: Cold Spring Harbor Laboratory
Date: 16-07-2012
Abstract: Comparison between groups of monozygotic (MZ) and dizygotic (DZ) twins enables an estimation of the relative contribution of genetic and shared and nonshared environmental factors to phenotypic variability. Using DNA methylation profiling of ∼20,000 CpG sites as a phenotype, we have examined discordance levels in three neonatal tissues from 22 MZ and 12 DZ twin pairs. MZ twins exhibit a wide range of within-pair differences at birth, but show discordance levels generally lower than DZ pairs. Within-pair methylation discordance was lowest in CpG islands in all twins and increased as a function of distance from islands. Variance component decomposition analysis of DNA methylation in MZ and DZ pairs revealed a low mean heritability across all tissues, although a wide range of heritabilities was detected for specific genomic CpG sites. The largest component of variation was attributed to the combined effects of nonshared intrauterine environment and stochastic factors. Regression analysis of methylation on birth weight revealed a general association between methylation of genes involved in metabolism and biosynthesis, providing further support for epigenetic change in the previously described link between low birth weight and increasing risk for cardiovascular, metabolic, and other complex diseases. Finally, comparison of our data with that of several older twins revealed little evidence for genome-wide epigenetic drift with increasing age. This is the first study to analyze DNA methylation on a genome scale in twins at birth, further highlighting the importance of the intrauterine environment on shaping the neonatal epigenome.
Pediatric Pleomorphic Xanthoastrocytoma Treated with Surgical Resection Alone: Clinicopathologic Features
Publisher: Ovid Technologies (Wolters Kluwer Health)
Date: 10-2016
Methylation profiling of paediatric pilocytic astrocytoma reveals variants specifically associated with tumour location and predictive of recurrence
Publisher: Wiley
Date: 06-07-2018
Body mass index from early to late childhood and cardiometabolic measurements at 11 to 12 years
Publisher: American Academy of Pediatrics (AAP)
Date: 08-2020
Abstract: To examine how overweight and obesity at specific ages and overall BMI growth patterns throughout childhood predict cardiometabolic phenotypes at 11 to 12 years. In a population-based s le of 5107 infants, BMI was measured every 2 years between ages 2 to 3 and 10 to 11 years. We identified 5 BMI trajectories using growth curve models. At ages 11 to 12 years, 1811 children completed assessments for metabolic syndrome risk scores, carotid-femoral pulse wave velocity, and carotid intima-media thickness. Multivariable regression models were used to estimate associations, adjusted for potential confounders (eg, age, sex, smoking exposure, and small for gestational age). Overweight and obesity from early childhood onward were strongly associated with higher cardiometabolic risk at 11 to 12 years of age. At age 6 to 7 years, compared with those with a healthy weight, children with overweight had higher metabolic syndrome risk scores by 0.23 SD units (95% confidence interval 0.05 to 0.41) and with obesity by 0.76 SD units (0.51–1.01), with associations almost doubling by age 10 to 11 years. Obese (but not overweight) children had higher outcome pulse wave velocity (0.64–0.73 SD units) from ages 6 to 7 years and slightly higher outcome carotid intima-media thickness (0.20–0.30 SD units) at all ages. Cumulative exposure to high BMI from 2 to 3 years of age carried the greatest cardiometabolic risk, with a gradient of risk across trajectories. High early-childhood BMI is already silently associated with the development of cardiometabolic risk by 11 to 12 years, highlighting the urgent need for effective action to reduce overweight and obesity in early childhood.
Infant inflammation predicts childhood emotional and behavioral problems and partially mediates socioeconomic disadvantage
Publisher: Elsevier BV
Date: 08-2022
Is cellular heterogeneity merely a confounder to be removed from epigenome-wide association studies?
Publisher: Future Medicine Ltd
Date: 08-2017
Abstract: Excitement about DNA methylation biomarkers has been tempered by a growing appreciation of the complex causal relations with cell fate. Inters le differences in DNA methylation can be partitioned into those that are independent of cellular heterogeneity and those that are caused by differential mixtures of cell types. Generally, the field has assumed that the former are more likely to be causative of disease. The latter has been considered a likely consequence of disease and a confounder to be removed. We argue that the conceptual separation of these signals is artificial and not necessarily informative about causation. DNA methylation is a very sensitive measure of cell fate mix and therefore reveals much about underlying disease etiology including aspects of causation.
The Peri/Postnatal Epigenetic Twins Study (PETS)
Publisher: Cambridge University Press (CUP)
Date: 22-11-2012
DOI: 10.1017/THG.2012.114
Abstract: The Peri ostnatal Epigenetic Twins Study (PETS) is a longitudinal cohort of 250 pairs of Australian twins and their mothers, who were recruited mid-way through pregnancy from January 2007 to September 2009. The study is centered on the developmental origins of health and disease paradigm (DOHaD) in which an adverse intrauterine environment predisposes the in idual to complex disease in later life by reducing growth in utero and adversely altering developmental plasticity. Data concerning diet and lifestyle were collected from mothers during pregnancy, and s les of plasma and serum taken at 28 weeks’ gestation. We attended 75% of all births, at which time we collected multiple biological s les including placenta, cord blood, and neonatal cheek cells, the latter from 91% of pairs. Chorionicity was recorded and zygosity was determined by DNA testing where necessary. Approximately 40% of the twins are monozygotic, two-thirds of which are dichorionic. Twins were seen again at 18 months of age and repeat blood and cheek swabs taken where possible. Studies of gene expression and the epigenetic marks of DNA methylation have so far revealed that twins exhibit a wide range of epigenetic discordance at birth, that one-third of the epigenome changes significantly between birth and 18 months shared (maternal) environment, genetic factors, and non-shared intrauterine environment contribute to an increasing proportion of epigenetic variation at birth, respectively, and affect tissues differently, and that within-pair birth weight discordance correlates with epigenetic discordance in genes associated with lipid metabolism, supporting an epigenetic mechanism for DOHaD.
Metabolic Regulation of DNA Methylation in Mammalian Cells
Publisher: Elsevier
Date: 2017
Time- and sex-dependent associations between prenatal alcohol exposure and placental global DNA methylation
Publisher: Future Medicine Ltd
Date: 07-2018
Abstract: Aim: Epigenetic changes, in particular in the placenta, may mediate the effects of prenatal alcohol exposure (PAE) on children's health. We examined the relationship between PAE patterns, based on dose and timing, and placental global DNA methylation. Methods: Using linear regression analysis, we examined the association between different PAE categories and placental global DNA methylation (n = 187), using the proxy measure of Alu-interspersed repeats. Results: Following adjustment for important covariates, we found no evidence of an association between PAE and placental global DNA methylation overall. However, when stratifying by newborn sex, PAE throughout pregnancy was associated with higher placental global DNA methylation (1.5% p = 0.01) of male newborns. Conclusion: PAE may have sex-specific effects on placental global DNA methylation if alcohol is consumed throughout pregnancy.
Deserters on the atopic march: Risk factors, immune profile, and clinical outcomes of food-sensitized-tolerant infants.
Publisher: Wiley
Date: 17-01-2019
DOI: 10.1111/ALL.14159
Abstract: A few studies have investigated the antecedents and outcomes of infants who demonstrate IgE sensitization to foods that they clinically tolerate. Improved understanding of this sensitized-tolerant phenotype may inform strategies for the prevention of food allergy. In an Australian birth cohort (n = 1074), assembled using an unselected antenatal s ling frame, participants were categorized as nonsensitized (NS), sensitizedtolerant (ST), or food allergic (FA) based on skin prick testing and food challenge at 12 months of age. Environmental exposures were recorded throughout. Cord blood regulatory T-cell populations were measured at birth. Subsequent childhood allergic disease was assessed by parent report, clinical examination, and repeat skin prick testing. The covariates of interest varied between NS (n = 698), ST (n = 27), and FA (n = 61) groups as follows, suggesting that across these measures, the ST group was more similar to the NS than the FA group: family history of eczema NS 44.6%, ST. 44.6%, FA 65.6% pet ownership at 12 months: NS 71.5%, ST 81.5%, FA 45.8% eczema during the first 12 months: NS 19%, ST 32%, FA 64% and aeroallergen sensitization at 4 years: NS 19.1%, ST 28.6%, FA 44.4%. At birth, a higher proportion of activated regulatory T cells was associated with ST (OR = 2.89, 95% CI 1.03-8.16, P = .045). Food-sensitized-tolerance in infancy appears to be associated with a similar pattern of exposures, immunity, and outcomes to nonsensitized infants. In addition, we found some evidence that an elevated proportion of activated regulatory T cells at birth was specific to the sensitized-tolerant infants, which may be relevant to suppression of clinical disease.
Metabolomics: population epidemiology and concordance in Australian children aged 11–12 years and their parents
Publisher: BMJ
Date: 07-2019
DOI: 10.1136/BMJOPEN-2017-020900
Abstract: Nuclear magnetic resonance (NMR) metabolomics is high throughput and cost-effective, with the potential to improve the understanding of disease and risk. We examine the circulating metabolic profile by quantitative NMR metabolomics of a s le of Australian 11–12 year olds children and their parents, describe differences by age and sex, and explore the correlation of metabolites in parent–child dyads. The population-based cross-sectional Child Health CheckPoint study nested within the Longitudinal Study of Australian Children. Blood s les collected from CheckPoint participants at assessment centres in seven Australian cities and eight regional towns February 2015–March 2016. 1180 children and 1325 parents provided a blood s le and had metabolomics data available. This included 1133 parent–child dyads (518 mother–daughter, 469 mother–son, 68 father–daughter and 78 father–son). 228 metabolic measures were obtained for each participant. We focused on 74 biomarkers including amino acid species, lipoprotein subclass measures, lipids, fatty acids, measures related to fatty acid saturation, and composite markers of inflammation and energy homeostasis. We identified differences in the concentration of specific metabolites between childhood and adulthood and in metabolic profiles in children and adults by sex. In general, metabolite concentrations were higher in adults than children and sex differences were larger in adults than in children. Positive correlations were observed for the majority of metabolites including isoleucine (CC 0.33, 95% CI 0.27 to 0.38), total cholesterol (CC 0.30, 95% CI 0.24 to 0.35) and omega 6 fatty acids (CC 0.28, 95% CI 0.23 to 0.34) in parent–child comparisons. We describe the serum metabolite profiles from mid-childhood and adulthood in a population-based s le, together with a parent–child concordance. Differences in profiles by age and sex were observed. These data will be informative for investigation of the childhood origins of adult non-communicable diseases and for comparative studies in other populations.
Diffuse scattering study of aspirin forms (I) and (II)
Publisher: International Union of Crystallography (IUCr)
Date: 10-11-2010
DOI: 10.1107/S0108768110037055
Abstract: Full three-dimensional diffuse scattering data have been recorded for both polymorphic forms [(I) and (II)] of aspirin and these data have been analysed using Monte Carlo computer modelling. The observed scattering in form (I) is well reproduced by a simple harmonic model of thermally induced displacements. The data for form (II) show, in addition to thermal diffuse scattering (TDS) similar to that in form (I), diffuse streaks originating from stacking fault-like defects as well as other effects that can be attributed to strain induced by these defects. The present study has provided strong evidence that the aspirin form (II) structure is a true polymorph with a structure quite distinct from that of form (I). The diffuse scattering evidence presented shows that crystals of form (II) are essentially composed of large single domains of the form (II) lattice with a relatively small volume fraction of intrinsic planar defects or faults comprising misoriented bilayers of molecular dimers. There is evidence of some local aggregation of these defect bilayers to form small included regions of the form (I) structure. Evidence is also presented that shows that the strain effects arise from the mismatch of molecular packing between the defect region and the surrounding form (II) lattice. This occurs at the edges of the planar defects in the b direction only.
Micromanaging human placental function: Differential microRNA expression in feto-placental endothelial cells of gestational diabetes pregnancies
Publisher: Portland Press Ltd.
Date: 25-01-2019
DOI: 10.1042/CS20180901
Reproductive function in men conceived with in vitro fertilization and intracytoplasmic sperm injection
Publisher: Elsevier BV
Date: 04-2022
DOI: 10.1016/J.FERTNSTERT.2021.12.026
Abstract: To determine the semen quality and reproductive hormones of men conceived by in vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI) compared with men conceived without assisted reproductive technology (ART). Cohort study. IVF centers in Victoria and the Western Australian Raine Study. Men conceived with IVF/ICSI and men conceived without ART aged 18-25 years. Clinical review. The primary outcome was the prevalence of severe oligozoospermia (sperm concentration, <5 million/mL). The secondary outcomes were total sperm count, total and progressive motility, total motile count, normal morphology, and serum testosterone, luteinizing hormone (LH) and follicle-stimulating hormone (FSH). There was no difference in the prevalence of severe oligozoospermia between 120 men conceived with IVF/ICSI and 356 men conceived without ART (9% vs. 5.3%). Men conceived with IVF/ICSI had similar sperm concentration, total sperm count, and total motile count but lower mean total (55.3% vs. 60.6%) and progressive (44.7% vs. 53.9%) sperm motility with higher mean normal morphology (8.5% vs. 5.4%). Differences in progressive motility (ß, -9.9 95% confidence interval [CI], -16.7 - -3.0), normal morphology (ß, 4.3 95% CI, 3.0-5.7), and proportion with abnormal morphology (adjusted odds ratios, 0.1 95% CI, 0.04-0.5) remained significant after adjusting for confounders. Men conceived with IVF/ICSI had lower mean FSH (3.3 IU/L) and LH (3.9 IU/L) levels and higher mean testosterone levels (19.1 nmol/L) than controls (4.2 IU/L, 11.0 IU/L, and 16.8 nmol/L). This study of men conceived with IVF/ICSI found similar sperm output to men conceived without ART. Overall, the results are reassuring.
Glucose as a fetal nutrient: dynamic regulation of several glucose transporter genes by DNA methylation in the human placenta across gestation
Publisher: Elsevier BV
Date: 2013
DOI: 10.1016/J.JNUTBIO.2012.06.006
Abstract: The human placenta ensures proper fetal development through the regulation of nutrient and gas transfer from the mother to the fetus and the removal of waste products from the fetal circulation. Glucose is one of the major nutrients for the growing fetus. Its transport across the placenta to the fetus is mediated by a family of facilitative transporter proteins, known as the glucose transporters (GLUTs), encoded by the SLC2A family of genes. There are 14 members of this gene family, and the expression of several of these has been shown in human placenta however, aside from GLUT1 and GLUT3, little is known about the role of these proteins in placental function, fetal development and disease. In this study, we analysed previously generated genome-scale DNA methylation and gene expression data to examine the role of methylation in GLUT expression throughout gestation. We found evidence that DNA methylation regulates expression of GLUT3 and GLUT10, while the constitutively expressed GLUT1 showed no promoter methylation. We further analysed the level of DNA methylation across the promoter region of GLUT3, previously shown to be involved in glucose back-flux from the fetal circulation into the placenta. Using the Sequenom EpiTYPER platform, we found increasing DNA methylation of this gene in association with decreasing expression as gestation progresses, thereby highlighting the role of epigenetic modifications in regulating the GLUT family of genes in the placenta during pregnancy. These findings warrant a reexamination of the role of additional GLUT family members in the placenta in pregnancy and disease.
Plasma Trimethylamine N-Oxide and Its Precursors: Population Epidemiology, Parent–Child Concordance, and Associations with Reported Dietary Intake in 11- to 12-Year-Old Children and Their Parents
Publisher: Elsevier BV
Date: 07-2020
DOI: 10.1093/CDN/NZAA103
A Low Glycaemic Index Diet in Pregnancy Induces DNA Methylation Variation in Blood of Newborns: Results from the ROLO Randomised Controlled Trial
Publisher: MDPI AG
Date: 06-04-2018
DOI: 10.3390/NU10040455
Higher gestational weight gain delays wound healing and reduces expression of long non‐coding RNA KLRK1‐AS1 in neonatal endothelial progenitor cells
Publisher: Wiley
Date: 20-07-2023
DOI: 10.1113/JP284871
Abstract: High gestational weight gain (GWG) is a cardiovascular risk factor and may disturb neonatal endothelial function. Long non‐coding RNAs (lncRNAs) regulate gene expression epigenetically and can modulate endothelial function. Endothelial colony forming cells (ECFCs), circulating endothelial precursors, are a recruitable source of endothelial cells and sustain endothelial function, vascular growth and repair. We here investigated whether higher GWG affects neonatal ECFC function and elucidated the role of lncRNAs herein. Wound healing of umbilical cord blood‐derived ECFCs after pregnancies with GWG kg versus kg was determined in a scratch assay and based on monolayer impedance after electric wounding (electric cell‐substrate impedance sensing, ECIS). LncRNA expression was analysed by RNA sequencing. The function of killer cell lectin‐like receptor K1 antisense RNA ( KLRK1‐AS1 ) was investigated after siRNA‐based knockdown. Closure of the scratch was delayed by 25% ( P = 0.041) in the higher GWG group and correlated inversely with GWG ( R = −0.538, P = 0.012) in all subjects ( n = 22). Similarly, recovery of the monolayer barrier after electric wounding was delayed (−11% after 20 h P = 0.014 n = 15). Several lncRNAs correlated with maternal GWG, the most significant one being KLRK1‐AS1 (log 2 fold change = −0.135, P 0.001, n = 35). KLRK1‐AS1 knockdown ( n = 4) reduced barrier recovery after electric wounding by 21% ( P = 0.029) and KLRK1‐AS1 expression correlated with the time required for wound healing for both scratch ( R = 0.447, P = 0.033) and impedance‐based assay ( R = 0.629, P = 0.014). Higher GWG reduces wound healing of neonatal ECFCs, and lower levels of the lncRNA KLRK1‐AS1 may underlie this. image Maternal cardiovascular risk factors such as diabetes, obesity and smoking in pregnancy disturb fetal endothelial function, and we here investigated whether also high gestational weight gain (GWG) has an impact on fetal endothelial cells. Circulating endothelial progenitor cells (endothelial colony forming cells, ECFCs) are highly abundant in the neonatal blood stream and serve as a circulating pool for vascular growth and repair. We revealed that higher GWG delays wound healing capacity of ECFCs in vitro . We identified the regulatory RNA lncRNA KLRK1‐AS1 as a link between GWG and delayed ECFC wound healing. Our data show that high GWG, independent of pre‐pregnancy BMI, affects neonatal ECFC function.
Maternal Obesity Alters Placental Cell Cycle Regulators in the First Trimester of Human Pregnancy: New Insights for BRCA1
Publisher: MDPI AG
Date: 11-01-2020
DOI: 10.3390/IJMS21020468
Abstract: In the first trimester of pregnancy, placental development involves a wide range of cellular processes. These include trophoblast proliferation, fusion, and differentiation, which are dependent on tight cell cycle control. The intrauterine environment affects placental development, which also includes the trophoblast cell cycle. In this work, we focus on maternal obesity to assess whether an altered intrauterine milieu modulates expression and protein levels of placental cell cycle regulators in early human pregnancy. For this purpose, we use first trimester placental tissue from lean and obese women (gestational week 5+0–11+6, n = 58). Using a PCR panel, a cell cycle protein array, and STRING database analysis, we identify a network of cell cycle regulators increased by maternal obesity in which breast cancer 1 (BRCA1) is a central player. Immunostaining localizes BRCA1 predominantly to the villous and the extravillous cytotrophoblast. Obesity-driven BRCA1 upregulation is not able to be explained by DNA methylation (EPIC array) or by short-term treatment of chorionic villous explants at 2.5% oxygen with tumor necrosis factor α (TNF-α) (50 mg/mL), leptin (100 mg/mL), interleukin 6 (IL-6) (100 mg/mL), or high glucose (25 nM). Oxygen tension rises during the first trimester, but this change in vitro has no effect on BRCA1 (2.5% and 6.5% O2). We conclude that maternal obesity affects placental cell cycle regulation and speculate this may alter placental development.
Inflammation mediates the relationship between obesity and retinal vascular calibre in 11-12 year-olds children and mid-life adults
Publisher: Springer Science and Business Media LLC
Date: 19-03-2020
DOI: 10.1038/S41598-020-61801-W
Abstract: Obesity predicts adverse microvasculature from childhood, potentially via inflammatory pathways. We investigated whether inflammation mediates associations between obesity and microvascular parameters. In 1054 children (mean age 11 years) and 1147 adults (44 years) from a cross-sectional study, we measured BMI (z-scores for children) and WHtR, Glycoprotein acetyls (GlycA), an inflammatory marker, and retinal arteriolar and venular calibre. Causal mediation analysis methods decomposed a “total effect” into “direct” and “indirect” components via a mediator, considering continuous and categorical measures and adjusting for potential confounders. Compared to normal-weight BMI children, those with overweight or obesity had narrower arteriolar calibre (total effects −0.21 to −0.12 standard deviation (SD)): direct (not mediated via GlycA) effects were similar. Children with overweight or obesity had 0.25 to 0.35 SD wider venular calibre, of which 19 to 25% was mediated via GlycA. In adults, those with obesity had 0.07 SD greater venular calibre, which was completely mediated by GlycA (indirect effect: 0.07 SD, 95% CI −0.01 to 0.16). Similar findings were obtained with other obesity measures. Inflammation mediated associations between obesity and retinal venules, but not arterioles from mid-childhood, with higher mediation effects observed in adults. Interventions targeting inflammatory pathways may help mitigate adverse impacts of obesity on the microvasculature.
Mass cytometry reveals cellular fingerprint associated with IgE+ peanut tolerance and allergy in early life.
Publisher: Springer Science and Business Media LLC
Date: 27-02-2020
DOI: 10.1038/S41467-020-14919-4
Abstract: IgE-mediated peanut allergic is common, often serious, and usually lifelong. Not all in iduals who produce peanut-specific IgE will react upon consumption of peanut and can eat the food without adverse reactions, known as sensitized tolerance. Here, we employ high-dimensional mass cytometry to define the circulating immune cell signatures associated with sensitized tolerance and clinical allergy to peanut in the first year of life. Key features of clinical peanut allergic are increased frequency of activated B cells (CD19 hi HLADR hi ), overproduction of TNFα and increased frequency of peanut-specific memory CD4 T cells. Infants with sensitized tolerance display reduced frequency but hyper-responsive naive CD4 T cells and an increased frequency of plasmacytoid dendritic cells. This work demonstrates the utility and power of high-dimensional mass cytometry analysis to interrogate the cellular interactions that are associated with allergic sensitization and clinical food allergy in the first year of life.
The CODATwins Project: The Current Status and Recent Findings of COllaborative Project of Development of Anthropometrical Measures in Twins
Publisher: Cambridge University Press (CUP)
Date: 31-07-2019
DOI: 10.1017/THG.2019.35
Abstract: The COllaborative project of Development of Anthropometrical measures in Twins (CODATwins) project is a large international collaborative effort to analyze in idual-level phenotype data from twins in multiple cohorts from different environments. The main objective is to study factors that modify genetic and environmental variation of height, body mass index (BMI, kg/m 2 ) and size at birth, and additionally to address other research questions such as long-term consequences of birth size. The project started in 2013 and is open to all twin projects in the world having height and weight measures on twins with information on zygosity. Thus far, 54 twin projects from 24 countries have provided in idual-level data. The CODATwins database includes 489,981 twin in iduals (228,635 complete twin pairs). Since many twin cohorts have collected longitudinal data, there is a total of 1,049,785 height and weight observations. For many cohorts, we also have information on birth weight and length, own smoking behavior and own or parental education. We found that the heritability estimates of height and BMI systematically changed from infancy to old age. Remarkably, only minor differences in the heritability estimates were found across cultural–geographic regions, measurement time and birth cohort for height and BMI. In addition to genetic epidemiological studies, we looked at associations of height and BMI with education, birth weight and smoking status. Within-family analyses examined differences within same-sex and opposite-sex dizygotic twins in birth size and later development. The CODATwins project demonstrates the feasibility and value of international collaboration to address gene-by-exposure interactions that require large s le sizes and address the effects of different exposures across time, geographical regions and socioeconomic status.
Effect of an antenatal diet and lifestyle intervention and maternal BMI on cord blood DNA methylation in infants of overweight and obese women: The LIMIT Randomised Controlled Trial
Publisher: Public Library of Science (PLoS)
Date: 24-06-2022
DOI: 10.1371/JOURNAL.PONE.0269723
Abstract: To investigate the effect of an antenatal diet and lifestyle intervention, and maternal pre-pregnancy overweight or obesity, on infant cord blood DNA methylation. We measured DNA methylation in 645 cord blood s les from participants in the LIMIT study (an antenatal diet and lifestyle intervention for women with early pregnancy BMI ≥25.0 kg/m 2 ) using the Illumina 450K BeadChip array, and tested for any differential methylation related to the intervention, and to maternal early pregnancy BMI. We also analysed differential methylation in relation to selected candidate genes. No CpG sites were significantly differentially methylated in relation to either the diet and lifestyle intervention, or with maternal early pregnancy BMI. There was no significant differential methylation in any of the selected genes related to the intervention, or to maternal BMI. We found no evidence of an effect of either antenatal diet and lifestyle, or of maternal early pregnancy BMI, on cord blood DNA methylation. ACTRN12607000161426
Maternal Smoking during Pregnancy and DNA-Methylation in Children at Age 5.5 Years: Epigenome-Wide-Analysis in the European Childhood Obesity Project (CHOP)-Study
Publisher: Public Library of Science (PLoS)
Date: 12-05-2016
Maternal vitamin D predominates over genetic factors in determining neonatal circulating vitamin D concentrations
Publisher: Elsevier BV
Date: 07-2012
Abstract: There are multiple potential regulators of neonatal vitamin D status of environmental, genetic, and epigenetic origins. The relation between these factors and circulating neonatal vitamin D has yet to be fully characterized. The aim of this study was to examine the relative contribution of genetic factors, maternal circulating 25-hydroxyvitamin D [25(OH)D] concentrations, and the placental methylation level of the gene that encodes the primary catabolic enzyme of active vitamin D [25(OH)D-24-hydroxylase encoded by CYP24A1] to neonatal 25(OH)D concentrations. We used the classical twin study design to determine the genetic contribution to neonatal 25(OH)D. A total of 86 twin pairs (32 monozygotic and 54 dizygotic twin pairs) were included in this study. Serum 25(OH)D was measured by using a 25(OH)D kit. CYP24A1 promoter DNA methylation was measured by means of matrix-assisted laser desorption time-of-flight mass spectrometry. Maternal and neonatal 25(OH)D showed a strong association (R² = 0.19). Monozygotic and dizygotic within-pair serum 25(OH)D correlations were similar (R² = 0.71 and 0.67, respectively), which suggested no genetic effect. Placental CYP24A1 methylation did not show an association with maternal or neonatal 25(OH)D concentrations. Our results suggest that maternal circulating 25(OH)D is the most significant regulator of neonatal circulating 25(OH)D concentrations, with underlying genetic factors playing a limited role. The placental methylation of the CYP24A1 promoter appears subject to a genetic influence, although no evidence of a relation between the methylation level of this gene and circulating maternal or neonatal 25(OH)D was apparent.
Construction of neocentromere-based human minichromosomes for gene delivery and centromere studies
Publisher: Springer Science and Business Media LLC
Date: 22-05-2002
Abstract: Human neocentromeres are fully functional centromeres that arise naturally in non-centromeric regions devoid of alpha-satellite DNA. We have successfully produced a series of minichromosomes by telomere-associated truncation of a marker chromosome mardel(10) containing a neocentromere. The resulting minichromosomes are either linear or circular in nature, and range in size from approximately 650 kb to 2 Mb. These minichromosomes exhibit full centromeric activity, bind to essential centromere proteins, and are mitotically stable over many generations. They provide a useful system for dissecting the functional domains of complex eukaryotic centromeres and as vectors for therapeutic gene delivery.
Increased maternal mental health burden in a representative longitudinal community cohort coinciding with COVID-19 lockdown
Publisher: Informa UK Limited
Date: 16-09-2021
Effects of Scaffold/Matrix Alteration on Centromeric Function and Gene Expression
Publisher: Elsevier BV
Date: 09-2004
Blood DNA methylation as a potential biomarker of dementia: A systematic review
Publisher: Wiley
Date: 08-11-2017
Gestational Diabetes Mellitus-Associated Hyperglycemia Impairs Glucose Transporter 3 Trafficking in Trophoblasts Through the Downregulation of AMP-Activated Protein Kinase
Publisher: Frontiers Media SA
Date: 02-11-2021
DOI: 10.3389/FCELL.2021.722024
Abstract: AMP-activated protein kinase (AMPK) is an important regulator of glucose metabolism, and glucose transporter 3 (GLUT3) is an efficient glucose transporter in trophoblasts. Whether placental AMPK and GLUT3 respond accordingly to gestational diabetes mellitus (GDM) remains uncertain. Here, we explored the regulatory role of AMPK in the GLUT3-dependent uptake of glucose by placental trophoblasts and the viability of the cells. In this study, the level of glycolysis in normal and GDM-complicated placentas was assessed by LC-MS/MS. The trophoblast hyperglycemia model was induced by the incubation of HTR8/SVneo cells with a high glucose concentration. GDM animal models were generated with db/ + mice and C57BL/6J mice fed a high-fat diet, and AMPK was manipulated by the oral administration of metformin. The uptake of glucose by trophoblasts was assessed using 2-NBDG or 2-deoxy-D-[ 3 H] glucose. The results showed that GDM is associated with impaired glycolysis, AMPK activity, GLUT3 expression in the plasma membrane (PM) and cell survival in the placenta. Hyperglycemia induced similar changes in trophoblasts, and these changes were rescued by AMPK activation. Both hyperglycemic db/ + and high-fat diet-induced GDM mice exhibited a compromised AMPK–GLUT3 axis and suppressed cell viability in the placenta as well as excessive fetal growth, and all of these effects were partially alleviated by metformin. Taken together, our findings support the notion that AMPK activation upregulates trophoblast glucose uptake by stimulating GLUT3 translocation, which is beneficial for viability. Thus, the modulation of glucose metabolism in trophoblasts by targeting AMPK might ameliorate the adverse intrauterine environment caused by GDM.
Process evaluation in the field: global learnings from seven implementation research hypertension projects in low-and middle-income countries
Publisher: Springer Science and Business Media LLC
Date: 16-07-2019
Sex matters: XIST and DDX3Y gene expression as a tool to determine fetal sex in human first trimester placenta
Publisher: Elsevier BV
Date: 08-2020
New directions in childhood obesity research: how a comprehensive biorepository will allow better prediction of outcomes
Publisher: Springer Science and Business Media LLC
Date: 22-10-2018
Differentiation of human embryonic stem cells to HOXA+ hemogenic vasculature that resembles the aorta-gonad-mesonephros
Publisher: Springer Science and Business Media LLC
Date: 17-10-2016
DOI: 10.1038/NBT.3702
Abstract: The ability to generate hematopoietic stem cells from human pluripotent cells would enable many biomedical applications. We find that hematopoietic CD34
Triiodothyronine (T3) Induces Limited Transcriptional and DNA Methylation Reprogramming in Human Monocytes
Publisher: MDPI AG
Date: 04-03-2022
DOI: 10.3390/BIOMEDICINES10030608
Abstract: Thyroid hormones have immunomodulatory roles, but their effects on the transcriptome and epigenome of innate immune cell types remain unexplored. In this study, we investigate the effects of triiodothyronine (T3) on the transcriptome and methylome of human monocytes in vitro, both in resting and lipopolysaccharide (LPS)-stimulated conditions. In resting monocytes, 5 µM T3 affected the expression of a small number of monocyte-to-macrophage differentiation-associated genes, including TLR4 (p-value 0.05, expression fold change .5). T3 attenuated a small proportion of monocyte-to-macrophage differentiation-associated DNA methylation changes, while specifically inducing DNA methylation changes at several hundred differentially methylated CpG probes (DMPs) (p-value 0.05, Δβ 0.05). In LPS-stimulated monocytes, the presence of T3 attenuated the effect of 27% of LPS-induced DMPs (p-value 0.05, Δβ 0.05). Interestingly, co-stimulation with T3 + LPS induced a unique DNA methylation signature that was not observed in the LPS-only or T3-only exposure groups. Our results suggest that T3 induces limited transcriptional and DNA methylation remodeling in genes enriched in metabolism and immune processes and alters the normal in vitro LPS response. The overlap between differentially expressed genes and genes associated with DMPs was minimal thus, other epigenetic mechanisms may underpin the expression changes. This research provides insight into the complex interplay between thyroid hormones, epigenetic remodeling, and transcriptional dynamics in monocytes.
Gestational diabetes and maternal obesity are associated with epigenome-wide methylation changes in children
Publisher: American Society for Clinical Investigation
Date: 06-09-2018
Engineering chromosomes for delivery of therapeutic genes
Publisher: Elsevier BV
Date: 12-2005
DOI: 10.1016/J.TIBTECH.2005.10.001
Abstract: The ability to create fully functional human chromosome vectors represents a potentially exciting gene-delivery system for the correction of human genetic disorders with several advantages over viral delivery systems. However, for the full potential of chromosome-based gene-delivery vectors to be realized, several key obstacles must be overcome. Methods must be developed to insert therapeutic genes reliably and efficiently and to enable the stable transfer of the resulting chromosomal vectors to different therapeutic cell types. Research to achieve these outcomes continues to encounter major challenges however recent developments have reiterated the potential of chromosome-based vectors for therapeutic gene delivery. Here we review the different strategies under development and discuss the advantages and problems associated with each.
Long-term cardiometabolic health in people born after assisted reproductive technology: a multi-cohort analysis
Publisher: Oxford University Press (OUP)
Date: 09-07-2010
DOI: 10.1093/EURHEARTJ/EHAC726
Abstract: To examine associations of assisted reproductive technology (ART) conception (vs. natural conception: NC) with offspring cardiometabolic health outcomes and whether these differ with age. Differences in systolic (SBP) and diastolic blood pressure (DBP), heart rate (HR), lipids, and hyperglycaemic/insulin resistance markers were examined using multiple linear regression models in 14 population-based birth cohorts in Europe, Australia, and Singapore, and results were combined using meta-analysis. Change in cardiometabolic outcomes from 2 to 26 years was examined using trajectory modelling of four cohorts with repeated measures. 35 938 (654 ART) offspring were included in the meta-analysis. Mean age ranged from 13 months to 27.4 years but was & years in 11/14 cohorts. Meta-analysis found no statistical difference (ART minus NC) in SBP (−0.53 mmHg 95% CI:−1.59 to 0.53), DBP (−0.24 mmHg −0.83 to 0.35), or HR (0.02 beat/min −0.91 to 0.94). Total cholesterol (2.59% 0.10–5.07), HDL cholesterol (4.16% 2.52–5.81), LDL cholesterol (4.95% 0.47–9.43) were statistically significantly higher in ART-conceived vs. NC offspring. No statistical difference was seen for triglycerides (TG), glucose, insulin, and glycated haemoglobin. Long-term follow-up of 17 244 (244 ART) births identified statistically significant associations between ART and lower predicted SBP/DBP in childhood, and subtle trajectories to higher SBP and TG in young adulthood however, most differences were not statistically significant. These findings of small and statistically non-significant differences in offspring cardiometabolic outcomes should reassure people receiving ART. Longer-term follow-up is warranted to investigate changes over adulthood in the risks of hypertension, dyslipidaemia, and preclinical and clinical cardiovascular disease.
Does maternal mental well-being in pregnancy impact the early human epigenome?
Publisher: Future Medicine Ltd
Date: 03-2017
Abstract: There is considerable interest in the potential nongenetic transmission of a suite of mental health conditions across generations, with epigenetics emerging as a candidate mediator of such effects. This review summarizes findings from 22 studies measuring candidate gene DNA methylation and seven epigenome-wide association studies of offspring epigenetic profile in women with adverse mental wellbeing measures (stress, depression or anxiety) in pregnancy. Despite some compelling evidence to suggest an association, there is a lack of reproducible findings, potentially linked to a number of limitations to this research and the field more broadly. Large cohorts with well characterized exposures across pregnancy are now needed. There is exciting potential that epigenetics may help explain some of the link between maternal wellbeing and child health outcomes, thereby informing novel interventions, but future studies must address current limitations to advance translational knowledge in this area.
The Distinct Role of the HDL Receptor SR-BI in Cholesterol Homeostasis of Human Placental Arterial and Venous Endothelial Cells
Publisher: MDPI AG
Date: 11-05-2022
DOI: 10.3390/IJMS23105364
Abstract: As opposed to adults, high-density lipoprotein (HDL) is the main cholesterol carrying lipoprotein in fetal circulation. The major HDL receptor, scavenger receptor class B type I (SR-BI), contributes to local cholesterol homeostasis. Arterial endothelial cells (ECA) from human placenta are enriched with cholesterol compared to venous endothelial cells (ECV). Moreover, umbilical venous and arterial plasma cholesterol levels differ markedly. We tested the hypothesis that the uptake of HDL-cholesteryl esters differs between ECA and ECV because of the differential expression of SR-BI. We aimed to identify the key regulators underlying these differences and the functional consequences. Immunohistochemistry was used for visualization of SR-BI in situ. ECA and ECV were isolated from the chorionic plate of human placenta and used for RT-qPCR, Western Blot, and HDL uptake assays with 3H- and 125I-labeled HDL. DNA was extracted for the methylation profiling of the SR-BI promoter. SR-BI regulation was studied by exposing ECA and ECV to differential oxygen concentrations or shear stress. Our results show elevated SR-BI expression and protein abundance in ECA compared to ECV in situ and in vitro. Immunohistochemistry demonstrated that SR-BI is mainly expressed on the apical side of placental endothelial cells in situ, allowing interaction with mature HDL circulating in the fetal blood. This was functionally linked to a higher increase of selective cholesterol ester uptake from fetal HDL in ECA than in ECV, and resulted in increased cholesterol availability in ECA. SR-BI expression on ECV tended to decrease with shear stress, which, together with heterogeneous immunostaining, suggests that SR-BI expression is locally regulated in the placental vasculature. In addition, hypomethylation of several CpG sites within the SR-BI promoter region might contribute to differential expression of SR-BI between chorionic arteries and veins. Therefore, SR-BI contributes to a local cholesterol homeostasis in ECA and ECV of the human feto-placental vasculature.
Postnatal stability, tissue, and time specific effects of AHRR methylation change in response to maternal smoking in pregnancy.
Publisher: Informa UK Limited
Date: 22-11-2014
DOI: 10.4161/EPI.27248
Components of the human spindle checkpoint control mechanism localize specifically to the active centromere on dicentric chromosomes
Publisher: Springer Science and Business Media LLC
Date: 27-10-2000
Abstract: The spindle checkpoint control mechanism functions to ensure faithful chromosome segregation by delaying cell ision until all chromosomes are correctly oriented on the mitotic spindle. Initially identified in budding yeast, several mammalian spindle checkpoint-associated proteins have recently been identified and partially characterized. These proteins associate with all active human centromeres, including neocentromeres, in the early stages of mitosis prior to the commencement of anaphase. We have examined the status of proteins associated with the checkpoint protein complex (BUB1, BUBR1, BUB3, MAD2), the anaphase-promoting complex (Tsg24, p55CDC), and other proteins associated with mitotic checkpoint control (ERK1, 3F3/2 epitope, hZW10), on a human dicentric chromosome. Each of these proteins was found to specifically associate with only the active centromere, suggesting that only active centromeres participate in the spindle checkpoint. This finding complements previous studies on multicentric chromosomes demonstrating specific association of structural and motor-related centromere proteins with active centromeres, and suggests that centromere inactivation is accompanied by loss of all functionally important centromere proteins.
Vertical resolution of baroclinic modes in global ocean models
Publisher: Elsevier BV
Date: 05-2017
Imprinted CDKN1C Is a Tumor Suppressor in Rhabdoid Tumor and Activated by Restoration of SMARCB1 and Histone Deacetylase Inhibitors
Publisher: Public Library of Science (PLoS)
Date: 16-02-2009
Evidence of broad-based family support for the use of archival childhood tumour samples in future research.
Publisher: BMJ
Date: 10-05-2016
DOI: 10.1136/MEDETHICS-2015-103141
Abstract: This study aimed to determine the ability to successfully contact past paediatric patients and their families to request participation in research, to assess familial views on the use of previously collected archival clinical s les for research purposes, and to highlight the ethical and practical issues in obtaining this type of retrospective consent. To assess familial views on the use of such s les for research, we contacted a cohort of families with children previously diagnosed with a brain tumour to ask for consent to an epigenetic/genetic study. Examining participants' responses allowed us to gauge their opinions on the use of such tissue for research, and whether they would like to receive genetic information uncovered during research. We were able to successfully contact 107 out of 178 families and found a significant positive correlation between year of diagnosis and ability to make contact. Of those families contactable that returned a consent form (75/107), 74 agreed to the use of their/their child's archival tissue in future research, and 70 of 74 requested notification should a gene change of potential clinical relevance be found. There were no differences in opinion between parents of living or deceased children or the patients themselves. This study highlights the importance of time since diagnosis on the ability to make contact with previous patients and their families. When contactable, our data highlight the altruistic views of families towards the use of archival clinical s les for research purposes, irrespective of the outcome of their child's illness.
DNA methylation and genetic variation of the angiotensin converting enzyme (ACE) in depression
Publisher: Elsevier BV
Date: 02-2018
DOI: 10.1016/J.PSYNEUEN.2017.11.003
Abstract: Depression is one of the most prevalent psychiatric disorders, and in older persons is associated with high levels of comorbidity and under-treatment. Dysfunction of the hypothalamic-pituitary-adrenal (HPA) stress axis is consistently observed in the older population as well as depressed patients, with the angiotensin converting enzyme (ACE) a key regulator of the stress response. Epigenetic regulation of ACE may play an important role in HPA axis (dys)regulation. To investigate ACE promoter methylation as a biomarker of late-life depression, and its association with genetic variation and cortisol secretion. The longitudinal general population ESPRIT study is aimed at investigating psychiatric disorders in older persons (n=1863, average age=73). Depression was assessed using the Mini International Neuropsychiatric Interview according to DSM-IV criteria and the Centre for Epidemiologic Studies Depression Scale (CES-D). Genotype information for seven polymorphisms across the ACE gene was also available. Blood and saliva s les collected at baseline and used to extract DNA and measure cortisol, respectively. Sequenom MassARRAY was used to measure promoter DNA methylation of the ACE gene (n=552). There was no evidence of an association between ACE promoter methylation and depression. However, there was evidence that ACE genetic variants influenced methylation, and modified the association between depression and methylation (Δ at various sites -2.05% to 1.74% p=0.019 to 0.039). Multivariate analyses were adjusted for participants' lifestyle, health and medical history. Independent of depression status, ACE methylation was inversely correlated with cortisol levels (r=-0.336, p=0.042). This study provides evidence that associations between ACE methylation and depression are genotype-dependent, suggesting that the development of reliable depression biomarkers may need to consider methylation levels in combination with underlying genetic variation. ACE methylation may also be a suitable biomarker of cortisol and/or HPA axis activity.
Maternal mental well-being during pregnancy and glucocorticoid receptor gene promoter methylation in the neonate
Publisher: Cambridge University Press (CUP)
Date: 04-04-2016
DOI: 10.1017/S0954579416000183
Abstract: Maternal mental health during pregnancy has been linked to health outcomes in progeny. Mounting evidence implicates fetal “programming” in this process, possibly via epigenetic disruption. Maternal mental health has been associated with glucocorticoid receptor methylation (nuclear receptor subfamily 3, group C, member 1 [ NR3C1 ]) in the neonate however, most studies have been small ( n 100) and have failed to control for multiple testing in the statistical analysis. The Barwon Infant Study is a population-derived birth cohort with antenatal recruitment. Maternal depression and anxiety were assessed using the Edinburgh Postnatal Depression Scale and psychological distress using the Perceived Stress Scale. NR3C1 cord blood methylation levels were determined using Sequenom MassArray for 481 participants. Maternal psychological distress and anxiety were associated with a small increase in neonate NR3C1 methylation at specific CpG sites, thus replicating some previous findings. However, associations were only nominally significant and did not remain after correction for the number of CpG sites and exposures investigated. As the largest study to explore the relationship between maternal well-being and offspring NR3C1 cord blood methylation, our results highlight the need for caution when interpreting previous findings in this area. Future studies must ensure they are adequately powered to detect the likely small effect sizes while controlling for multiple testing.
Placental pseudo-malignancy from a DNA methylation perspective: unanswered questions and future directions
Publisher: Frontiers Media SA
Date: 2013
Prospects for Epigenetic Epidemiology
Publisher: Oxford University Press (OUP)
Date: 13-12-2008
DOI: 10.1093/AJE/KWN380
Centromere protein B null mice are mitotically and meiotically normal but have lower body and testis weights
Publisher: Rockefeller University Press
Date: 20-04-1998
Abstract: CENP-B is a constitutive centromere DNA-binding protein that is conserved in a number of mammalian species and in yeast. Despite this conservation, earlier cytological and indirect experimental studies have provided conflicting evidence concerning the role of this protein in mitosis. The requirement of this protein in meiosis has also not previously been described. To resolve these uncertainties, we used targeted disruption of the Cenpb gene in mouse to study the functional significance of this protein in mitosis and meiosis. Male and female Cenpb null mice have normal body weights at birth and at weaning, but these subsequently lag behind those of the heterozygous and wild-type animals. The weight and sperm content of the testes of Cenpb null mice are also significantly decreased. Otherwise, the animals appear developmentally and reproductively normal. Cytogenetic fluorescence-activated cell sorting and histological analyses of somatic and germline tissues revealed no abnormality. These results indicate that Cenpb is not essential for mitosis or meiosis, although the observed weight reduction raises the possibility that Cenpb deficiency may subtly affect some aspects of centromere assembly and function, and result in reduced rate of cell cycle progression, efficiency of microtubule capture, and/or chromosome movement. A model for a functional redundancy of this protein is presented.
Plasma metabolomic profiles associated with infant food allergy with further consideration of other early life factors
Publisher: Elsevier BV
Date: 08-2020
The value of twins in epigenetic epidemiology
Publisher: Oxford University Press (OUP)
Date: 09-01-2012
DOI: 10.1093/IJE/DYR179
Abstract: During past decades, twin studies have played an important role in genetic epidemiology studies of complex traits. The strength of twin studies lies in the ability to disentangle genetic and environmental factors that contribute to a phenotype, by comparing genetically identical monozygotic twins to dizygotic twins, who share on average 50% of genetic variants. Twin studies now offer the opportunity to study epigenetic variation across the genome with two aims. First, twin studies can improve our understanding of the factors regulating epigenetic variability by assessing the heritability of epigenetic variants. Secondly, the use of twins in epigenetic research is increasingly recognized as an important approach to help unravel the complexities associated with human development and disease. The strategic use of identical twins discordant for complex disease has revealed the importance of linking epigenetic disruption to the disease-associated risk in humans. Lastly, we also discuss the possibility that epigenetic effects on disease may in part explain some of the missing heritability in genome-wide association studies. The study of human epigenetic factors in twins can inform the role of genetics, as well as in utero and postnatal environments to the establishment, maintenance and functional consequences of human epigenome variation.
Gut Microbiome Composition Remains Stable in Individuals with Diabetes-Related Early to Late Stage Chronic Kidney Disease
Publisher: MDPI AG
Date: 29-12-2020
DOI: 10.3390/BIOMEDICINES9010019
Abstract: (1) Background: In iduals with diabetes and chronic kidney disease display gut dysbiosis when compared to healthy controls. However, it is unknown whether there is a change in dysbiosis across the stages of diabetic chronic kidney disease. We investigated a cross-sectional study of patients with early and late diabetes associated chronic kidney disease to identify possible microbial differences between these two groups and across each of the stages of diabetic chronic kidney disease. (2) Methods: This cross-sectional study recruited 95 adults. DNA extracted from collected stool s les were used for 16S rRNA sequencing to identify the bacterial community in the gut. (3) Results: The phylum Firmicutes was the most abundant and its mean relative abundance was similar in the early and late chronic kidney disease group, 45.99 ± 0.58% and 49.39 ± 0.55%, respectively. The mean relative abundance for family Bacteroidaceae, was also similar in the early and late group, 29.15 ± 2.02% and 29.16 ± 1.70%, respectively. The lower abundance of Prevotellaceae remained similar across both the early 3.87 ± 1.66% and late 3.36 ± 0.98% diabetic chronic kidney disease groups. (4) Conclusions: The data arising from our cohort of in iduals with diabetes associated chronic kidney disease show a predominance of phyla Firmicutes and Bacteroidetes. The families Ruminococcaceae and Bacteroidaceae represent the highest abundance, while the beneficial Prevotellaceae family were reduced in abundance. The most interesting observation is that the relative abundance of these gut microbes does not change across the early and late stages of diabetic chronic kidney disease, suggesting that this is an early event in the development of diabetes associated chronic kidney disease. We hypothesise that the dysbiotic microbiome acquired during the early stages of diabetic chronic kidney disease remains relatively stable and is only one of many risk factors that influence progressive kidney dysfunction.
The skin barrier function gene SPINK5 is associated with challenge-proven IgE-mediated food allergy in infants
Publisher: Wiley
Date: 04-04-2017
DOI: 10.1111/ALL.13143
Abstract: A defective skin barrier is hypothesized to be an important route of sensitization to dietary antigens and may lead to food allergy in some children. Missense mutations in the serine peptidase inhibitor Kazal type 5 (SPINK5) skin barrier gene have previously been associated with allergic conditions. To determine whether genetic variants in and around SPINK5 are associated with IgE-mediated food allergy. We genotyped 71 "tag" single nucleotide polymorphisms (tag-SNPs) within a region spanning ~263 kb including SPINK5 (~61 kb) in n=722 (n=367 food-allergic, n=199 food-sensitized-tolerant and n=156 non-food-allergic controls) 12-month-old infants (discovery s le) phenotyped for food allergy with the gold standard oral food challenge. Transepidermal water loss (TEWL) measures were collected at 12 months from a subset (n=150) of these in iduals. SNPs were tested for association with food allergy using the Cochran-Mantel-Haenszel test adjusting for ancestry strata. Association analyses were replicated in an independent s le group derived from four paediatric cohorts, total n=533 (n=203 food-allergic, n=330 non-food-allergic), mean age 2.5 years, with food allergy defined by either clinical history of reactivity, 95% positive predictive value (PPV) or challenge, corrected for ancestry by principal components. SPINK5 variant rs9325071 (A⟶G) was associated with challenge-proven food allergy in the discovery s le (P=.001, OR=2.95, CI=1.49-5.83). This association was further supported by replication (P=.007, OR=1.58, CI=1.13-2.20) and by meta-analysis (P=.0004, OR=1.65). Variant rs9325071 is associated with decreased SPINK5 gene expression in the skin in publicly available genotype-tissue expression data, and we generated preliminary evidence for association of this SNP with elevated TEWL also. We report, for the first time, association between SPINK5 variant rs9325071 and challenge-proven IgE-mediated food allergy.
Wheel running and environmental enrichment differentially modify exon-specific BDNF expression in the hippocampus of wild-type and pre-motor symptomatic male and female Huntington's disease mice
Publisher: Wiley
Date: 2009
DOI: 10.1002/HIPO.20658
Abstract: Brain-derived neurotrophic factor (BDNF) is an essential neurotrophin and regulation of its expression is complex due to multiple 5' untranslated exons which are separately spliced to a common coding exon to form unique mRNA transcripts. Disruption of BDNF gene expression is a key to the development of symptoms in Huntington's disease (HD), a fatal neurodegenerative condition. Abnormal epigenetic modifications are associated with reduced gene expression in late-stage HD but such regulation of BDNF gene expression has yet to be investigated. We hypothesized that BDNF gene expression is altered in the HD hippoc us of pre-motor symptomatic R6/1 transgenic HD mice, correlating with a change in the DNA methylation profile. The effects of wheel-running and environmental enrichment on wild-type mice, in association with a proposed environment-mediated correction of BDNF gene expression deficits in HD mice, were also investigated. Using real-time PCR, levels of total BDNF mRNA were found to be reduced in the hippoc us of both male and female HD mice. Wheel-running significantly increased total BDNF gene expression in all groups of mice except male HD mice. In contrast, environmental enrichment significantly increased expression only in male wild-type animals. Further quantification of BDNF exon-specific transcripts revealed sex-specific changes in relation to the effect of the HD mutation and differential effects on gene expression by wheel-running and environmental enrichment. The HD-associated reduction of BDNF gene expression was not due to increased methylation of the gene sequence. Furthermore, environment-induced changes in BDNF gene expression in the wild-type hippoc us were independent of the extent of DNA methylation. Overall, the results of this study provide new insight into the role of BDNF in HD pathogenesis in addition to the mechanisms regulating normal BDNF gene expression.
Mercy Pregnancy and Emotional Well-being Study (MPEWS): Understanding maternal mental health, fetal programming and child development. Study design and cohort profile
Publisher: Wiley
Date: 25-01-2017
DOI: 10.1002/MPR.1558
Breastfeeding and Growth of Children in the Peri/postnatal Epigenetic Twins Study (PETS)
Publisher: SAGE Publications
Date: 23-03-2016
Abstract: The prevalence of overweight infants and toddlers has increased by 60% in the past 30 years and is a significant contributor to diabetes, cardiovascular disease, and early morbidity and mortality. The World Health Organization’s updated meta-analysis in 2013 observed an association between breastfeeding and a lower prevalence of obesity later in life. The purpose of this study was to assess the growth of children in a cohort of Australian twins to examine associations between duration of breastfeeding and growth at 18 months of age. Our hypothesis is that the anthropometric measurements of the participants will be greater with shorter duration of breastfeeding. Methods include using cross-sectional data from a cohort at the 18-month visit (n = 179) in the Peri ostnatal Epigenetics Twins Study (PETS) to assess the relationship between duration of breastfeeding and infant size at 18 months of age. Inclusion criteria were birth weight of more than 2000 grams and breastfed for less than 1 month, 1 to 3 months, or 4 to 6 months. The analysis suggested that infants breastfed for 1 to 3 months were significantly larger than infants breastfed for 4 to 6 months in terms of mean body mass index (BMI) (0.61 kg/m 2 P = .02 95% confidence interval [CI], 0.17-1.05), arm circumference (0.66 cm P = .006 95% CI, 0.26-1.06), and abdominal circumference (1.16 cm P = .03 95% CI, 0.26-2.06). The analysis also suggested that infants breastfed for less than 1 month were significantly larger than infants breastfed for 4 to 6 months in terms of mean arm circumference (0.72 cm P = .009 95% CI, 0.26-1.17). Results suggest that supplementing with non–breast milk before 4 months of age was associated with an increased BMI, arm circumference, and abdominal circumference at 18 months of age. The mean BMI decreased from 85% to 65% when infants were breastfeeding for 4 to 6 months as compared to breastfeeding for 1 to 3 months. Breastfeeding for 4 to 6 months appeared to protect against the risk of obesity for the children in the PETS.
Monte Carlo analysis of neutron diffuse scattering data
Publisher: Elsevier BV
Date: 11-2006
Gut microbiota composition during infancy and subsequent behavioural outcomes.
Publisher: Elsevier BV
Date: 02-2020
Sequence analysis of an 80 kb human neocentromere
Publisher: Oxford University Press (OUP)
Date: 02-1999
DOI: 10.1093/HMG/8.2.217
Abstract: We previously described the cloning of an 80 kb DNA corresponding to the core protein-binding domain of a human chromosome 10-derived neocentromere. Here we report the complete sequence of this DNA (designated NC DNA) and its detailed structural analysis. The sequence is devoid of human centromeric alpha-satellite DNA and the pericentric beta- and gamma-satellites, the ATRS and 48 bp repeat DNA. One copy of a sequence that is related to the CENPB box motif is present, and a number of copies of other pericentric sequences including pJalpha and classical satellites I and III are present but both their relative sparsity and non-tandem organization suggest that each sequence, on its own, is unlikely to mimic any role the sequence may have in the normal centromere. The DNA-binding motifs of the architectural and regulatory proteins HMGI and topoII have a normal abundance and random distribution, implying that these sequences are not key functional elements. The total A + T content of the sequence is not notably different from that of the human genome, but an abundance of AT-rich islands and a biased distribution of these islands within the NC sequence are clearlydiscernible and may be functionally significant. Substantial amounts of transposable elements and low copy number tandem repeats, including several that are highly AT- and purine-rich, are also present and may act as functional elements. One of the AT-rich tandemrepeats (AT28) may form interesting structures and is described in detail. The defined features show only a loose resemblance to the structures of known centromeres, highlighting the possibility that, rather than a conserved primary sequence, it is the overallcomposition and distribution patterns of various unknown functional elements, or any 'ordinary' DNA under appropriate epigenetic influences, that determine centromere formation and function. This is the firstdetailed analysis of a neocentromere DNA and provides a basis for comparison against future sequences.
Epigenetic Change as the Major Mediator of Fetal Programming in Humans: Are We There Yet?
Publisher: S. Karger AG
Date: 2014
DOI: 10.1159/000365020
Abstract: The developmental origins of health and disease (DOHaD) hypothesis predicts that environmental exposures experienced early in life have the potential to modify the risk associated with later-onset disease. The DOHaD hypothesis is supported by a large number of direct animal studies and a smaller number of compelling observational studies in humans, but the mechanism(s) underlying the ‘programming' effects of DOHaD remain largely unclear. Given the inherent property of environmental sensitivity, the demonstrated role in gene regulation, and the capacity for stable maintenance over time once established, epigenetic variation has rapidly emerged as a candidate mediator of such effects. However, little direct evidence exists in humans, primarily due to the inherent problems associated with unraveling the relative contributions of genetic and environmental influences to phenotypic outcomes. Robust evidence is required in several domains to establish epigenetic variation in the causal pathway to DoHAD-associated disease. Firstly, interin idual epigenetic variability in response to specific early-life environmental exposures needs to be demonstrated. Further, compelling data linking specific epigenetic variants to specific disease(s) is needed. Epigenetic variation should be apparent in a tissue relevant to the disease of interest prior to phenotypic onset in order to avoid confounding and the potential for reverse causation. Finally, the functional relevance of specific epigenetic change must be demonstrated. Compelling evidence is mounting in each of these domains but remains somewhat fragmented, providing small pieces of the overall complex puzzle. It is likely that only large longitudinal life course studies commencing prior to birth, with extensive environmental exposure data and biospecimens, can provide direct evidence in support of a role of epigenetic processes as drivers of the DOHaD in humans.
Epigenetic deregulation in pediatric acute lymphoblastic leukemia.
Publisher: Informa UK Limited
Date: 06-01-2014
DOI: 10.4161/EPI.27585
Replication of DNA Methylation Variation Reported in Cord Blood Samples From GDM-Affected Pregnancies in Preadolescent and Adolescent Offspring of Women With GDM
Publisher: American Diabetes Association
Date: 08-03-2021
DOI: 10.2337/DC21-0248
Immuno‐epigenomic analysis identifies attenuated interferon responses in naïve CD4 T cells of adolescents with peanut and multi‐food allergy
Publisher: Wiley
Date: 11-2022
DOI: 10.1111/PAI.13890
Abstract: IgE‐mediated food allergies have been linked to suboptimal naïve CD4 T (nCD4T) cell activation in infancy, underlined by epigenetic and transcriptomic variation. Similar attenuated nCD4T cell activation in adolescents with food allergy have also been reported, but these are yet to be linked to specific epigenetic or transcriptional changes. We generated genome‐wide DNA methylation data in purified nCD4 T cells at quiescence and following activation in a cohort of adolescents (aged 10–15 years old) with peanut allergy (peanut only or peanut + ≥1 additional food allergy) (FA, n = 29), and age‐matched non‐food allergic controls (NA, n = 18). Additionally, we assessed transcriptome‐wide gene expression and cytokine production in these cells following activation. We found widespread changes in DNA methylation in both NA and FA nCD4T cells in response to activation, associated with the T cell receptor signaling pathway. Adolescents with FA exhibit unique DNA methylation signatures at quiescence and post‐activation at key genes involved in Th1/Th2 differentiation ( RUNX3 , RXRA , NFKB1A , IL4R) , including a differentially methylated region (DMR) at the TNFRSF6B promoter, linked to Th1 proliferation. Combined analysis of DNA methylation, transcriptomic data and cytokine output in the same s les identified an attenuated interferon response in nCD4T cells from FA in iduals following activation, with decreased expression of several interferon genes, including IFN‐γ and a DMR at a key downstream gene, BST2 . We find that attenuated nCD4T cell responses from adolescents with food allergy are associated with specific epigenetic variation, including disruption of interferon responses, indicating dysregulation of key immune pathways that may contribute to a persistent FA phenotype. However, we recognize the small s le size, and the consequent restraint on reporting adjusted p ‐value statistics as limitations of the study. Further study is required to validate these findings.
Comprehensive Metabolomic Profiling of Cord Blood and Placental Tissue in Surviving Monochorionic Twins Complicated by Twin-Twin Transfusion Syndrome With or Without Fetoscopic Laser Coagulation Surge
Publisher: Frontiers Media SA
Date: 12-04-2022
DOI: 10.3389/FBIOE.2022.786755
Abstract: Objectives: To investigate metabolomic perturbations caused by twin-twin transfusion syndrome, metabolic changes associated with fetoscopic laser coagulation in both placental tissue and cord plasma, and to investigate differential metabolites pertinent to varying fetal outcomes, including hemodynamic status, birth weight, and cardiac function, of live-born babies. Methods: Placental tissue and cord plasma s les from normal term or uncomplicated preterm-born monochorionic twins and those complicated by twin-twin transfusion syndrome treated with or without fetoscopic laser coagulation were analyzed by high-performance liquid chromatography metabolomic profiling. Sixteen comparisons of different co-twin groups were performed. Partial least squares–discriminant analysis, metabolic pathway analysis, biomarker analysis, and Spearman’s correlation analysis were conducted based on differential metabolites used to determine potential biomarkers in different comparisons and metabolites that are pertinent to neonatal birth weight and left ventricular ejection fraction. Results: These metabolomic investigations showed that the cord plasma metabolome has a better performance in discriminating fetuses among different hemodynamic groups than placental tissue. The metabolic alteration of twin-twin transfusion syndrome in these two types of s les centers on fatty acid and lipid metabolism. The fetoscopic laser coagulation procedure improves the metabolomic change brought by this syndrome, making the metabolomes of the treated group less distinguishable from those of the control and preterm birth groups. Certain compounds, especially lipids and lipid-like molecules, are noted to be potential biomarkers of this morbid disease and pertinent to neonatal birth weight and ejection fraction. Conclusions: Fetoscopic laser coagulation can ameliorate the metabolomic alteration caused by twin-twin transfusion syndrome in placental tissue and cord plasma, which are involved mainly in fatty acid and lipid-like molecule metabolism. Certain lipids and lipid-like molecules are helpful in differentiating co-twins of different hemodynamic statuses and are significantly correlated with neonatal birth weight or ejection fraction.
Measuring maternal body composition by biomedical impedance can predict risk for gestational diabetes mellitus: a retrospective study among 22,223 women
Publisher: Informa UK Limited
Date: 28-07-2020
DOI: 10.1080/14767058.2020.1797666
Abstract: This study aimed to identify which element of body composition measurements taken before 17th week gestation was the strongest risk factor for gestational diabetes mellitus (GDM) in Chinese pregnant women. A retrospective study was performed using data retrieved from the Electronic Medical Record database of Chongqing Health Center for Women and Children (China) from January 2014 to December 2015. A total of 22,223 women were included with singleton pregnancies and no preexisting diabetes who underwent bioelectrical impedance analysis (BIA) before 17 gestational weeks and 75-g OGTT at 24-28 gestational weeks. The prevalence of GDM from 2014 to 2015 was 27.13% (IADPSG). All indicators of BIA (total body water, fat mass, fat-free mass, percent body fat, muscle mass, visceral fat levels, proteins, bone minerals, basal metabolic rate, lean trunk mass), age, weight and body mass index (BMI) were risk factors that significantly increased the occurrence of GDM ( Visceral fat levels, bone minerals and percent body fat were significantly associated with an increased risk of GDM, providing the reference ranges of visceral fat levels, bone minerals and percent body fat as predictive factors for Chinese women to estimate the risk of GDM by BIA during pregnancy.
DNA methylation at IL32 in juvenile idiopathic arthritis
Publisher: Springer Science and Business Media LLC
Date: 09-06-2015
DOI: 10.1038/SREP11063
Abstract: Juvenile idiopathic arthritis (JIA) is the most common autoimmune rheumatic disease of childhood. We recently showed that DNA methylation at the gene encoding the pro-inflammatory cytokine interleukin-32 ( IL32 ) is reduced in JIA CD4+ T cells. To extend this finding, we measured IL32 methylation in CD4+ T-cells from an additional s le of JIA cases and age- and sex-matched controls and found a reduction in methylation associated with JIA consistent with the prior data (combined case-control dataset: 25.0% vs 37.7%, p = 0.0045). Further, JIA was associated with reduced IL32 methylation in CD8+ T cells (15.2% vs 25.5%, p = 0.034), suggesting disease-associated changes to a T cell precursor. Additionally, we measured regional SNPs, along with CD4+ T cell expression of total IL32 and the γ and β isoforms. Several SNPs were associated with methylation. Two SNPs were also associated with JIA and we found evidence of interaction such that methylation was only associated with JIA in minor allele carriers (e.g. rs10431961 p interaction = 0.011). Methylation at one measured CpG was inversely correlated with total IL32 expression (Spearman r = −0.73, p = 0.0009), but this was not a JIA-associated CpG. Overall, our data further confirms that reduced IL32 methylation is associated with JIA and that SNPs play an interactive role.
Blood Plasma Metabolites in Diabetes-Associated Chronic Kidney Disease: A Focus on Lipid Profiles and Cardiovascular Risk
Publisher: Frontiers Media SA
Date: 28-02-2022
Abstract: We investigated a cross-sectional metabolomic analysis of plasma and urine of patients with early and late stage diabetes associated chronic kidney disease (CKD), inclusive of stages 1–5 CKD, to identify potential metabolomic profiles between the two groups. This cross-sectional study recruited 119 adults. Metabolomic biomarkers were quantified in 119 non-fasted plasma and 57 urine s les using a high-throughput proton Nuclear Magnetic Resonance platform. Analyses were conducted using R with the ggforestplot package. Linear regression models were minimally adjusted for age, sex, and body mass index and p -values were adjusted for multiple comparisons using the Benjamini-Hockberg method with a false discovery rate of 0.05. Apolipoprotein A1 concentration (ApoA1) was reduced (adj. p = 0.04) and apolipoprotein B/apolipoprotein A1 ratio (ApoB/ApoA1) was increased (adj. p = 0.04) in late CKD compared with early CKD. Low-density lipoprotein triglyceride (LDL-TG) had an increased concentration (adj. p = 0.01), while concentrations of high-density lipoprotein cholesterol (HDL-C) were reduced (adj. p = 0.04) in late CKD compared to early stages of disease. Our results highlight the presence of abnormal lipid metabolism namely significant reduction in the protective ApoA1 and significant increase in atherogenic ApoB/ApoA1 ratio. The study also demonstrates significantly elevated levels of triglyceride-rich lipoproteins such as LDL-TG. We illustrate the significant reduction in protective HDL-C in in iduals with diabetic CKD. It explores a detailed plasma lipid profile that significantly differentiates between the late and early CKD groups as well as each CKD stage. The study of complex metabolite profiles may provide additional data required to enable more specific cardiovascular risk stratification.
Decreased cortical muscarinic M1 receptors in schizophrenia are associated with changes in gene promoter methylation, mRNA and gene targeting microRNA
Publisher: Springer Science and Business Media LLC
Date: 19-02-2013
DOI: 10.1038/TP.2013.3
The role of genetics and environment in the rise of childhood food allergy.
Publisher: Wiley
Date: 19-07-2012
DOI: 10.1111/J.1365-2222.2011.03823.X
Abstract: Food allergy is a growing clinical and public health problem world-wide. The rising incidence is occurring more rapidly than changes to the genome sequence would allow, but it is yet to be determined whether environmental factors might act in interaction with genetic risk. That is to say, are environmental factors more likely to affect those genetically at risk? Family history is a strong risk factor for the development of food allergy as it co-aggregates with other atopic diseases and as such genetic factors do play an important role in food allergy risk. However, significant interest has now turned to the role of epigenetic modifications of the genome as the major mediator of gene-environment interaction. The consideration of the role of epigenetics in food allergy is likely to provide an insight into aetiological and biological disease mechanisms. This paper discusses the current state of knowledge regarding genetic and environmental risk factors for food allergy, and considers the potential for furthering our understanding of food allergy aetiology by examining the role of epigenetic variation.
The effects of maternal anxiety during pregnancy on IGF2/H19 methylation in cord blood
Publisher: Springer Science and Business Media LLC
Date: 29-03-2016
DOI: 10.1038/TP.2016.32
Abstract: Compelling evidence suggests that maternal mental health in pregnancy can influence fetal development. The imprinted genes, insulin-like growth factor 2 ( IGF2 ) and H19, are involved in fetal growth and each is regulated by DNA methylation. This study aimed to determine the association between maternal mental well-being during pregnancy and differentially methylated regions (DMRs) of IGF2 (DMR0) and the IGF2/H19 imprinting control region (ICR) in newborn offspring. Maternal depression, anxiety and perceived stress were assessed at 28 weeks of pregnancy in the Barwon Infant Study ( n =576). DNA methylation was measured in purified cord blood mononuclear cells using the Sequenom MassArray Platform. Maternal anxiety was associated with a decrease in average ICR methylation (Δ=−2.23% 95% CI=−3.68 to −0.77%), and across all six of the in idual CpG units in anxious compared with non-anxious groups. Birth weight and sex modified the association between prenatal anxiety and infant methylation. When stratified into lower (⩽3530 g) and higher ( g) birth weight groups using the median birth weight, there was a stronger association between anxiety and ICR methylation in the lower birth weight group (Δ=−3.89% 95% CI=−6.06 to −1.72%), with no association in the higher birth weight group. When stratified by infant sex, there was a stronger association in female infants (Δ=−3.70% 95% CI=−5.90 to −1.51%) and no association in males. All the linear regression models were adjusted for maternal age, smoking and folate intake. These findings show that maternal anxiety in pregnancy is associated with decreased IGF2 / H19 ICR DNA methylation in progeny at birth, particularly in female, low birth weight neonates. ICR methylation may help link poor maternal mental health and adverse birth outcomes, but further investigation is needed.
The Placental Exposome: Placental Determinants of Fetal Adiposity and Postnatal Body Composition
Publisher: S. Karger AG
Date: 2013
DOI: 10.1159/000355222
Abstract: Offspring of obese and diabetic mothers are at increased risk of being born with excess adiposity as a consequence of their intrauterine environment. Excessive fetal fat accretion reflects additional placental nutrient transfer, suggesting an effect of the maternal environment on placental function. High plasma levels of particular nutrients in obese and diabetic mothers are likely to be the important drivers of nutrient transfer to the fetus, resulting in excess fat accretion. However, not all offspring of obese and diabetic mothers are born large for gestational age and the explanation may involve the regulation of placental nutrient transfer required for fetal growth. The placenta integrates maternal and fetal signals across gestation in order to determine nutrient transfer rate. Understanding the nature of these signals and placental responses to them is key to understanding the pathology of both fetal growth restriction and macrosomia. The overall effects of the maternal environment on the placenta are the product of its exposures throughout gestation, the ‘placental exposome'. Understanding these environmental influences is important as exposures early in gestation, for instance causing changes in the function of genes involved in nutrient transfer, may determine how the placenta will respond to exposures later in gestation, such as to raised maternal plasma glucose or lipid concentrations. Longitudinal studies are required which allow investigation of the influences on the placenta across gestation. These studies need to make full use of developing technologies characterising placental function, fetal growth and body composition. Understanding these processes will assist in the development of preventive strategies and treatments to optimise prenatal growth in those pregnancies at risk of either excess or insufficient nutrient supply and could also reduce the risk of chronic disease in later life.
Inference about causation between body mass index and DNA methylation in blood from a twin family study
Publisher: Cold Spring Harbor Laboratory
Date: 21-11-2017
DOI: 10.1101/223040
Abstract: Several studies have reported DNA methylation in blood to be associated with body mass index (BMI), but only a few have investigated causal aspects of the association. We used a twin family design to assess this association at two life points and applied a novel analytical approach to investigate the evidence for causality. The methylation profile of DNA from peripheral blood was measured for 479 Australian women (mean age 56 years) from 130 twin families. Linear regression was used to estimate the associations of methylation at ~410 000 cytosine-guanine dinucleotides (CpG), and of the average methylation at ~20 000 genes, with current BMI, BMI at age 18-21 years, and the change between the two (BMI change). A novel regression-based methodology for twins, Inference about Causation through Examination of Familial Confounding (ICE FALCON), was used to assess causation. At 5% false discovery rate, nine, six and 12 CpGs at 24 loci were associated with current BMI, BMI at age 18-21 years and BMI change, respectively. The average methylation of BHLHE40 and SOCS3 loci was associated with current BMI, and of PHGDH locus was associated with BMI change. From the ICE FALCON analyses with BMI as the predictor and methylation as the outcome, a woman’s methylation level was associated with her co-twin’s BMI, and the association disappeared conditioning on her own BMI, consistent with BMI causing methylation. To the contrary, using methylation as the predictor and BMI as the outcome, a woman’s BMI was not associated with her co-twin’s methylation level, consistent with methylation not causing BMI. For middle-aged women, peripheral blood DNA methylation at several genomic locations is associated with current BMI, BMI at age 18-21 years and BMI change. Our study suggests that BMI has a causal effect on peripheral blood DNA methylation.
Socioeconomic Position Is Associated With Carotid Intima–Media Thickness in Mid‐Childhood: The Longitudinal Study of Australian Children
Publisher: Ovid Technologies (Wolters Kluwer Health)
Date: 02-08-2017
Abstract: Lower socioeconomic position ( SEP ) predicts higher cardiovascular risk in adults. Few studies differentiate between neighborhood and family SEP or have repeated measures through childhood, which would inform understanding of potential mechanisms and the timing of interventions. We investigated whether neighborhood and family SEP , measured biennially from ages 0 to 1 year onward, was associated with carotid intima–media thickness ( IMT ) at ages 11 to 12 years. Data were obtained from 1477 families participating in the Child Health CheckPoint study, nested within the Longitudinal Study of Australian Children. Disadvantaged family and neighborhood SEP was cross‐sectionally associated with thicker maximum carotid IMT in separate univariable linear regression models. Associations with family SEP were not attenuated in multivariable analyses, and associations with neighborhood SEP were attenuated only in models adjusted for family SEP . The difference in maximum carotid IMT between the highest and lowest family SEP quartile measured at ages 10 to 11 years was 10.7 μm (95% CI , 3.4–18.0 P =0.004), adjusted for age, sex, pubertal status, passive smoking exposure, body mass index, blood pressure, and arterial lumen diameter. In longitudinal analyses, family SEP measured as early as age 2 to 3 years was associated with maximum carotid IMT at ages 11 to 12 years (difference between highest and lowest quartile: 8.5 μm 95% CI , 1.3–15.8 P =0.02). No associations were observed between SEP and mean carotid IMT . We report a robust association between lower SEP in early childhood and carotid IMT in mid‐childhood. Further investigation of mechanisms may inform pediatric cardiovascular risk assessment and prevention strategies.
A Potential Role for Epigenetically Mediated Trained Immunity in Food Allergy
Publisher: Elsevier BV
Date: 06-2020
Heterozygosity for the common perforin mutation, p.A91V, impairs the cytotoxicity of primary natural killer cells from healthy individuals
Publisher: Wiley
Date: 17-03-2015
DOI: 10.1038/ICB.2015.1
Abstract: The production and delivery of functional perforin (PRF PRF1 gene) by cytotoxic lymphocytes maintains immune homeostasis and tumour immune surveillance. In humans, inheritance of the common PRF1 polymorphism, p.A91V, (c.272C>T) found in 8-9% of the Caucasian population, with another mutated allele resulting in reduced PRF function or trafficking, has been shown to result in hyperinflammatory diseases and/or haematological cancers. In this study, we sought to investigate the function of p.A91V on a wild-type (WT) perforin background. We first developed an assay that distinguishes the relative levels of transcription of in idual PRF1 alleles, including p.A91V. The p.A91V allele was seen to be expressed at similar levels as the WT allele in primary human natural killer (NK) cells, ruling out that allelic expression imbalance influenced their function. We then demonstrated that the p.A91V mutation results in protein misfolding and an appreciable reduction in NK-cell cytotoxicity in healthy carriers of p.A91V. We propose that this level of cytotoxic dysfunction may readily account for the predisposition to immune-mediated disease in in iduals homozygous for p.A91V. Also, the fact that monoallelic mutations of PRF1 decrease NK-cell cytotoxicity should be considered in in iduals presenting with the manifestations of immune deficiency states that impinge on NK-cell cytotoxicity.
Innate Immune Activation and Circulating Inflammatory Markers in Preschool Children
Publisher: Frontiers Media SA
Date: 08-02-2022
DOI: 10.3389/FIMMU.2021.830049
Abstract: Early childhood is characterised by repeated infectious exposures that result in inflammatory responses by the innate immune system. In addition, this inflammatory response to infection is thought to contribute to the epidemiological evidence linking childhood infection and adult non-communicable diseases. Consequently, the relationship between innate immune responses and inflammation during early life may inform prevention of NCDs later in life. In adults, non-genetic host factors such as age, sex, and obesity, strongly impact cytokine production and circulating mediators, but data in children are lacking. Here, we assessed cytokine responses and inflammatory markers in a population of healthy preschool children (mean age 4.2 years). We studied associations between cytokines, plasma inflammatory markers and non-genetic host factors, such as sex, age, adiposity, season, and immune cell composition. Similar to adults, boys had a higher inflammatory response than girls, with IL-12p70 and IL-10 upregulated following TLR stimulation. Adiposity and winter season were associated with increased circulating inflammatory markers but not cytokine production. The inflammatory markers GlycA and hsCRP were positively associated with production of a number of cytokines and may therefore reflect innate immune function and inflammatory potential. This dataset will be informative for future prospective studies relating immune parameters to preclinical childhood NCD phenotypes.
Placental DNA methylation in pregnancies complicated by maternal diabetes and/or obesity: State of the art and research gaps
Publisher: Informa UK Limited
Date: 05-09-2022
Population-based plasma lipidomics reveals developmental changes in metabolism and signatures of obesity risk: a mother-offspring cohort study
Publisher: Springer Science and Business Media LLC
Date: 25-07-2022
DOI: 10.1186/S12916-022-02432-Y
Abstract: Lipids play a vital role in health and disease, but changes to their circulating levels and the link with obesity remain poorly characterized in expecting mothers and their offspring in early childhood. LC-MS/MS-based quantitation of 480 lipid species was performed on 2491 plasma s les collected at 4 time points in the mother-offspring Asian cohort GUSTO (Growing Up in Singapore Towards healthy Outcomes). These 4 time points constituted s les collected from mothers at 26–28 weeks of gestation ( n =752) and 4–5 years postpartum ( n =650), and their offspring at birth ( n =751) and 6 years of age ( n =338). Linear regression models were used to identify the pregnancy and developmental age-specific variations in the plasma lipidomic profiles, and their association with obesity risk. An independent birth cohort ( n =1935), the Barwon Infant Study (BIS), comprising mother-offspring dyads of Caucasian origin was used for validation. Levels of 36% of the profiled lipids were significantly higher (absolute fold change 1.5 and P adj 0.05) in antenatal maternal circulation as compared to the postnatal phase, with phosphatidylethanolamine levels changing the most. Compared to antenatal maternal lipids, cord blood showed lower concentrations of most lipid species (79%) except lysophospholipids and acylcarnitines. Changes in lipid concentrations from birth to 6 years of age were much higher in magnitude (log 2 FC=−2.10 to 6.25) than the changes observed between a 6-year-old child and an adult (postnatal mother) (log 2 FC=−0.68 to 1.18). Associations of cord blood lipidomic profiles with birth weight displayed distinct trends compared to the lipidomic profiles associated with child BMI at 6 years. Comparison of the results between the child and adult BMI identified similarities in association with consistent trends ( R 2 =0.75). However, large number of lipids were associated with BMI in adults (67%) compared to the children (29%). Pre-pregnancy BMI was specifically associated with decrease in the levels of phospholipids, sphingomyelin, and several triacylglycerol species in pregnancy. In summary, our study provides a detailed landscape of the in utero lipid environment provided by the gestating mother to the growing fetus, and the magnitude of changes in plasma lipidomic profiles from birth to early childhood. We identified the effects of adiposity on the circulating lipid levels in pregnant and non-pregnant women as well as offspring at birth and at 6 years of age. Additionally, the pediatric vs maternal overlap of the circulating lipid phenotype of obesity risk provides intergenerational insights and early opportunities to track and intervene the onset of metabolic adversities. This birth cohort is a prospective observational study, which was registered on 1 July 2010 under the identifier NCT01174875 .
Defective chromosome segregation, microtubule bundling and nuclear bridging in inner centromere protein gene (Incenp)-disrupted mice
Publisher: Oxford University Press (OUP)
Date: 07-1999
DOI: 10.1093/HMG/8.7.1145
Abstract: INCENP is a chromosomal passenger protein which relocates from the centromere to thel spindle midzone during the metaphase-anaphase transition, ultimately being discarded in the cell midbody at the completion of cytokinesis. Using homologous recombination, we have generated Incenp gene-targeted heterozygous mice that are phenotypically indistinguishable from their wild-type littermates. Intercrossing the hetero-zygotes results in no live-born homozygous Incenp -disrupted progeny, indicating an early lethality. Day 3.5 affected pre-implantation embryos contain large, morphologically abnormal cells that fail to fully develop a blastocoel cavity or thrive in utero and in culture. Chromatin and tubulin immunocytochemical stainings of these and day 2.5 affected embryos reveal a high mitotic index, no discernible metaphase or anaphase stages, complete absence of midbodies, micronuclei formation, morphologically irregular macronuclei with large chromosome complements, multipolar mitotic configurations, binucleated cells, internuclear bridges and abnormal spindle bundling. The phenotype is consistent with a defect in the modulation of microtubule dynamics, severely affecting chromosome segregation and resulting in poorly resolved chromatin masses, aberrant karyokinesis and internuclear bridge formation. These latter occurrences could pose a physical barrier blocking cytokinesis.
Low-dose aspirin for primary prevention of adverse pregnancy outcomes in twin pregnancies: an observational cohort study based on propensity score matching
Publisher: Springer Science and Business Media LLC
Date: 22-11-2021
DOI: 10.1186/S12884-021-04217-2
Abstract: Since the effectiveness of low-dose aspirin (LDA) in twin pregnancies is uncertain, we aimed to preliminarily assess whether LDA is beneficial in preventing preecl sia in twin pregnancies. This study is an observational study in two hospitals in China. Among 932 women, 277 in the First Affiliated Hospital of Chongqing Medical University were routinely treated with aspirin (100 mg daily) from 12 to 16 weeks to 35 weeks of gestational age, while 655 in Chongqing Health Center for Women and Children were not taking aspirin during pregnancy. We followed each subject and the in idual details were recorded. LDA significantly reduced the risk of preecl sia (RR 0.48 95% CI 0.24–0.95) and preterm birth 34 weeks (RR 0.50 95% CI 0.29–0.86) and showed possible benefits to lower the rate of SGA babies (RR 0.74 95% CI 0.55–1.00). Moreover, the risk of postpartum hemorrhage was not increased by LDA (RR 0.89 95% CI 0.35–2.26). Treatment with low-dose aspirin in twin pregnancies could offer some protection against adverse pregnancy outcomes in the absence of significantly increased risk of postpartum hemorrhage. Chinese Clinical Trial Registry (ChiCTR) ChiCTR-OOC-16008203 , Retrospectively registered date: April 1st, 2016
The ever growing complexity of placental epigenetics - Role in adverse pregnancy outcomes and fetal programming
Publisher: Elsevier BV
Date: 12-2012
Protocol for establishing a child and adolescent twin register for mental health research and capacity building in Sri Lanka and other low and middle-income countries in South Asia
Publisher: BMJ
Date: 10-2019
DOI: 10.1136/BMJOPEN-2019-029332
Abstract: Worldwide, 10%–20% of children and adolescents experience mental health conditions. However, most such disorders remain undiagnosed until adolescence or adulthood. Little is known about the factors that influence mental health in children and adolescents, especially in low and middle-income countries (LMIC), where environmental threats, such as poverty and war, may affect optimal neurodevelopment. Cohort studies provide important information on risks and resilience across the life course by enabling tracking of the effects of early life environment on health during childhood and beyond. Large birth cohort studies, including twin cohorts that can be aetiologically informative, have been conducted within high-income countries but are not generalisable to LMIC. There are limited longitudinal birth cohort studies in LMIC. We sought to enhance the volume of impactful research in Sri Lanka by establishing a Centre of Excellence for cohort studies. The aim is to establish a register of infant, child and adolescent twins, including mothers pregnant with twins, starting in the districts of Colombo (Western Province) and Vavuniya (Northern Province). We will gain consent from twins or parents for future research projects. This register will provide the platform to investigate the aetiology of mental illness and the impact of challenges to early brain development on future mental health. Using this register, we will be able to conduct research that will (1) expand existing research capacity on child and adolescent mental health and twin methods (2) further consolidate existing partnerships and (3) establish new collaborations. The initiative is underpinned by three pillars: high-quality research, ethics, and patient and public involvement and engagement (PPIE). Ethical approval for this study was obtained from the Ethics Review Committee of Sri Lanka Medical Association and Keele University’s Ethical Review Panel. In addition to journal publications, a range of PPIE activities have been conducted.
Inference about causation between body mass index and DNA methylation in blood from a twin family study
Publisher: Springer Science and Business Media LLC
Date: 17-05-2019
DOI: 10.1038/S41366-018-0103-4
Abstract: Several studies have reported DNA methylation in blood to be associated with body mass index (BMI), but few have investigated causal aspects of the association. We used a twin family design to assess this association at two life points and applied a novel analytical approach to appraise the evidence for causality. The methylation profile of DNA from peripheral blood was measured for 479 Australian women from 130 twin families. Linear regression was used to estimate the associations of DNA methylation at ~410,000 cytosine-guanine dinucleotides (CpGs), and of the average DNA methylation at ~20,000 genes, with current BMI, BMI at age 18-21 years, and the change between the two (BMI change). A novel regression-based methodology for twins, Inference about Causation through Examination of Familial Confounding (ICE FALCON), was used to assess causation. At a 5% false discovery rate, nine, six and 12 CpGs at 24 loci were associated with current BMI, BMI at age 18-21 years and BMI change, respectively. The average DNA methylation of the BHLHE40 and SOCS3 loci was associated with current BMI, and of the PHGDH locus with BMI change. From the ICE FALCON analyses with BMI as the predictor and DNA methylation as the outcome, a woman's DNA methylation level was associated with her co-twin's BMI, and the association disappeared after conditioning on her own BMI, consistent with BMI causing DNA methylation. To the contrary, using DNA methylation as the predictor and BMI as the outcome, a woman's BMI was not associated with her co-twin's DNA methylation level, consistent with DNA methylation not causing BMI. For middle-aged women, peripheral blood DNA methylation at several genomic locations is associated with current BMI, BMI at age 18-21 years and BMI change. Our study suggests that BMI has a causal effect on peripheral blood DNA methylation.
Phosphorylation of Yes-associated protein impairs trophoblast invasion and migration: implications for the pathogenesis of fetal growth restriction†
Publisher: Oxford University Press (OUP)
Date: 24-06-2020
Abstract: Fetal growth restriction (FGR) is a condition in which a newborn fails to achieve his or her prospective hereditary growth potential. This condition is associated with high newborn mortality, second only to that associated with premature birth. FGR is associated with maternal, fetal, and placental abnormalities. Although the placenta is considered to be an important organ for supplying nutrition for fetal growth, research on FGR is limited, and treatment through the placenta remains challenging, as neither proper uterine intervention nor its pathogenesis have been fully elucidated. Yes-associated protein (YAP), as the effector of the Hippo pathway, is widely known to regulate organ growth and cancer development. Therefore, the correlation of the placenta and YAP was investigated to elucidate the pathogenic mechanism of FGR. Placental s les from humans and mice were collected for histological and biomechanical analysis. After investigating the location and role of YAP in the placenta by immunohistochemistry, we observed that YAP and cytokeratin 7 have corresponding locations in human and mouse placentas. Moreover, phosphorylated YAP (p-YAP) was upregulated in FGR and gradually increased as gestational age increased during pregnancy. Cell function experiments and mRNA-Seq demonstrated impaired YAP activity mediated by extracellular signal-regulated kinase inhibition. Established FGR-like mice also recapitulated a number of the features of human FGR. The results of this study may help to elucidate the association of FGR development with YAP and provide an intrauterine target that may be helpful in alleviating placental dysfunction.
Vitamin D insufficiency in the first 6 months of infancy and challenge-proven IgE-mediated food allergy at 1 year of age: a case-cohort study.
Publisher: Wiley
Date: 23-02-2017
DOI: 10.1111/ALL.13122
Abstract: Ecological evidence suggests vitamin D insufficiency (VDI) due to lower ambient ultraviolet radiation (UVR) exposure may be a risk factor for IgE-mediated food allergy. However, there are no studies relating directly measured VDI during early infancy to subsequent challenge-proven food allergy. To prospectively investigate the association between VDI during infancy and challenge-proven food allergy at 1 year. In a birth cohort (n = 1074), we used a case-cohort design to compare 25-hydroxyvitamin D Within the random subcohort, VDI was present in 45% (105/233) of newborns and 24% (55/227) of infants at 6 months. Food allergy prevalence at 1 year was 7.7% (61/786), and 6.5% (53/808) were egg-allergic. There was no evidence of an association between VDI at either birth (aRR 1.25, 95% CI 0.70-2.22) or 6 months (aRR 0.93, 95% CI 0.41-2.14) and food allergy at 1 year. There was no evidence that VDI during the first 6 months of infancy is a risk factor for food allergy at 1 year of age. These findings primarily relate to egg allergy, and larger studies are required.
Investigating the impact of oral health on pregnancy and offspring outcomes: protocol for the Lifetime Impact of ORal heAlth (LIORA) cohort study
Publisher: BMJ
Date: 11-2022
DOI: 10.1136/BMJOPEN-2022-066204
Abstract: Oral health is a fundamental component of well-being, and is closely associated with overall health and quality of life. Oral health may also affect the next generation. The children of mothers with poor oral health are likely to also have poor oral health as they go through life. We aim to investigate associations between maternal oral health and general health, pregnancy outcomes, offspring oral health and offspring general health. The Lifetime Impact of Oral Health study is a prospective, observational cohort study being done at a single centre in Chongqing, China. A total of 1000 pregnant women will be recruited in their first trimester (11–14 weeks gestation). After obtaining informed consent, general and oral health assessments will be undertaken. Maternal lifestyle, demographic data and biospecimens (blood, hair, urine, nail clippings, saliva, dental plaque, buccal, vaginal and anal swabs) will be collected. Pregnancy outcomes will be recorded at the time of delivery. Cord blood and placenta s les will be collected. The offspring will be followed up for general and oral health examinations, neurodevelopmental assessments and biospecimen (dental plaque, saliva, buccal swabs, exfoliated primary dentition, urine, hair, nail clippings) collection until they are 15 years old. Biological s les will undergo comprehensive metabolomic, microbiome and epigenome analyses. Associations between maternal oral health and general health, pregnancy outcomes, offspring oral health and offspring general health will be investigated and the underlying mechanisms explored. This project has been approved by the Research Ethics Committee of the Affiliated Hospital of Stomatology of Chongqing Medical University (CQHS-REC-2021 LSNo.23). Participants will be required to provide informed consent to participate in the study. Dissemination of findings will take the form of publications in peer-reviewed journals and presentations at national and international conferences. ChiCTR2100046898.
The 10q25 neocentromere and its inactive progenitor have identical primary nucleotide sequence: Further evidence for epigenetic modification
Publisher: Cold Spring Harbor Laboratory
Date: 06-2000
DOI: 10.1101/GR.10.6.832
Abstract: We have previously localized the core centromere protein-binding domain of a 10q25.2-derived neocentromere to an 80-kb genomic region. Detailed analysis has indicated that the 80-kb neocentromere (NC) DNA has a similar overall organization to the corresponding region on a normal chromosome 10 (HC) DNA, derived from a genetically unrelated CEPH in idual. Here we report sequencing of the HC DNA and its comparison to the NC sequence. Single-base differences were observed at a maximum rate of 4.6 per kb however, no deletions, insertions, or other structural rearrangements were detected. To investigate whether the observed changes, or subsets of these, might be de novo mutations involved in neocentromerization (i.e., in committing a region of a chromosome to neocentromere formation), the progenitor DNA (PnC) from which the NC DNA descended, was cloned and sequenced. Direct comparison of the PnC and NC sequences revealed 100% identity, suggesting that the differences between NC and HC DNA are single nucleotide polymorphisms (SNPs) and that formation of the 10q25.2 NC did not involve a change in DNA sequence in the core centromere protein-binding NC region. This is the first study in which a cloned NC DNA has been compared directly with its inactive progenitor DNA at the primary sequence level. The results form the basis for future sequence comparison outside the core protein-binding domain, and provide direct support for the involvement of an epigenetic mechanism in neocentromerization. [The sequences in this paper have been submitted to GenBank under accession nos. AF222855 (not yet available) for HC AF042484 for NCI AF222854 (not yet available) for NCII and AF222856 (not yet available) for PnC.]
Time for a standardized system of reporting sites of genomic methylation
Publisher: Springer Science and Business Media LLC
Date: 30-04-2015
Epigenetic silencing of BIM in glucocorticoid poor-responsive pediatric acute lymphoblastic leukemia, and its reversal by histone deacetylase inhibition
Publisher: American Society of Hematology
Date: 21-10-2010
DOI: 10.1182/BLOOD-2010-05-284968
Abstract: Glucocorticoids play a critical role in the therapy of lymphoid malignancies, including pediatric acute lymphoblastic leukemia (ALL), although the mechanisms underlying cellular resistance remain unclear. We report glucocorticoid resistance attributable to epigenetic silencing of the BIM gene in pediatric ALL biopsies and xenografts established in immune-deficient mice from direct patient explants as well as a therapeutic approach to reverse resistance in vivo. Glucocorticoid resistance in ALL xenografts was consistently associated with failure to up-regulate BIM expression after dexamethasone exposure despite confirmation of a functional glucocorticoid receptor. Although a comprehensive assessment of BIM CpG island methylation revealed no consistent changes, glucocorticoid resistance in xenografts and patient biopsies significantly correlated with decreased histone H3 acetylation. Moreover, the histone deacetylase inhibitor vorinostat relieved BIM repression and exerted synergistic antileukemic efficacy with dexamethasone in vitro and in vivo. These findings provide a novel therapeutic strategy to reverse glucocorticoid resistance and improve outcome for high-risk pediatric ALL.
Evidence of increased DNA methylation of the androgen receptor gene in occipital hair follicles from men with androgenetic alopecia
Publisher: Oxford University Press (OUP)
Date: 24-06-2011
Cloning, expression, and promoter structure of a mammalian Inner Centromere Protein (INCENP)
Publisher: Springer Science and Business Media LLC
Date: 04-1999
Cohort Profile: The Peri/post-natal Epigenetic Twins Study
Publisher: Oxford University Press (OUP)
Date: 03-10-2011
DOI: 10.1093/IJE/DYR140
Identifying the lungs as a susceptible site for allele-specific regulatory changes associated with type 1 diabetes risk
Publisher: Springer Science and Business Media LLC
Date: 14-09-2021
DOI: 10.1038/S42003-021-02594-0
Abstract: Type 1 diabetes (T1D) etiology is complex. We developed a machine learning approach that ranked the tissue-specific transcription regulatory effects for T1D SNPs and estimated their relative contributions to conversion to T1D by integrating case and control genotypes (Wellcome Trust Case Control Consortium and UK Biobank) with tissue-specific expression quantitative trait loci (eQTL) data. Here we show an eQTL (rs6679677) associated with changes to AP4B1-AS1 transcript levels in lung tissue makes the largest gene regulatory contribution to the risk of T1D development. Luciferase reporter assays confirmed allele-specific enhancer activity for the rs6679677 tagged locus in lung epithelial cells ( i.e . A549 cells C A reduces expression, p = 0.005). Our results identify tissue-specific eQTLs for SNPs associated with T1D. The strongest tissue-specific eQTL effects were in the lung and may help explain associations between respiratory infections and risk of islet autoantibody seroconversion in young children.
Investigating the epigenetic profile of the inflammatory gene IL-6 in late-life depression
Publisher: Springer Science and Business Media LLC
Date: 25-10-2017
Investigating the potential role of genetic and epigenetic variation of DNA methyltransferase genes in hyperplastic polyposis syndrome.
Publisher: Public Library of Science (PLoS)
Date: 10-02-2011
Cross-sectional metabolic profiles of mental health in population-based cohorts of 11- to 12-year-olds and mid-life adults: The Longitudinal Study of Australian Children
Publisher: SAGE Publications
Date: 23-05-2020
Abstract: Poorer mental health in adulthood is associated with increased risk of cardiovascular disease and reduced life expectancy. However, little is known of the molecular pathways underpinning this relationship and how early in life adverse metabolite profiles relate to self-reported variation in mental health. We examined cross-sectional associations between mental health and serum metabolites indicative of cardiovascular health, in large Australian population-based cohorts at two stages of the life-course. We characterised cross-sectional serum nuclear magnetic resonance metabolite profiles of positively and negatively framed mental health in a large population-based s le of Australian 11- to 12-year-olds ( n = 1172 51% girls) and mid-life adults (n = 1322 mean age 45 years 87% women). We examined multiple standard self-report mental health scales, spanning psychosocial health, general well-being, life satisfaction, and health-related quality of life. Linear regression was used to investigate the cross-sectional association between mental health and each metabolite (n = 73) in children and adults separately, unadjusted and adjusted for age, sex, socioeconomic position and body mass index. Better child and adult mental health were associated with lower levels of the inflammatory marker glycoprotein acetyls, and a favourable, less atherogenic lipid/lipoprotein profile. Patterns of association in children were generally weaker than in adults. Associations were generally modest and partially attenuated when adjusted for body mass index. In general, metabolite profiles associated with better child and adult mental health closely aligned with those predictive of better cardiovascular health in adults. Our findings support previous evidence for the likely bidirectional relationship between mental health and cardiovascular disease risk, by extending this evidence base to the molecular level and in children.
IFPA meeting 2014 workshop report: Animal models to study pregnancy pathologies; new approaches to study human placental exposure to xenobiotics; biomarkers of pregnancy pathologies; placental genetic
Publisher: Elsevier BV
Date: 04-2015
DOI: 10.1016/J.PLACENTA.2015.01.196
Abstract: Workshops are an important part of the IFPA annual meeting as they allow for discussion of specialized topics. At IFPA meeting 2014 there were six themed workshops, five of which are summarized in this report. These workshops related to various aspects of placental biology but collectively covered areas of animal models, xenobiotics, pathological biomarkers, genetics and epigenetics, and stillbirth and fetal growth restriction.
Origins of Lifetime Health Around the Time of Conception: Causes and Consequences
Publisher: Ovid Technologies (Wolters Kluwer Health)
Date: 10-2018
Metabolic Regulation of DNA Methylation in Mammals
Publisher: Elsevier
Date: 2011
Epigenetic regulation of neurodevelopmental genes in response to in utero exposure to phthalate plastic chemicals: How can we delineate causal effects?
Publisher: Elsevier BV
Date: 07-2016
DOI: 10.1016/J.NEURO.2016.05.011
Abstract: Accumulating evidence, from animal models and human observational studies, implicates the in utero (and early postnatal) environment in the 'programming' of risk for a variety of adverse outcomes and health trajectories. The modern environment is replete with man-made compounds such as plastic product chemicals (PPC), including phenols and phthalates. Evidence from several human cohorts implicates exposure to these chemicals in adverse offspring neurodevelopment, though a direct causal relationship has not been firmly established. In this review we consider a potential causal pathway that encompasses epigenetic human variation, and how we might test this mechanistic hypothesis in human studies. In the first part of this report we outline how PPCs induce epigenetic change, focusing on the brain derived neurotrophic factor (BDNF) gene, a key regulator of neurodevelopment. Further, we discuss the role of the epigenetics of BDNF and other genes in neurodevelopment and the emerging human evidence of an association between phthalate exposure and adverse offspring neurodevelopment. We discuss aspects of epidemiological and molecular study design and analysis that could be employed to strengthen the level of human evidence to infer causality. We undertake this using an exemplar recent research ex le: maternal prenatal smoking, linked to methylation change at the aryl hydrocarbon receptor repressor (AHRR) gene at birth, now shown to mediate some of the effects of maternal smoking on birth weight. Characterizing the relationship between the modern environment and the human molecular pathways underpinning its impact on early development is paramount to understanding the public health significance of modern day chemical exposures.
Human transgenerational responses to early-life experience: potential impact on development, health and biomedical research
Publisher: BMJ
Date: 25-07-2014
Identification of Potential Biomarkers of Chronic Kidney Disease in Individuals with Diabetes: Protocol for a Cross-sectional Observational Study (Preprint)
Publisher: JMIR Publications Inc.
Date: 16-09-2019
Abstract: he importance of identifying people with diabetes and progressive kidney dysfunction relates to the excess morbidity and mortality of this group. Rates of cardiovascular disease are much higher in people with both diabetes and kidney dysfunction than in those with only one of these conditions. By the time these people are identified in current clinical practice, proteinuria and renal dysfunction are already established, limiting the effectiveness of therapeutic interventions. The identification of an epigenetic or blood metabolite signature or gut microbiome profile may identify those with diabetes at risk of progressive chronic kidney disease, in turn providing targeted intervention to improve patient outcomes. his study aims to identify potential biomarkers in people with diabetes and chronic kidney disease (CKD) associated with progressive renal injury and to distinguish between stages of chronic kidney disease. Three sources of biomarkers will be explored, including DNA methylation profiles in blood lymphocytes, the metabolomic profile of blood-derived plasma and urine, and the gut microbiome. he cross-sectional study recruited 121 people with diabetes and varying stages (stages 1-5) of chronic kidney disease. Single-point data collection included blood, urine, and fecal s les in addition to clinical data such as anthropometric measurements and biochemical parameters. Additional information obtained from medical records included patient demographics, medical comorbidities, and medications. ata collection commenced in January 2018 and was completed in June 2018. At the time of submission, 121 patients had been recruited, and 119 s les remained after quality control. There were 83 participants in the early diabetes-associated CKD group with a mean estimated glomerular filtration rate (eGFR) of 61.2 mL/min/1.73 m2 (early CKD group consisting of stage 1, 2, and 3a CKD), and 36 participants in the late diabetic CKD group with a mean eGFR of 23.9 mL/min/1.73 m2 (late CKD group, consisting of stage 3b, 4, and 5), i P /i .001. We have successfully obtained DNA for methylation and microbiome analyses using the biospecimens collected via this protocol and are currently analyzing these results together with the metabolome of this cohort of in iduals with diabetic CKD. ecent advances have improved our understanding of the epigenome, metabolomics, and the influence of the gut microbiome on the incidence of diseases such as cancers, particularly those related to environmental exposures. However, there is a paucity of literature surrounding these influencers in renal disease. This study will provide insight into the fundamental understanding of the pathophysiology of CKD in in iduals with diabetes, especially in novel areas such as epigenetics, metabolomics, and the kidney-gut axis. ERR1-10.2196/16277
Epigenetic Influences on Neurodevelopment at 11 Years of Age: Protocol for the Longitudinal Peri/Postnatal Epigenetic Twins Study at 11 Years of Age (PETS@11)
Publisher: Cambridge University Press (CUP)
Date: 12-2019
DOI: 10.1017/THG.2019.120
Abstract: Neurodevelopment is sensitive to genetic and pre ostnatal environmental influences. These effects are likely mediated by epigenetic factors, yet current knowledge is limited. Longitudinal twin studies can delineate the link between genetic and environmental factors, epigenetic state at birth and neurodevelopment later in childhood. Building upon our study of the Peri ostnatal Epigenetic Twin Study (PETS) from gestation to 6 years of age, here we describe the PETS 11-year follow-up in which we will use neuroimaging and cognitive testing to examine the relationship between early-life environment, epigenetics and neurocognitive outcomes in mid-childhood. Using a within-pair twin model, the primary aims are to (1) identify early-life epigenetic correlates of neurocognitive outcomes (2) determine the developmental stability of epigenetic effects and (3) identify modifiable environmental risk factors. Secondary aims are to identify factors influencing gut microbiota between 6 and 11 years of age to investigate links between gut microbiota and neurodevelopmental outcomes in mid-childhood. Approximately 210 twin pairs will undergo an assessment at 11 years of age. This includes a direct child cognitive assessment, multimodal magnetic resonance imaging, biological s ling, anthropometric measurements and a range of questionnaires on health and development, behavior, dietary habits and sleeping patterns. Data from complementary data sources, including the National Assessment Program — Literacy and Numeracy and the Australian Early Development Census, will also be sought. Following on from our previous focus on relationships between growth, cardiovascular health and oral health, this next phase of PETS will significantly advance our understanding of the environmental interactions that shape the developing brain.
Health and fertility of ICSI-conceived young men: study protocol
Publisher: Oxford University Press (OUP)
Date: 2020
Abstract: What are the long-term health and reproductive outcomes for young men conceived using ICSI whose fathers had spermatogenic failure (STF)? Are there epigenetic consequences of ICSI conception? Currently, little is known about the health of ICSI-conceived adults, and in particular the health and reproductive potential of ICSI-conceived men whose fathers had STF. Only one group to date has assessed semen parameters and reproductive hormones in ICSI-conceived men and suggested higher rates of impaired semen quality compared to spontaneously conceived (SC) peers. Metabolic parameters in this same cohort of men were mostly comparable. No study has yet evaluated other aspects of adult health. This cohort study aims to evaluate the general health and development (aim 1), fertility and metabolic parameters (aim 2) and epigenetic signatures (aim 3) of ICSI-conceived sons whose fathers had STF (ICSI study group). There are three age-matched control groups: ICSI-conceived sons whose fathers had obstructive azoospermia (OAZ) and who will be recruited in this study, as well as IVF sons and SC sons, recruited from other studies. Of 1112 ICSI parents including fathers with STF and OAZ, 78% (n = 867) of mothers and 74% (n = 823) of fathers were traced and contacted. Recruitment of ICSI sons started in March 2017 and will finish in July 2020. Based on preliminary participation rates, we estimate the following s le size will be achieved for the ICSI study group: mothers n = 275, fathers n = 225, sons n = 115. Per aim, the s le sizes of OAZ-ICSI (estimated), IVF and SC controls are: Aim 1—OAZ-ICSI: 28 (maternal surveys)/12 (son surveys), IVF: 352 (maternal surveys)/244 (son surveys), SC: 428 (maternal surveys)/255 (son surveys) Aim 2—OAZ-ICSI: 12, IVF: 72 (metabolic data), SC: 391 (metabolic data)/365 (reproductive data) Aim 3—OAZ-ICSI: 12, IVF: 71, SC: 292. Eligible parents are those who underwent ICSI at one of two major infertility treatment centres in Victoria, Australia and gave birth to one or more males between January 1994 and January 2000. Eligible sons are those aged 18 years or older, whose fathers had STF or OAZ, and whose parents allow researchers to approach sons. IVF and SC controls are age-matched men derived from previous studies, some from the same source population. Participating ICSI parents and sons complete a questionnaire, the latter also undergoing a clinical assessment. Outcome measures include validated survey questions, physical examination (testicular volumes, BMI and resting blood pressure), reproductive hormones (testosterone, sex hormone-binding globulin, FSH, LH), serum metabolic parameters (fasting glucose, insulin, lipid profile, highly sensitive C-reactive protein) and semen analysis. For epigenetic and future genetic analyses, ICSI sons provide specimens of blood, saliva, sperm and seminal fluid while their parents provide a saliva s le. The primary outcomes of interest are the number of mother-reported hospitalisations of the son son-reported quality of life prevalence of moderate-severe oligozoospermia (sperm concentration & million/ml) and DNA methylation profile. For each outcome, differences between the ICSI study group and each control group will be investigated using multivariable linear and logistic regression for continuous and binary outcomes, respectively. Results will be presented as adjusted odds ratios and 95% CIs. This study is funded by an Australian National Health and Medical Research Council Partnership Grant (NHMRC APP1140706) and was partially funded by the Monash IVF Research and Education Foundation. L.R. is a minority shareholder and the Group Medical Director for Monash IVF Group, and reports personal fees from Monash IVF group and Ferring Australia, honoraria from Ferring Australia, and travel fees from Merck Serono, MSD and Guerbet R.J.H. is the Medical Director of Fertility Specialists of Western Australia and has equity in Western IVF R.I.M. is a consultant for and a shareholder of Monash IVF Group and S.R.C. reports personal fees from Besins Healthcare and non-financial support from Merck outside of the submitted work. The remaining authors have no conflicts of interest to declare. Not applicable. Not applicable. Not applicable.
Cardiovascular health and retinal microvascular geometry in Australian 11-12 year-olds
Publisher: Elsevier BV
Date: 05-2020
DOI: 10.1016/J.MVR.2019.103966
Abstract: Traditional retinal microvascular parameters (smaller arteriolar and greater venular caliber) are associated with cardiovascular risk factors, pre-clinical vascular phenotypes and clinical cardiovascular events in adults. Although novel retinal microvascular geometric parameters showed analogous associations in adults, less is known whether these parameters are associated with cardiovascular health from childhood. In a population-based cross-sectional study in children (n = 1126, mean age 11.4 years, 50.3% girls), we examined associations of cardiovascular risk factors and pre-clinical arterial phenotypes with retinal geometric parameters. Cardiovascular parameters included body mass index (BMI), an inflammatory marker (GlycA), low-density lipoprotein and high-density lipoprotein (HDL) cholesterol, systolic (SBP) and diastolic blood pressure, large artery functional (pulse wave velocity, PWV and carotid arterial elasticity) and structural (carotid intima-media thickness) phenotypes. Retinal geometric parameters (fractal dimension (D
Blood DNA methylation signatures to detect dementia prior to overt clinical symptoms
Publisher: Wiley
Date: 2020
DOI: 10.1002/DAD2.12056
Epigenetics and Neonatology
Publisher: American Academy of Pediatrics (AAP)
Date: 08-2009
Abstract: Although an in idual's cells all have the same DNA, each cell type has a different pattern of active (expressed) and inactive genes. Such patterns are established or programmed during development by epigenetic modifications involving small molecules that covalently bind to specific sites in DNA or DNA-packaging proteins. The modifications regulate gene activity without changing the DNA sequence. Diet, lifestyle factors, and exposure to toxins or other adverse factors as well as random epigenetic mutations can result in de novo epigenetic modifications that may influence the course of development. The perinatal period is a time of rapid physiologic change during which some epigenetic reprogramming is likely to occur. Further, adverse events at this time may lead to epigenetic changes that have implications for future health and well-being. Evidence suggests that epigenetics plays a part in mediating effects of the perinatal environment and that such epigenetic changes may be reversed later in life. This has major implications for understanding of the cause of preterm birth as well as the consequences of prematurity.
Hypermethylation and down-regulation of DLEU2 in paediatric acute myeloid leukaemia independent of embedded tumour suppressor miR-15a/16-1
Publisher: Springer Science and Business Media LLC
Date: 2014
Vitamin D insufficiency is associated with reduced regulatory T cell frequency in food-allergic infants.
Publisher: Wiley
Date: 13-01-2020
DOI: 10.1111/PAI.13439
IFPA meeting 2015 workshop report III: nanomedicine applications and exosome biology, xenobiotics and endocrine disruptors and pregnancy, and lipid
Publisher: Elsevier BV
Date: 12-2016
DOI: 10.1016/J.PLACENTA.2016.01.003
Abstract: Workshops are an important part of the IFPA annual meeting, as they allow for discussion of specialized topics. At the IFPA meeting 2015 there were twelve themed workshops, three of which are summarized in this report. These workshops were related to various aspects of placental biology but collectively covered areas of pregnancy pathologies and placental metabolism: 1) nanomedicine applications and exosome biology 2) xenobiotics and endocrine disruptors and pregnancy 3) lipid mediators and placental function.
Characterisation of histone variant distribution in human embryonic stem cells by transfection of in vitro transcribed mRNA
Publisher: Wiley
Date: 15-07-2009
DOI: 10.1002/MRD.21077
Abstract: Recent studies, primarily in mouse embryonic stem cells, have highlighted the unique chromatin state of pluripotent stem cells, including the incorporation of histone variants into specific genomic locations, and its role in facilitating faithful expression of genes during development. However, there is little information available on the expression and subcellular localisation of histone variants in human embryonic stem cells (hESCs). In this study, we confirmed the expression of a panel of histone variant genes in several hESC lines and demonstrated the utility of transfection of in vitro transcribed, epitope-tagged mRNAs to characterise the subcellular localisation of these proteins. The subcellular localisations of variant histone H3 (CENP-A, H3.3), H2A (MACROH2A, H2AX, H2AZ, H2ABBD) and H1 (H1A, HB, H1C, H1D) were examined, revealing distinct nuclear localisation profiles for each protein. These data highlight the differences between murine (m) ESCs and hESCs, including the presence of a MACROH2A-enriched inactive X chromosome in undifferentiated XX hESC lines. We also provide the first evidence for MACROH2A accumulation on the Y-chromosome in XY hESCs.
Increased maternal non-oxidative energy metabolism mediates association between prenatal DEHP exposure and offspring ASD symptoms: a birth cohort study
Publisher: Cold Spring Harbor Laboratory
Date: 14-06-2022
DOI: 10.1101/2022.06.08.22275892
Abstract: Prenatal phthalate exposure has previously been linked to the development of autism spectrum disorder (ASD). However, the underlying biological mechanisms remain unclear. We investigated whether maternal and child central carbon metabolism is involved as part of the Barwon Infant Study, a population-based birth cohort of 1074 Australian children. We estimated phthalate daily intakes using third-trimester urinary phthalate metabolite concentrations and other relevant indices. The metabolome of maternal serum in the third trimester, cord blood at birth and child plasma at 1 year were measured by nuclear magnetic resonance. We used the Small Molecule Pathway Database and principal component analysis to construct composite metabolite scores reflecting metabolic pathways. ASD symptoms at 2 and 4 years were measured by subscales of the Child Behavior Checklist and the Strengths and Difficulties Questionnaire, respectively. Multivariable linear regression analyses demonstrated (i) associations between higher prenatal di(2-ethylhexyl) phthalate (DEHP) levels and increased activity in maternal non-oxidative energy metabolism pathways, specifically non-oxidative pyruvate metabolism and the Warburg Effect, and (ii) associations between increased activity in these pathways and increased offspring ASD symptomology at 2 and 4 years of age. Mediation analyses suggested that part of the mechanism by which higher prenatal DEHP exposure influences the development of ASD symptoms in early childhood is through a maternal metabolic shift in pregnancy towards non-oxidative energy pathways, which are inefficient compared to oxidative metabolism. Interventions targeting maternal metabolic activity in pregnancy may be beneficial in reducing the potential risk to the developing fetus.
Data Resource Profile: Melbourne Children’s LifeCourse initiative (LifeCourse)
Publisher: Oxford University Press (OUP)
Date: 10-05-2022
DOI: 10.1093/IJE/DYAC086
Validation of DNA methylation biomarkers for diagnosis of acute lymphoblastic leukemia.
Publisher: Oxford University Press (OUP)
Date: 07-2014
DOI: 10.1373/CLINCHEM.2013.219956
Abstract: DNA methylation biomarkers capable of diagnosis and subtyping have been found for many cancers. Fifteen such markers have previously been identified for pediatric acute lymphoblastic leukemia (ALL). Validation of these markers is necessary to assess their clinical utility for molecular diagnostics. Substantial efficiencies could be achieved with these DNA methylation markers for disease tracking with potential to replace patient-specific genetic testing. We evaluated DNA methylation of promoter regions of TLX3 (T-cell leukemia homeobox) and FOXE3 (forkhead box E3) in bone marrow biopsies from 197 patients classified as leukemic (n = 95) or clear of the disease (n = 102) by MALDI-TOF. Using a single nucleotide extension assay (methylSABER), we tested 10 bone marrow biopsies collected throughout the course of patient chemotherapy. Using reference materials, diagnostic thresholds and limits of detection were characterized for both methods. Reliable detection of DNA methylation of TLX3 and FOXE3 segregated ALL from those clear of disease with minimal false-negative and false-positive results. The limit of detection with MALDI-TOF was 1000–5000 copies of methylated allele. For methylSABER, the limit of detection was 10 copies of methylated TLX3, which enabled monitoring of minimal residual disease in ALL patients. Mass spectrometry procedures can be used to regionally multiplex and detect rare DNA methylation events, establish DNA methylation loci as clinically applicable biomarkers for disease diagnosis, and track pediatric ALL.
Supragingival Plaque Microbiome Ecology and Functional Potential in the Context of Health and Disease
Publisher: American Society for Microbiology
Date: 21-12-2018
Abstract: Oral health has substantial economic importance, with over $100 billion spent on dental care in the United States annually. The microbiome plays a critical role in oral health, yet remains poorly classified. To address the question of how microbial ersity and function in the oral cavities of children relate to caries diagnosis, we surveyed the supragingival plaque biofilm microbiome in 44 juvenile twin pairs. Using shotgun sequencing, we constructed a genome encyclopedia describing the core supragingival plaque microbiome. This unveiled several new previously uncharacterized but ubiquitous microbial lineages in the oral microbiome. Caries is a microbial community metabolic disorder that cannot be described by a single etiology, and our results provide the information needed for next-generation diagnostic tools and therapeutics for caries.
Distinct Patterns of Gene-Specific Methylation in Mammalian Placentas: Implications for Placental Evolution and Function
Publisher: Elsevier BV
Date: 04-2010
DOI: 10.1016/J.PLACENTA.2010.01.009
Abstract: The placenta has arisen relatively recently and is among the most rapidly evolving tissues in mammals. Several different placental barrier and structure types appear to have independently evolved common functional features. Specific patterns of gene expression that determine placental development in humans are predicted to be accompanied by specific profiles of epigenetic modification. However, the stratification of epigenetic modifications into those involved in conserved aspects of placental function, versus those involved in ergent placental features, has yet to begin. As a first step towards this goal, we have investigated the methylation status of a small number of gene-specific methylation events recently identified in human placenta, in a panel of placental tissue from baboon, marmoset, cow, cat, guinea pig and mouse. These represent disparate placental barrier types and structures. In this study we hypothesized that specific epigenetic markings may be associated with placental barrier type or function, independent of phylogeny. However, in contrast to our predictions, the majority of gene-specific methylation appears to track with phylogeny, independent of placental barrier type or other structural features. This suggests that despite the likelihood of epigenetic modification playing a role in the functioning and evolution of different placental subtypes, there is no evidence for an involvement of the gene-specific methylation profiles we have identified, in specifying these differences. Further studies, examining larger numbers of epigenetic modifications across phylogeny, are required to define the role of specific epigenetic modifications in the evolution of distinct placental structures.
Transcriptomic Remodelling of Fetal Endothelial Cells During Establishment of Inflammatory Memory
Publisher: Frontiers Media SA
Date: 19-11-2021
DOI: 10.3389/FIMMU.2021.757393
Abstract: Inflammatory memory involves the molecular and cellular ‘reprogramming’ of innate immune cells following exogenous stimuli, leading to non-specific protection against subsequent pathogen exposure. This phenomenon has now also been described in non-hematopoietic cells, such as human fetal and adult endothelial cells. In this study we mapped the cell-specific DNA methylation profile and the transcriptomic remodelling during the establishment of inflammatory memory in two distinct fetal endothelial cell types – a progenitor cell (ECFC) and a differentiated cell (HUVEC) population. We show that both cell types have a core transcriptional response to an initial exposure to a viral-like ligand, Poly(I:C), characterised by interferon responsive genes. There was also an ECFC specific response, marked by the transcription factor ELF1, suggesting a non-canonical viral response pathway in progenitor endothelial cells. Next, we show that both ECFCs and HUVECs establish memory in response to an initial viral exposure, resulting in an altered subsequent response to lipopolysaccharide. While the capacity to train or tolerize the induction of specific sets of genes was similar between the two cell types, the progenitor ECFCs show a higher capacity to establish memory. Among tolerized cellular pathways are those involved in endothelial barrier establishment and leukocyte migration, both important for regulating systemic immune-endothelial cell interactions. These findings suggest that the capacity for inflammatory memory may be a common trait across different endothelial cell types but also indicate that the specific downstream targets may vary by developmental stage.
Role of GRK2 in Trophoblast Necroptosis and Spiral Artery Remodeling: Implications for Preeclampsia Pathogenesis
Publisher: Frontiers Media SA
Date: 30-11-2021
DOI: 10.3389/FCELL.2021.694261
Abstract: Lv et al. show that trophoblastic GRK2 deficiency could promote placenta dysfunction and PE-like phenotype by activating necroptosis in trophoblasts, then inducing cytokine disturbance in circulation.
Evidence for widespread changes in promoter methylation profile in human placenta in response to increasing gestational age and environmental/stochastic factors
Publisher: Springer Science and Business Media LLC
Date: 28-10-2011
Abstract: The human placenta facilitates the exchange of nutrients, gas and waste between the fetal and maternal circulations. It also protects the fetus from the maternal immune response. Due to its role at the feto-maternal interface, the placenta is subject to many environmental exposures that can potentially alter its epigenetic profile. Previous studies have reported gene expression differences in placenta over gestation, as well as inter-in idual variation in expression of some genes. However, the factors contributing to this variation in gene expression remain poorly understood. In this study, we performed a genome-wide DNA methylation analysis of gene promoters in placenta tissue from three pregnancy trimesters. We identified large-scale differences in DNA methylation levels between first, second and third trimesters, with an overall progressive increase in average methylation from first to third trimester. The most differentially methylated genes included many immune regulators, reflecting the change in placental immuno-modulation as pregnancy progresses. We also detected increased inter-in idual variation in the third trimester relative to first and second, supporting an accumulation of environmentally induced (or stochastic) changes in DNA methylation pattern. These highly variable genes were enriched for those involved in amino acid and other metabolic pathways, potentially reflecting the adaptation of the human placenta to different environments. The identification of cellular pathways subject to drift in response to environmental influences provide a basis for future studies examining the role of specific environmental factors on DNA methylation pattern and placenta-associated adverse pregnancy outcomes.
Determinants of placental leptin receptor gene expression and association with measures at birth.
Publisher: Elsevier BV
Date: 10-2020
Mosaic inv dup(8p) marker chromosome with stable neocentromere suggests neocentromerization is a post-zygotic event
Publisher: Wiley
Date: 2001
DOI: 10.1002/1096-8628(20010722)102:1<86::AID-AJMG1390>3.0.CO;2-T
Abstract: Marker chromosomes containing active human neocentromeres have been described in in iduals where the chromosomes are non-mosaic, suggesting that they are mitotically stable, but also in in iduals where there is mosaicism, raising the possibility of neocentromere instability. We report two independently ascertained in iduals who are mosaic for a supernumerary marker chromosome, shown by reverse chromosome painting to have an 8p origin, resulting in mosaicism for tetrasomy 8p23.1-->pter in the patient. The markers have a primary constriction but show no detectable centromeric alpha-satellite DNA. The marker in Patient 1 demonstrated no centromere protein CENP-B binding, but associated with nine different functionally critical centromere proteins. Investigation of peripheral blood lymphocytes from this patient on five separate occasions over a 13-year period showed 23-46% mosaicism for the marker chromosome with no decrease in incidence. In vitro investigation of primary and secondary sub-clones of a lymphoblast cell line derived from the patient demonstrated 100% stability of the marker chromosome indicating that neocentromere instability is unlikely to be responsible for the mosaicism in the patient. This and other available data support a general model of neocentromerization as a post-zygotic event, irrespective of whether the supernumerary chromosome fragment has arisen during meiosis or post-fertilization at mitosis.
Poly(ADP-ribose) polymerase at active centromeres and neocentromeres at metaphase
Publisher: Oxford University Press (OUP)
Date: 22-01-2000
DOI: 10.1093/HMG/9.2.187
Abstract: A double-stranded 9 bp GTGAAAAAG pJ alpha sequence found in human centromeric alpha-satellite DNA and a 28 bp ATGTATATATGTGTATATAGACATAAAT tandemly repeated AT28 sequence found within a cloned neo- centromere DNA have each allowed the affinity purification of a nuclear protein that we have identified as poly(ADP-ribose) polymerase (PARP). Use of other related or unrelated oligonucleotide sequences as affinity substrates has indicated either significantly reduced or no detectable PARP purification, suggesting preferential but not absolute sequence-specific binding. Immunofluorescence analysis of human and sheep metaphase cells using a polyclonal anti-PARP antibody revealed centromeric localization of PARP, with diffuse signals also seen on the chromosome arms. Similar results were observed for mouse chromosomes except for a significantly enlarged PARP-binding region around the core centromere-active domain, suggesting possible 'spreading' of PARP into surrounding non-core centromeric domains. Enhanced PARP signals were also observed on alpha-satellite-negative human neo- centromeres and on the active but not the inactive alpha-satellite-containing centromere of a human dicentric chromosome. PARP signals were absent from the q12 heterochromatin of the Y chromosome, suggesting a correlation of PARP binding with centromere function that is independent of heterochromatic properties. Preliminary cell cycle analysis indicates detectable centromeric association of PARP during S/G(2)phase and that the total proportion of PARP that is centromeric is relatively low. Strong binding of PARP to different centromere sequence motifs may offer a versatile mechanism of mammalian centromere recognition that is independent of primary DNA sequences.
The establishment of DOHaD working groups in Australia and New Zealand
Publisher: Cambridge University Press (CUP)
Date: 27-04-2016
DOI: 10.1017/S2040174416000167
Abstract: The evidence underpinning the developmental origins of health and disease (DOHaD) is overwhelming. As the emphasis shifts more towards interventions and the translational strategies for disease prevention, it is important to capitalize on collaboration and knowledge sharing to maximize opportunities for discovery and replication. DOHaD meetings are facilitating this interaction. However, strategies to perpetuate focussed discussions and collaborations around and between conferences are more likely to facilitate the development of DOHaD research. For this reason, the DOHaD Society of Australia and New Zealand (DOHaD ANZ) has initiated themed Working Groups, which convened at the 2014–2015 conferences. This report introduces the DOHaD ANZ Working Groups and summarizes their plans and activities. One of the first Working Groups to form was the ActEarly birth cohort group, which is moving towards more translational goals. Reflecting growing emphasis on the impact of early life bio ersity – even before birth – we also have a Working Group titled Infection, inflammation and the microbiome. We have several Working Groups exploring other major non-cancerous disease outcomes over the lifespan, including Brain, behaviour and development and Obesity, cardiovascular and metabolic health. The Epigenetics and Animal Models Working Groups cut across all these areas and seeks to ensure interaction between researchers. Finally, we have a group focussed on ‘Translation, policy and communication’ which focusses on how we can best take the evidence we produce into the community to effect change. By coordinating and perpetuating DOHaD discussions in this way we aim to enhance DOHaD research in our region.
Ontogeny of circulating lipid metabolism in pregnancy and early childhood – a longitudinal population study
Publisher: eLife Sciences Publications, Ltd
Date: 02-03-2022
DOI: 10.7554/ELIFE.72779
Abstract: There is mounting evidence that in utero and early life exposures may predispose an in idual to metabolic disorders in later life and dysregulation of lipid metabolism is critical in such outcomes. However, there is limited knowledge about lipid metabolism and factors causing lipid dysregulation in early life that could result in adverse health outcomes in later life. We studied the effect of antenatal factors such as gestational age, birth weight, and mode of birth on lipid metabolism at birth changes in the circulating lipidome in the first 4 years of life and the effect of breastfeeding in the first year of life. From this study, we aim to generate a framework for deeper understanding into factors effecting lipid metabolism in early life, to provide early interventions for those at risk of developing metabolic disorders including cardiovascular diseases. We performed comprehensive lipid profiling of 1074 mother-child dyads in the Barwon Infant Study (BIS), a population-based pre-birth cohort and measured 776 distinct lipid features across 39 lipid classes using ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS). We measured lipids in 1032 maternal serum s les at 28 weeks’ gestation, 893 cord serum s les at birth, 793, 735, and 511 plasma s les at 6, 12 months, and 4 years, respectively. Cord serum was enriched with long chain poly-unsaturated fatty acids (LC-PUFAs), and corresponding cholesteryl esters relative to the maternal serum. We performed regression analyses to investigate the associations of cord serum lipid species with antenatal factors: gestational age, birth weight, mode of birth and duration of labour. The lipidome differed between mother and newborn and changed markedly with increasing child’s age. Alkenylphosphatidylethanolamine species containing LC-PUFAs increased with child’s age, whereas the corresponding lysophospholipids and triglycerides decreased. Majority of the cord serum lipids were strongly associated with gestational age and birth weight, with most lipids showing opposing associations. Each mode of birth showed an independent association with cord serum lipids. Breastfeeding had a significant impact on the plasma lipidome in the first year of life, with up to 17-fold increases in a few species of alkyldiaclylglycerols at 6 months of age. This study sheds light on lipid metabolism in infancy and early childhood and provide a framework to define the relationship between lipid metabolism and health outcomes in early childhood. This work was supported by the A*STAR-NHMRC joint call funding (1711624031).
Hyper-Inflammatory Monocyte Activation Following Endotoxin Exposure in Food Allergic Infants
Publisher: Frontiers Media SA
Date: 24-09-2020
Telomere length is reduced in 9- to 16-year-old girls exposed to gestational diabetes in utero
Publisher: Springer Science and Business Media LLC
Date: 23-01-2018
DOI: 10.1007/S00125-018-4549-7
Abstract: Shortened telomere length is a marker of cell damage and is associated with oxidative stress, chronic inflammation and metabolic disease. We hypothesised that the offspring of women with gestational diabetes mellitus (GDM) with increased risk of cardiovascular and metabolic diseases might exhibit shorter telomere length. We investigated telomere length in 439 GDM and 469 control group offspring, aged between 9 and 16 years, recruited from the Danish National Birth Cohort. Relative telomere length was measured in peripheral blood DNA (n = 908) using a quantitative PCR approach. Multivariate regression analysis was used to investigate the association between mothers' GDM status and telomere length in the offspring. Female offspring had longer telomeres than males. Offspring of mothers with GDM had significantly shorter telomere length than control offspring, but this difference was observed only in girls. There was a negative association between telomere length and GDM exposure among the female offspring (14% shorter telomeres, p = 0.003) following adjustment for the age of the offspring. Telomere length in female offspring was negatively associated with fasting insulin levels and HOMA-IR (p = 0.03). Maternal age, smoking, gestational age, birthweight and the offspring's anthropometric characteristics were not associated with telomere length (p ≥ 0.1). The 9- to 16-year-old girls of mothers with GDM had shorter telomeres than those from the control population. Further studies are needed to understand the extent to which shortened telomere length predicts and/or contributes to the increased risk of disease later in life among the offspring of women with GDM.
Maternal prenatal gut microbiota composition predicts child behaviour
Publisher: Elsevier BV
Date: 06-2021
Characteristics of DNA methylation and gene expression in regulatory features on the Infinium 450k Beadchip
Publisher: Cold Spring Harbor Laboratory
Date: 25-11-2015
DOI: 10.1101/032862
Abstract: Understanding the relationship between variations in DNA methylation and gene expression has been challenging. Evidence suggests the function of DNA methylation may vary with genomic context, and few consistent rules linking methylation to expression have been noted. For array-based studies, the content of current DNA methylation array platforms provide broad coverage of the genome but target only a fraction of the potentially methylated CG dinucleotides. A better understanding of the interplay between DNA methylation and gene expression is beneficial for users of these platforms, and may aid with candidate prioritization in epigenome-wide association studies (EWAS). To address this we examined the relationship between DNA methylation levels and gene expression in primary T-lymphocytes at discreet genomic regions around the transcriptional unit (Promoters, gene body, untranslated regions) and at CpG island-associated regions (islands, shores and shelves), stratifying by high and low expressed genes. As anticipated we found evidence that DNA methylation at CpG sites near promoter regions are tightly correlated with gene expression in both the stably expressed and developmentally regulated genes, however this is dependent on CpG density. DNA methylation within the gene body was not consistently associated with changes in gene expression. CpG islands and island shores exhibited strong correlations with gene expression, but this was not true for island shelves. We found these relationships were generally preserved at both dynamic and steady state genes, with some notable exceptions. In combination these insights may be useful for prioritising candidates identified in epigenome-wide association studies for subsequent functional studies.
Assessing Local Structure in PbZn1/3Nb2/3O3 Using Diffuse Scattering and Reverse Monte Carlo Refinement
Publisher: Springer Science and Business Media LLC
Date: 20-10-2012
Rodents on a high-fat diet born to mothers with gestational diabetes exhibit sex-specific lipidomic changes in reproductive organs
Publisher: China Science Publishing & Media Ltd.
Date: 05-2022
DOI: 10.3724/ABBS.2022052
Abstract: Maternal gestatonal diabetes mellitus (GDM) and offspring high-fat diet (HFD) have been shown to have sex-specific detrimental effects on the health of the offspring. Maternal GDM combined with an offspring HFD alters the lipidomic profiles of offspring reproductive organs with sex hormones and increases insulin signaling, resulting in offspring obesity and diabetes. The pre-pregnancy maternal GDM mice model is established by feeding maternal C57BL/6 mice and their offspring are fed with either a HFD or a low-fat diet (LFD). Testis, ovary and liver are collected from offspring at 20 weeks of age. The lipidomic profiles of the testis and ovary are characterized using gas chromatography-mass spectrometry. Male offspring following a HFD have elevated body weight. In reproductive organs and hormones, male offspring from GDM mothers have decreased testes weights and testosterone levels, while female offspring from GDM mothers show increased ovary weights and estrogen levels. Maternal GDM aggravates the effects of an offspring HFD in male offspring on the AKT pathway, while increasing the risk of developing inflammation when expose to a HFD in female offspring liver. Testes are prone to the effect of maternal GDM, whereas ovarian metabolite profiles are upregulated in maternal GDM and downregulated in offspring following an HFD. Maternal GDM and an offspring HFD have different metabolic effects on offspring reproductive organs, and PUFAs may protect against detrimental outcomes in the offspring, such as obesity and diabetes.
Children and Adults in a Household Cohort Study Have Robust Longitudinal Immune Responses Following SARS-CoV-2 Infection or Exposure
Publisher: Frontiers Media SA
Date: 13-10-2021
DOI: 10.3389/FIMMU.2021.741639
Abstract: Children have reduced severity of COVID-19 compared to adults and typically have mild or asymptomatic disease. The immunological mechanisms underlying these age-related differences in clinical outcomes remain unexplained. Here, we quantify 23 immune cell populations in 141 s les from children and adults with mild COVID-19 and their PCR-negative close household contacts at acute and convalescent time points. Children with COVID-19 displayed marked reductions in myeloid cells during infection, most prominent in children under the age of five. Recovery from infection in both children and adults was characterised by the generation of CD8 T CM and CD4 T CM up to 9 weeks post infection. SARS-CoV-2-exposed close contacts also had immunological changes over time despite no evidence of confirmed SARS-CoV-2 infection on PCR testing. This included an increase in low-density neutrophils during convalescence in both exposed children and adults, as well as increases in CD8 T CM and CD4 T CM in exposed adults. In comparison to children with other common respiratory viral infections, those with COVID-19 had a greater change in innate and T cell-mediated immune responses over time. These findings provide new mechanistic insights into the immune response during and after recovery from COVID-19 in both children and adults.
Maternal inflammatory and omega-3 fatty acid pathways mediate the association between socioeconomic disadvantage and childhood cognition
Publisher: Elsevier BV
Date: 02-2022
DOI: 10.1016/J.BBI.2021.12.002
Abstract: Poor cognitive outcomes in early childhood predict poor educational outcomes and diminished health over the life course. We sought to investigate (i) whether maternal metabolites predict child cognition, and (ii) if maternal metabolomic profile mediates the relationship between environmental exposures and child cognition. Metabolites were measured using nuclear magnetic resonance-based metabolomics in pregnant women from a population-derived birth cohort. Child cognition was measured at age 2 years. In 662 mother-child pairs, elevated inflammatory markers (β = -2.62 95% CI -4.10, -1.15 P = 0.0005) and lower omega-3 fatty acid-related metabolites (β = 0.49 95% CI 0.09, 0.88 P = 0.02) in the mother were associated with lower child cognition and partially mediated the association between lower child cognition and multiple risk factors common to socioeconomic disadvantage. Modifying maternal prenatal metabolic pathways related to inflammation and omega-3 fatty acids may offset the adverse associations between prenatal risk factors related to socioeconomic disadvantage and low child cognition.
Epigenetic programming underpins B‐cell dysfunction in peanut and multi‐food allergy
Publisher: Wiley
Date: 2021
DOI: 10.1002/CTI2.1324
Abstract: Rates of IgE‐mediated food allergy (FA) have increased over the last few decades, and mounting evidence implicates disruption of epigenetic profiles in various immune cell types in FA development. Recent data implicate B‐cell dysfunction in FA however, few studies have examined epigenetic changes within these cells. We assessed epigenetic and transcriptomic profiles in purified B cells from adolescents with FA, comparing single‐food‐allergic (peanut only), multi‐food‐allergic (peanut and ≥1 other food) and non‐allergic (control) in iduals. Adolescents represent a phenotype of persistent and severe FA indicative of a common immune deviation. We identified 144 differentially methylated probes (DMPs) and 116 differentially expressed genes (DEGs) that distinguish B cells of in iduals with FA from controls, including differential methylation of the PM20D1 promoter previously associated with allergic disorders. Subgroup comparisons found 729 DMPs specific to either single‐food‐ or multi‐food‐allergic in iduals, suggesting epigenetic distinctions between allergy groups. This included two regions with increased methylation near three S100 genes in multi‐food‐allergic in iduals. Ontology results of DEGs specific to multi‐food‐allergic in iduals revealed enrichment of terms associated with myeloid cell activation. Motif enrichment analysis of promoters associated with DMPs and DEGs showed differential enrichment for motifs recognised by transcription factors regulating B‐ and T‐cell development, B‐cell lineage determination and TGF‐β signalling pathway between the multi‐food‐allergic and single‐food‐allergic groups. Our data highlight epigenetic changes in B cells associated with peanut allergy, distinguishing features of the epigenome between single‐food‐ and multi‐food‐allergic in iduals and revealing differential developmental pathways potentially underpinning these distinct phenotypes.
The importance of the intrauterine environment in shaping the human neonatal epigenome
Publisher: Future Medicine Ltd
Date: 02-2013
DOI: 10.2217/EPI.12.77
Human centromeres and neocentromeres show identical distribution patterns of > 20 functionally important kinetochore-associated proteins
Publisher: Oxford University Press (OUP)
Date: 22-01-2000
DOI: 10.1093/HMG/9.2.175
Abstract: Using combined immunofluorescence and fluorescence in situ hybridization (FISH) analysis we have extensively characterized the proteins associating with two different homologue human neocentromeres at interphase and prometaphase/metaphase, and compared these directly with those found with normal human centromeres. Antisera to CENP-A, CENP-B, CENP-C, CENP-E, CENP-F, INCENP, CLIP-170, dynein, dynactin subunits p150 (Glued) and Arp1, MCAK, Tsg24, p55CDC, HZW10, HBUB1, HBUBR1, BUB3, MAD2, ERK1, 3F3/2, topoisomerase II and a murine HP1 homologue, M31, were used in immuno-fluorescence experiments in conjunction with FISH employing specific DNA probes to clearly identify neocentromeric DNA. We found that except for the total absence of CENP-B binding, neocentromeres are indistinguishable from their alpha satellite-containing counterparts in terms of protein composition and distribution. This suggests that the DNA base of a potential centromeric locus is of minimal importance in determining the overall structure of a functional kinetochore and that, once seeded, the events leading to functional kinetochore formation occur independently of primary DNA sequence.
Diet quality trajectories and cardiovascular phenotypes/metabolic syndrome risk by 11–12 years
Publisher: Springer Science and Business Media LLC
Date: 06-04-2021
DOI: 10.1038/S41366-021-00800-X
Abstract: To investigate associations between early-life diet trajectories and preclinical cardiovascular phenotypes and metabolic risk by age 12 years. Participants were 1861 children (51% male) from the Longitudinal Study of Australian Children. At five biennial waves from 2-3 to 10-11 years: Every 2 years from 2006 to 2014, diet quality scores were collected from brief 24-h parent/self-reported dietary recalls and then classified using group-based trajectory modeling as 'never healthy' (7%), 'becoming less healthy' (17%), 'moderately healthy' (21%), and 'always healthy' (56%). At 11-12 years: During children's physical health Child Health CheckPoint (2015-2016), we measured cardiovascular functional (resting heart rate, blood pressure, pulse wave velocity, carotid elasticity/distensibility) and structural (carotid intima-media thickness, retinal microvasculature) phenotypes, and metabolic risk score (composite of body mass index z-score, systolic blood pressure, high-density lipoproteins cholesterol, triglycerides, and glucose). Associations were estimated using linear regression models (n = 1100-1800) adjusted for age, sex, and socioeconomic position. Compared to 'always healthy', the 'never healthy' trajectory had higher resting heart rate (2.6 bpm, 95% CI 0.4, 4.7) and metabolic risk score (0.23, 95% CI 0.01, 0.45), and lower arterial elasticity (-0.3% per 10 mmHg, 95% CI -0.6, -0.1) and distensibility (-1.2%, 95% CI -1.9, -0.5) (all effect sizes 0.3-0.4). Heart rate, distensibility, and diastolic blood pressure were progressively poorer for less healthy diet trajectories (linear trends p ≤ 0.02). Effects for systolic blood pressure, pulse wave velocity, and structural phenotypes were less evident. Children following the least healthy diet trajectory had poorer functional cardiovascular phenotypes and metabolic syndrome risk, including higher resting heart rate, one of the strongest precursors of all-cause mortality. Structural phenotypes were not associated with diet trajectories, suggesting the window to prevent permanent changes remains open to at least late childhood.
Gender Affirming Hormone Therapy induces specific DNA methylation changes in blood
Publisher: Cold Spring Harbor Laboratory
Date: 06-07-2021
DOI: 10.1101/2021.07.05.21260016
Abstract: DNA methylation is an epigenetic mark that is influenced by underlying genetic profile, environment, and aging. It also plays a key role in female-specific X-chromosome silencing in mammals. In addition to X-linked DNA methylation, sex-specific methylation patterns are widespread across autosomal chromosomes and can be present from birth or arise over time. In in iduals where gender identity and sex assigned at birth are markedly and consistently incongruent, as in the case of transgender people, feminization or masculinization may be sought through gender affirming hormone therapy (GAHT). In this study we profiled genome-wide DNA methylation in blood of transgender women and transgender men, before and during GAHT (6 months and 12 months into hormone treatment). We identified several thousand differentially methylated CpG sites (DMPs) in both people undergoing feminizing and masculinizing hormone therapy, the vast majority of which were progressive changes over time. Sex-specific DNA methylation patterns established in early development are largely refractory to change in association with GAHT. The small number of sex-DMPs that were affected by GAHT were those that become sex-specific during the lifetime, known as sex-and-age DMPs.
Does inflammation mediate the association between obesity and hearing status in mid-childhood and mid-life?
Publisher: Springer Science and Business Media LLC
Date: 26-02-2022
DOI: 10.1038/S41366-022-01080-9
Abstract: Obesity is characterized by heightened inflammation, and both phenotypes are associated with hearing loss. We aimed to determine if inflammation mediates the associations between obesity and hearing ability in mid-childhood and mid-life. Participants: 1165 11- to 12-year-old children and 1316 parents in the population-based cross-sectional Child Health CheckPoint within the Longitudinal Study of Australian Children. Adiposity measures: Body mass index (BMI) classified as normal, overweight and obesity waist-to-height ratio (WHtR) classified as <0.5 and ≥0.5 fat mass index. Inflammatory biomarkers: Serum glycoprotein A (GlycA) high-sensitivity C-reactive protein (hsCRP). Audiometry: Composite high Fletcher Index (mean threshold of 1, 2, 4 kHz) in the better ear. Causal mediation analysis decomposed a 'total effect' (obesity on hearing status) into 'indirect' effect via a mediator (eg GlycA, hsCRP) and 'direct' effect via other pathways, adjusting for age, sex and socioeconomic position. Compared to adults with BMI within the normal range, those with obesity had hearing thresholds 1.9 dB HL (95% CI 1.0-2.8) higher on the high Fletcher Index 40% of the total effect was mediated via GlycA (indirect effect: 0.8 dB HL, 95% CI 0.1-1.4). Children with obesity had hearing thresholds 1.3 dB HL (95% CI 0.2-2.5) higher than those with normal BMI, of which 67% (indirect effect: 0.9 dB HL, 95% CI 0.4-1.4) was mediated via GlycA. Similar mediation effects were noted using other adiposity measures. Similar but less marked mediation effects were observed when hsCRP was used as the inflammatory biomarker (6-23% in adults and 23-33% in children). Inflammation may play an important mediating role in the modest hearing reductions associated with obesity, particularly in children. These findings offer insights into possible mechanisms and early prevention strategies for hearing loss.
The relationship between hair metabolites, air pollution exposure and gestational diabetes mellitus: A longitudinal study from pre-conception to third trimester
Publisher: Frontiers Media SA
Date: 02-12-2022
DOI: 10.3389/FENDO.2022.1060309
Abstract: Gestational diabetes mellitus (GDM) is a metabolic condition defined as glucose intolerance with first presentation during pregnancy. Many studies suggest that environmental exposures, including air pollution, contribute to the pathogenesis of GDM. Although hair metabolite profiles have been shown to reflect pollution exposure, few studies have examined the link between environmental exposures, the maternal hair metabolome and GDM. The aim of this study was to investigate the longitudinal relationship (from pre-conception through to the third trimester) between air pollution exposure, the hair metabolome and GDM in a Chinese cohort. A total of 1020 women enrolled in the Complex Lipids in Mothers and Babies (CLIMB) birth cohort were included in our study. Metabolites from maternal hair segments collected pre-conception, and in the first, second, and third trimesters were analysed using gas chromatography-mass spectrometry (GC-MS). Maternal exposure to air pollution was estimated by two methods, namely proximal and land use regression (LUR) models, using air quality data from the air quality monitoring station nearest to the participant’s home. Logistic regression and mixed models were applied to investigate associations between the air pollution exposure data and the GDM associated metabolites. Of the 276 hair metabolites identified, the concentrations of fourteen were significantly different between GDM cases and non-GDM controls, including some amino acids and their derivatives, fatty acids, organic acids, and exogenous compounds. Three of the metabolites found in significantly lower concentrations in the hair of women with GDM (2-hydroxybutyric acid, citramalic acid, and myristic acid) were also negatively associated with daily average concentrations of PM 2.5 , PM 10 , SO 2 , NO 2 , CO and the exposure estimates of PM 2.5 and NO 2, and positively associated with O 3 . This study demonstrated that the maternal hair metabolome reflects the longitudinal metabolic changes that occur in response to environmental exposures and the development of GDM.
Accelerated Epigenetic Aging in Peripheral Blood does not Predict Dementia Risk
Publisher: Bentham Science Publishers Ltd.
Date: 05-2021
DOI: 10.2174/1567205018666210823100721
Abstract: There is strong evidence that epigenetic age acceleration is associated with increased risk of later-life diseases and all-cause mortality. However, there is currently limited evidence that suggests accelerated epigenetic age is associated with dementia risk. This study aims to clarify whether epigenetic biomarkers of accelerated aging can predict dementia risk, which is an important consideration as aging is the greatest risk factor for the disease. DNA methylation was measured in peripheral blood s les provided by 160 participants from the ASPirin in Reducing Events in the Elderly study, including 73 pre-symptomatic dementia cases and 87 controls matched for age, sex, and smoking and education status. Epigenetic age was calculated using Horvath, Hannum, GrimAge and PhenoAge DNA methylation clocks, and age acceleration (the disparity between chronological age and epigenetic age) was determined. There was no difference in age acceleration between dementia cases and controls. In males, only Hannum’s intrinsic epigenetic age acceleration was increased in pre-symptomatic dementia cases compared to controls (Δ +1.8 years, p = 0.03). These findings provide no strong evidence that accelerated epigenetic aging measured in peripheral blood can predict dementia risk.
Plasma B Vitamers: Population Epidemiology and Parent-Child Concordance in Children and Adults.
Publisher: MDPI AG
Date: 02-03-2021
DOI: 10.3390/NU13030821
Abstract: Scope: B vitamers are co-enzymes involved in key physiological processes including energy production, one-carbon, and macronutrient metabolism. Studies profiling B vitamers simultaneously in parent–child dyads are scarce. Profiling B vitamers in parent–child dyads enables an insightful determination of gene–environment contributions to their circulating concentrations. We aimed to characterise: (a) parent–child dyad concordance, (b) generation (children versus adults), (c) age (within the adult subgroup (age range 28–71 years)) and (d) sex differences in plasma B vitamer concentrations in the CheckPoint study of Australian children. Methods and Results: 1166 children (11 ± 0.5 years, 51% female) and 1324 parents (44 ± 5.1 years, 87% female) took part in a biomedical assessment of a population-derived longitudinal cohort study: The Growing Up in Australia’s Child Health CheckPoint. B vitamer levels were quantified by UHPLC/MS-MS. B vitamer levels were weakly concordant between parent–child pairs (10–31% of variability explained). All B vitamer concentrations exhibited generation-specificity, except for flavin mononucleotide (FMN). The levels of thiamine, pantothenic acid, and 4-pyridoxic acid were higher in male children, and those of pantothenic acid were higher in male adults compared to their female counterparts. Conclusion: Family, age, and sex contribute to variations in the concentrations of plasma B vitamers in Australian children and adults.
Changing genetic architecture of body mass index from infancy to early adulthood: an individual based pooled analysis of 25 twin cohorts
Publisher: Springer Science and Business Media LLC
Date: 09-08-2022
DOI: 10.1038/S41366-022-01202-3
Abstract: Body mass index (BMI) shows strong continuity over childhood and adolescence and high childhood BMI is the strongest predictor of adult obesity. Genetic factors strongly contribute to this continuity, but it is still poorly known how their contribution changes over childhood and adolescence. Thus, we used the genetic twin design to estimate the genetic correlations of BMI from infancy to adulthood and compared them to the genetic correlations of height. We pooled in idual level data from 25 longitudinal twin cohorts including 38,530 complete twin pairs and having 283,766 longitudinal height and weight measures. The data were analyzed using Cholesky decomposition offering genetic and environmental correlations of BMI and height between all age combinations from 1 to 19 years of age. The genetic correlations of BMI and height were stronger than the trait correlations. For BMI, we found that genetic correlations decreased as the age between the assessments increased, a trend that was especially visible from early to middle childhood. In contrast, for height, the genetic correlations were strong between all ages. Age-to-age correlations between environmental factors shared by co-twins were found for BMI in early childhood but disappeared altogether by middle childhood. For height, shared environmental correlations persisted from infancy to adulthood. Our results suggest that the genes affecting BMI change over childhood and adolescence leading to decreasing age-to-age genetic correlations. This change is especially visible from early to middle childhood indicating that new genetic factors start to affect BMI in middle childhood. Identifying mediating pathways of these genetic factors can open possibilities for interventions, especially for those children with high genetic predisposition to adult obesity.
Epigenetic Patterns in Five-Year-Old Children Exposed to a Low Glycemic Index Dietary Intervention during Pregnancy: Results from the ROLO Kids Study
Publisher: MDPI AG
Date: 24-11-2020
DOI: 10.3390/NU12123602
Abstract: A range of in utero and early-life factors can influence offspring epigenetics, particularly DNA methylation patterns. This study aimed to investigate the influence of a dietary intervention and factors in pregnancy on offspring epigenetic profile at five years of age. We also explored associations between body composition and methylation profile in a cross-sectional analysis. Sixty-three five-year-olds were selected from the ROLO Kids Study, a Randomized controlled trial Of a LOw glycemic index dietary intervention from the second trimester of pregnancy. DNA methylation was investigated in 780,501 CpG sites in DNA isolated from saliva. Principal component analysis identified no association between maternal age, weight, or body mass index (BMI) during pregnancy and offspring DNA methylation (p 0.01). There was no association with the dietary intervention during pregnancy, however, gene pathway analysis identified functional clusters involved in insulin secretion and resistance that differed between the intervention and control. There were no associations with child weight or adiposity at five years of age however, change in weight from six months was associated with variation in methylation. We identified no evidence of long-lasting influences of maternal diet or factors on DNA methylation at age five years. However, changes in child weight were associated with the methylome in childhood.
Causes of variation in epigenetic aging across the lifespan
Publisher: Cold Spring Harbor Laboratory
Date: 15-05-2020
DOI: 10.1101/2020.05.10.20097030
Abstract: Background DNA methylation-based biological age (DNAm age) is potentially an important biomarker for adult health. Studies in specific age ranges have found widely varying results about its causes of variation. We investigated these causes across the lifespan. Methods We pooled genome-wide DNA methylation data for 4,217 people aged 0-92 years from 1,871 families. DNAm age was calculated using the Horvath epigenetic clock. We estimated familial correlations in DNAm age for monozygotic (MZ) twin, dizygotic (DZ) twin, sibling, parent-offspring, and spouse pairs by cohabitation status. Genetic and environmental variance component models were fitted and compared. Results Twin pair correlations were -0.12 to 0.18 around birth, not different from zero (all P .29). For all pairs of relatives, their correlations increased with time spent living together (all P .02) at different rates (MZ DZ and siblings arent-offspring P .001) and decreased with time spent living apart (P=0.02) at similar rates. These correlation patterns were best explained by cohabitation-dependent shared environmental factors, the effects of which were 1.41 (95% confidence interval [CI], 1.16 to 1.66) times greater for MZ pairs than for DZ and sibling pairs, and the latter were 2.03 (95% CI, 1.13 to 9.47) times greater than for parent-offspring pairs. Genetic factors explained 13% (95% CI, -10% to 35%) of variation (P=0.27). Conclusion Variation in DNAm age is mostly caused by environmental factors, including those shared to different extents by relatives while living together and whose effects persist into old age. The equal environment assumption of the classic twin study might not hold for epigenetic aging.
Amplification of the PLAG-family genes-PLAGL1 and PLAGL2-is a key feature of the novel tumor type CNS embryonal tumor with PLAGL amplification.
Publisher: Springer Science and Business Media LLC
Date: 27-11-2022
DOI: 10.1007/S00401-022-02516-2
Abstract: Pediatric central nervous system (CNS) tumors represent the most common cause of cancer-related death in children aged 0–14 years. They differ from their adult counterparts, showing extensive clinical and molecular heterogeneity as well as a challenging histopathological spectrum that often impairs accurate diagnosis. Here, we use DNA methylation-based CNS tumor classification in combination with copy number, RNA-seq, and ChIP-seq analysis to characterize a newly identified CNS tumor type. In addition, we report histology, patient characteristics, and survival data in this tumor type. We describe a biologically distinct pediatric CNS tumor type ( n = 31 cases) that is characterized by focal high-level lification and resultant overexpression of either PLAGL1 or PLAGL2 , and an absence of recurrent genetic alterations characteristic of other pediatric CNS tumor types. Both genes act as transcription factors for a regulatory subset of imprinted genes (IGs), components of the Wnt/β-Catenin pathway, and the potential drug targets RET and CYP2W1 , which are also specifically overexpressed in this tumor type. A derived PLAGL-specific gene expression signature indicates dysregulation of imprinting control and differentiation/development. These tumors occurred throughout the neuroaxis including the cerebral hemispheres, cerebellum, and brainstem, and were predominantly composed of primitive embryonal-like cells lacking robust expression of markers of glial or neuronal differentiation (e.g., GFAP, OLIG2, and synaptophysin). Tumors with PLAGL1 lification were typically diagnosed during adolescence (median age 10.5 years), whereas those with PLAGL2 lification were diagnosed during early childhood (median age 2 years). The 10-year overall survival was 66% for PLAGL1 - lified tumors, 25% for PLAGL2 - lified tumors, 18% for male patients, and 82% for female patients. In summary, we describe a new type of biologically distinct CNS tumor characterized by PLAGL1/2 lification that occurs predominantly in infants and toddlers ( PLAGL2 ) or adolescents ( PLAGL1 ) which we consider best classified as a CNS embryonal tumor and which is associated with intermediate survival. The cell of origin and optimal treatment strategies remain to be defined.
Variable promoter methylation contributes to differential expression of key genes in human placenta-derived venous and arterial endothelial cells
Publisher: Springer Science and Business Media LLC
Date: 15-07-2013
Abstract: The endothelial compartment, comprising arterial, venous and lymphatic cell types, is established prenatally in association with rapid phenotypic and functional changes. The molecular mechanisms underpinning this process in utero have yet to be fully elucidated. The aim of this study was to investigate the potential for DNA methylation to act as a driver of the specific gene expression profiles of arterial and venous endothelial cells. Placenta-derived venous and arterial endothelial cells were collected at birth prior to culturing. DNA methylation was measured at ,000 CpG sites in parallel with expression measurements taken from 25,000 annotated genes. A consistent set of genomic loci was found to show coordinate differential methylation between the arterial and venous cell types. This included many loci previously not investigated in relation to endothelial function. An inverse relationship was observed between gene expression and promoter methylation levels for a limited subset of genes implicated in endothelial function, including NOS3 , encoding endothelial Nitric Oxide Synthase. Endothelial cells derived from the placental vasculature at birth contain widespread methylation of key regulatory genes. These are candidates involved in the specification of different endothelial cell types and represent potential target genes for environmentally mediated epigenetic disruption in utero in association with cardiovascular disease risk later in life.
Sex- and tissue-specific effects of binge-level prenatal alcohol consumption on DNA methylation at birth
Publisher: Future Medicine Ltd
Date: 12-2021
Abstract: Background: Binge-level prenatal alcohol exposure (PAE) causes developmental abnormalities, which may be mediated in part by epigenetic mechanisms. Despite this, few studies have characterised the association of binge PAE with DNA methylation in offspring. Methods: We investigated the association between binge PAE and genome-wide DNA methylation profiles in a sex-specific manner in neonatal buccal and placental s les. Results: We identified no differentially methylated CpGs or differentially methylated regions (DMRs) at false discovery rate .05. However, using a sum-of-ranks approach, we identified a DMR in each tissue of female offspring. The DMR identified in buccal s les is located near regions with previously-reported associations to fetal alcohol spectrum disorder (FASD) and binge PAE. Conclusion: Our findings warrant further replication and highlight a potential epigenetic link between binge PAE and FASD.
Maternal prenatal stress and its effects on primary pregnancy outcomes in twin pregnancies
Publisher: Informa UK Limited
Date: 08-05-2019
Biological underpinnings of trauma and post-traumatic stress disorder: focusing on genetics and epigenetics
Publisher: Future Medicine Ltd
Date: 11-2016
Abstract: Certain in iduals are more susceptible to stress and trauma, as well as the physical and mental health consequences following such exposure, including risk for post-traumatic stress disorder (PTSD). This differing vulnerability is likely to be influenced by genetic predisposition and specific characteristics of the stress itself (nature, intensity and duration), as well as epigenetic mechanisms. In this review we provide an overview of research findings in this field. We highlight some of the key genetic risk factors identified for PTSD, and the evidence that epigenetic processes might play a role in the biological response to trauma, as well as being potential biomarkers of PTSD risk. We also discuss important considerations for future research in this area.
Glycoprotein acetyls (GlycA) at 12 months are associated with high-sensitivity C-reactive protein and early life inflammatory immune measures
Publisher: Springer Science and Business Media LLC
Date: 26-01-2019
Active transcription and essential role of RNA polymerase II at the centromere during mitosis
Publisher: Proceedings of the National Academy of Sciences
Date: 20-01-2012
Abstract: Transcription of the centromeric regions has been reported to occur in G1 and S phase in different species. Here, we investigate whether transcription also occurs and plays a functional role at the mammalian centromere during mitosis. We show the presence of actively transcribing RNA polymerase II (RNAPII) and its associated transcription factors, coupled with the production of centromere satellite transcripts at the mitotic kinetochore. Specific inhibition of RNAPII activity during mitosis leads to a decrease in centromeric α-satellite transcription and a concomitant increase in anaphase-lagging cells, with the lagging chromosomes showing reduced centromere protein C binding. These findings demonstrate an essential role of RNAPII in the transcription of α-satellite DNA, binding of centromere protein C, and the proper functioning of the mitotic kinetochore.
Association of assisted reproductive technology with offspring growth and adiposity from infancy to early adulthood
Publisher: Cold Spring Harbor Laboratory
Date: 21-03-2022
DOI: 10.1101/2022.03.20.22272579
Abstract: People conceived using assisted reproductive technology (ART) make up an increasing proportion of the world’s population, and their numbers are expected to continue rising. Investigate association of ART conception with growth and adiposity outcomes from infancy to early adulthood in offspring from a large multinational multi-cohort study. 26 population-based cohort studies. Europe, Asia-Pacific, and North America Infants, children, adolescents, and young adults born from 1984 to 2018, with mean ages at assessment of growth/adiposity outcomes ranging from 0.6 month to 27.4 years. Conception by ART (conventional in vitro fertilisation and intracytoplasmic sperm injection) versus natural conception (NC). Length/height, weight, and body mass index (BMI). Each cohort was analysed separately with adjustment for maternal BMI, age, smoking, education, parity, ethnicity, and offspring sex and age. Cohort results were combined in random effects meta-analysis for thirteen age groups. Up to 158,066 offspring (4,329 conceived by ART) were included in each age-group meta-analysis 47.6% to 60.6% were female. Compared with NC, ART-conceived offspring were slightly shorter, lighter, and thinner from infancy to early adolescence. The differences in growth/adiposity outcomes were largest at the youngest ages and attenuated with older child age, e.g., adjusted standardised mean differences (95% confidence intervals) in offspring weight at age ‘ months’, ‘17 to 23 months’, ‘6 to 9 years’, and ‘14 to 17 years’ were -0.27 standard deviation (SD) units (−0.39 to -0.16), -0.16SD (−0.22 to -0.09), -0.07SD (−0.10 to -0.04), and -0.02SD (−0.15 to 0.12), respectively. There was no evidence that results were driven by parental subfertility or of difference between conventional in vitro fertilisation and intracytoplasmic sperm injection however, smaller offspring size appeared to be limited to offspring conceived by fresh but not frozen embryo transfer, compared with NC. More marked but less precise differences were observed for body fat measurements. There was imprecise evidence that offspring conceived by ART may develop greater adiposity by early adulthood. People conceiving or conceived by ART can be reassured that differences in early growth and adiposity are small and no longer evident by late adolescence. Is conception by assisted reproductive technology associated with growth and adiposity from infancy to early adulthood? In this multi-cohort study of up to 158,066 European, Asian-Pacific, and Canadian infants, children, adolescents, and young adults, those conceived using assisted reproductive technology were on average shorter, lighter, and thinner from infancy up to early adolescence when compared with their naturally conceived peers though differences were small across all ages and reduced with older age. Parents conceiving or hoping to conceive through assisted reproductive technology and their offspring should be reassured that differences in early life growth and adiposity are small and no longer apparent by late adolescence.
Early life affects late-life health through determining DNA methylation across the lifespan: A twin study
Publisher: Elsevier BV
Date: 03-2022
The Metabolic Signatures of Surviving Cotwins in Cases of Single Intrauterine Fetal Death During Monochorionic Diamniotic Pregnancy: A Prospective Case-Control Study
Publisher: Frontiers Media SA
Date: 08-04-2022
DOI: 10.3389/FMOLB.2022.799902
Abstract: Introduction: Single intrauterine fetal death (sIUFD) in monochorionic diamniotic (MCDA) twin pregnancy may be associated with adverse clinical outcomes and possible metabolic changes in the surviving co-twin. Metabolomic profiling has not been undertaken before in these complex twin pregnancies. Methods: In this prospectively collected case-control study, three cross-cohort comparisons were made between sIUFD MCDA ( n = 16), uncomplicated MCDA ( n = 16, eight pairs), and uncomplicated singleton pregnancies ( n = 8). To identify major sources of variation within the sIUFD MCDA cohort, a secondary comparison was conducted between spontaneous sIUFD ( n = 8) and sIUFD in MCDA twins due to selective termination of a single abnormal fetus by radiofrequency ablation (RFA) ( n = 8). Metabolomics analysis of placental tissue and umbilical cord plasma was performed using LC-MS profiling. The underlying metabolic networks and pathways were analyzed by web-based platforms. Associations and statistical correlations of all identified differential metabolites with neonatal birthweight and birth length were assessed by multivariable linear regression, adjusted for maternal age and gestation. Results: Across four comparisons, 131 and 111 differential metabolites were identified in placental tissue and cord plasma, respectively, with the highest variation seen between the spontaneous vs. single-induced IUFD in MCDA twins by RFA in the cord plasma. Conversely, the number of viable fetuses and the presence of sIUFD in MCDA twins had the highest impact on metabolite variation in placental tissue. Compounds correlated with fetal growth including placental acylcarnitines and gangliosides, along with specific amino acids (e.g., histidinyl-hydroxyproline), xenobiotics and biliverdin in cord plasma. Conclusion: sIUFD in MCDA twin pregnancy correlates with distinctive metabolic signatures, mostly in fatty acyls and complex lipids, in placental tissue and cord plasma of the surviving cotwin. Some metabolites are also associated with fetal growth.
IFPA Meeting 2012 Workshop Report II: Epigenetics and imprinting in the placenta, growth factors and villous trophoblast differentiation, role of the placenta in regulating fetal exposure to xenobioti
Publisher: Elsevier BV
Date: 03-2013
Telomere length: population epidemiology and concordance in Australian children aged 11–12 years and their parents
Publisher: BMJ
Date: 07-2019
DOI: 10.1136/BMJOPEN-2017-020263
Abstract: To (1) describe the epidemiology of child and adult telomere length, and (2) investigate parent–child telomere length concordance. Population-based cross-sectional study within the Longitudinal Study of Australian Children. Assessment centres in seven major Australian cities and eight selected regional towns February 2015 to March 2016. Of 1874 participating families, telomere data were available for analysis for 1206 children and 1343 parents, of whom 1143 were parent–child pairs. There were 589 boys and 617 girls 175 fathers and 1168 mothers. Relative telomere length (T/S ratio), calculated by comparing telomeric DNA (T) level with the single copy (S) beta-globin gene in venous blood-derived genomic DNA by quantitative real-time PCR. Mean T/S ratio for all children, boys and girls was 1.09 (SD 0.56), 1.05 (SD 0.53) and 1.13 (SD 0.59), respectively. Mean T/S ratio for all parents, fathers and mothers was 0.81 (SD 0.37), 0.82 (SD 0.36) and 0.81 (SD 0.38), respectively. Parent–child T/S ratio concordance was moderate (correlation 0.24). In adjusted regression models, one unit higher parent T/S ratio was associated with 0.36 (estimated linear regression coefficient (β) 95% CI 0.28 to 0.45) higher child T/S ratio. Concordance was higher in the youngest parent-age tertile (β 0.49 95% CI 0.34 to 0.64) compared with the middle (β 0.35 95% CI 0.21 to 0.48) and oldest tertile (β 0.26 95% CI 0.11 to 0.41 p-trend 0.04). Father–child concordance was 0.34 (95% CI 0.18 to 0.48), while mother–child was 0.22 (95% CI 0.17 to 0.28). We provide telomere length population values for children aged 11–12 years and their mid-life parents. Relative telomere length was shorter in adults than children, as expected. There was modest evidence of parent–child concordance, which diminished with increasing parent age.
Integrated genomic analysis of relapsed childhood acute lymphoblastic leukemia reveals therapeutic strategies
Publisher: American Society of Hematology
Date: 10-11-2011
DOI: 10.1182/BLOOD-2011-04-345595
Abstract: Despite an increase in survival for children with acute lymphoblastic leukemia (ALL), the outcome after relapse is poor. To understand the genetic events that contribute to relapse and chemoresistance and identify novel targets of therapy, 3 high-throughput assays were used to identify genetic and epigenetic changes at relapse. Using matched diagnosis/relapse bone marrow s les from children with relapsed B-precursor ALL, we evaluated gene expression, copy number abnormalities (CNAs), and DNA methylation. Gene expression analysis revealed a signature of differentially expressed genes from diagnosis to relapse that is different for early ( 36 months) and late (≥ 36 months) relapse. CNA analysis discovered CNAs that were shared at diagnosis and relapse and others that were new lesions acquired at relapse. DNA methylation analysis found increased promoter methylation at relapse. There were many genetic alterations that evolved from diagnosis to relapse, and in some cases these genes had previously been associated with chemoresistance. Integration of the results from all 3 platforms identified genes of potential interest, including CDKN2A, COL6A2, PTPRO, and CSMD1. Although our results indicate that a ersity of genetic changes are seen at relapse, integration of gene expression, CNA, and methylation data suggest a possible convergence on the WNT and mitogen-activated protein kinase pathways.
Post-transcriptional down regulation of ICAM-1 in feto-placental endothelium in GDM
Publisher: Informa UK Limited
Date: 03-03-2016
Longitudinal Study of Oral Microbiome Variation in Twins
Publisher: Springer Science and Business Media LLC
Date: 14-05-2020
DOI: 10.1038/S41598-020-64747-1
Abstract: Humans are host to a multitude of microorganisms that rapidly populate the body at birth, subject to a complex interplay that is dependent on host genetics, lifestyle, and environment. The host-associated microbiome, including the oral microbiome, presents itself in a complex ecosystem important to health and disease. As the most common chronic disease globally, dental caries is induced by host-microbial dysbiosis in children and adults. Multiple biological and environmental factors are likely to impact disease predisposition, onset, progression, and severity, yet longitudinal studies able to capture these influences are missing. To investigate how host genetics and environment influenced the oral microbial communities over time, we profiled supragingival plaque microbiomes of dizygotic and monozygotic twins during 3 visits over 12-months. Dental plaque DNA s les were lified by targeting the 16S rRNA gene V4 region, and microbial findings were correlated with clinical, diet and genetic metadata. We observed that the oral microbiome variances were shaped primarily by the environment when compared to host genetics. Among the environmental factors shaping microbial changes of our subjects, significant metadata included age of the subject, and the age by which subjects initiated brushing habits, and the types of actions post-brushing. Relevant heritability of the microbiome included Actinomyces and Capnocytophaga in monozygotic twins and Kingella in dizygotic twins. Corynebacterium and Veillonella abundances were associated with age, whereas Aggregatibacter was associated with younger subjects. Streptococcus abundance showed an inverse association over time, and Selenomonas abundances increased with brushing frequency per day. Unraveling the exact biological mechanisms in caries has the potential to reveal novel host-microbial biomarkers, pathways, and targets important to effective preventive measures, and early disease control in children.
The newborn metabolome: associations with gestational diabetes, sex, gestation, birth mode, and birth weight (Oct, 10.1038/s41390-021-01672-7, 2021)
Publisher: Springer Science and Business Media LLC
Date: 29-10-2022
Placenta-specific Methylation of the Vitamin D 24-Hydroxylase Gene
Publisher: Elsevier BV
Date: 05-2009
The Power of Two: Epigenetics and Twins
Publisher: Cambridge University Press (CUP)
Date: 12-2015
DOI: 10.1017/THG.2015.90
Stress-sensitive neurosignalling in depression: An integrated network biology approach to candidate gene selection for genetic association analysis
Publisher: Hindawi Limited
Date: 26-07-2012
DOI: 10.4081/MI.2012.E21
Abstract: Genetic risk for depressive disorders is poorly understood despite consistent suggestions of a high heritable component. Most genetic studies have focused on risk associated with single variants, a strategy which has so far only yielded small (often non-replicable) risks for depressive disorders. In this paper we argue that more substantial risks are likely to emerge from genetic variants acting in synergy within and across larger neurobiological systems (polygenic risk factors). We show how knowledge of major integrated neurobiological systems provides a robust basis for defining and testing theoretically defensible polygenic risk factors. We do this by describing the architecture of the overall stress response . Maladaptation via impaired stress responsiveness is central to the aetiology of depression and anxiety and provides a framework for a systems biology approach to candidate gene selection. We propose principles for identifying genes and gene networks within the neurosystems involved in the stress response and for defining polygenic risk factors based on the neurobiology of stress-related behaviour. We conclude that knowledge of the neurobiology of the stress response system is likely to play a central role in future efforts to improve genetic prediction of depression and related disorders.
DNA methylation of amino acid transporter genes in the human placenta
Publisher: Elsevier BV
Date: 12-2017
Prenatal exposure to phthalates and peripheral blood and buccal epithelial DNA methylation in infants: An epigenome-wide association study
Publisher: Elsevier BV
Date: 05-2022
DOI: 10.1016/J.ENVINT.2022.107183
Abstract: Prenatal exposure to phthalates has been associated with adverse health and neurodevelopmental outcomes. DNA methylation (DNAm) alterations may be a mechanism underlying these effects, but prior investigations of prenatal exposure to phthalates and neonatal DNAm profiles are limited to placental tissue and umbilical cord blood. Conduct an epigenome-wide association study (EWAS) of the associations between prenatal exposure to phthalates and DNAm in two accessible infant tissues, venous buffy coat blood and buccal epithelial cells (BECs). Participants included 152 maternal-infant pairs from the Alberta Pregnancy Outcomes and Nutrition (APrON) study. Maternal second trimester urine s les were analyzed for nine phthalate metabolites. Blood (n = 74) or BECs (n = 78) were collected from 3-month-old infants and profiled for DNAm using the Infinium HumanMethylation450 (450K) BeadChip. Robust linear regressions were used to investigate the associations between high (HMWPs) and low molecular weight phthalates (LMWPs) and change in methylation levels at variable Cytosine-phosphate-Guanine (CpG) sites in infant tissues, as well as the sensitivity of associations to potential confounders. One candidate CpG in gene RNF39 reported by a previous study examining prenatal exposure to phthalates and cord blood DNAm was replicated. The EWAS identified 12 high-confidence CpGs in blood and another 12 in BECs associated with HMWPs and/or LMWPs. Prenatal exposure to bisphenol A (BPA) associated with two of the CpGs associated with HMWPs in BECs. Prenatal exposure to phthalates was associated with DNAm variation at CpGs annotated to genes associated with endocrine hormone activity (i.e., SLCO4A1, TPO), immune pathways and DNA damage (i.e., RASGEF1B, KAZN, HLA-A, MYO18A, DIP2C, C1or109), and neurodevelopment (i.e., AMPH, NOTCH3, DNAJC5). Future studies that characterize the stability of these associations in larger s les, multiple cohorts, across tissues, and investigate the potential associations between these biomarkers and relevant health and neurodevelopmental outcomes are needed.
IFPA Meeting 2010 Workshop Report I: Immunology; Ion transport; Epigenetics; Vascular reactivity; Epitheliochorial placentation; Proteomics
Publisher: Elsevier BV
Date: 03-2011
DOI: 10.1016/J.PLACENTA.2010.12.019
Abstract: Workshops are an important part of the IFPA annual meeting. At IFPA Meeting 2010 there were twelve themed workshops, six of which are summarized in this report. 1. The immunology workshop focused on normal and pathological functions of the maternal immune system in pregnancy. 2. The transport workshop dealt with regulation of ion and water transport across the syncytiotrophoblast of human placenta. 3. The epigenetics workshop covered DNA methylation and its potential role in regulating gene expression in placental development and disease. 4. The vascular reactivity workshop concentrated on methodological approaches used to study placental vascular function. 5. The workshop on epitheliochorial placentation covered current advances from in vivo and in vitro studies of different domestic species. 6. The proteomics workshop focused on a variety of techniques and procedures necessary for proteomic analysis and how they may be implemented for placental research.
The metabolic health of young men conceived using intracytoplasmic sperm injection
Publisher: Oxford University Press (OUP)
Date: 27-09-2022
Abstract: Is the metabolic health of men conceived using ICSI different to that of IVF and spontaneously conceived (SC) men? ICSI-conceived men aged 18–24 years, compared with SC controls, showed differences in some metabolic parameters including higher resting diastolic blood pressure (BP) and homeostasis model assessment for insulin resistance (HOMA-IR) scores, although the metabolic parameters of ICSI- and IVF-conceived singleton men were more comparable. Some studies suggest that IVF-conceived offspring may have poorer cardiovascular and metabolic profiles than SC children. Few studies have examined the metabolic health of ICSI-conceived offspring. This cohort study compared the metabolic health of ICSI-conceived men to IVF-conceived and SC controls who were derived from prior cohorts. Participants included 121 ICSI-conceived men (including 100 singletons), 74 IVF-conceived controls (all singletons) and 688 SC controls (including 662 singletons). Resting systolic and diastolic BP (measured using an automated sphygmomanometer), height, weight, BMI, body surface area and fasting serum metabolic markers including fasting insulin, glucose, total cholesterol, high-density lipoprotein cholesterol (HDLC), low-density lipoprotein cholesterol, triglycerides, highly sensitive C-reactive protein (hsCRP) and HOMA-IR were compared between groups. Data were analysed using multivariable linear regression adjusted for various covariates including age and education level. After adjusting for covariates, compared to 688 SC controls, 121 ICSI-conceived men had higher diastolic BP (β 4.9, 95% CI 1.1–8.7), lower fasting glucose (β −0.7, 95% CI −0.9 to −0.5), higher fasting insulin (ratio 2.2, 95% CI 1.6–3.0), higher HOMA-IR (ratio 1.9, 95% CI 1.4–2.6), higher HDLC (β 0.2, 95% CI 0.07–0.3) and lower hsCRP (ratio 0.4, 95% CI 0.2–0.7) levels. Compared to 74 IVF-conceived singletons, only glucose differed in the ICSI-conceived singleton men (β −0.4, 95% CI −0.7 to −0.1). No differences were seen in the paternal infertility subgroups. The recruitment rate of ICSI-conceived men in this study was low and potential for recruitment bias exists. The ICSI-conceived men, the IVF-conceived men and SC controls were from different cohorts with different birth years and different geographical locations. Assessment of study groups and controls was not contemporaneous, and the measurements differed for some outcomes (BP, insulin, glucose, lipids and hsCRP). These observations require confirmation in a larger study with a focus on potential mechanisms. Further efforts to identify whether health differences are due to parental characteristics and/or factors related to the ICSI procedure are also necessary. This study was funded by an Australian National Health and Medical Research Council Partnership Grant (NHMRC APP1140706) and was partially funded by the Monash IVF Research and Education Foundation. S.R.C. was supported through an Australian Government Research Training Program Scholarship. R.J.H. is supported by an NHMRC project grant (634457), and J.H. and R.I.M. have been supported by the NHMRC as Senior and Principal Research Fellows respectively (J.H. fellowship number: 1021252 R.I.M. fellowship number: 1022327). L.R. is a minority shareholder and the Group Medical Director for Monash IVF Group, and reports personal fees from Monash IVF Group and Ferring Australia, honoraria from Ferring Australia and travel fees from Merck Serono and MSD and Guerbet R.J.H. is the Medical Director of Fertility Specialists of Western Australia and has equity in Western IVF R.I.M. is a consultant for and shareholder of Monash IVF Group and S.R.C. reports personal fees from Besins Healthcare and nonfinancial support from Merck outside of the submitted work. The remaining authors have no conflicts of interest to declare. N/A.
Paediatric leukaemia DNA methylation profiling using MBD enrichment and SOLiD sequencing on archival bone marrow smears.
Publisher: Oxford University Press (OUP)
Date: 18-03-2015
Physical activity and adiposity in preschool children: The Barwon Infant Study
Publisher: Wiley
Date: 29-09-2022
DOI: 10.1111/IJPO.12853
Abstract: The association between physical activity and adiposity in preschool‐aged children is unclear. To assess the cross‐sectional association between objectively measured physical activity and body fat in preschool‐aged children. In the preschool review in an Australian birth cohort study ( n = 1074), mean duration and time accumulated in ≥1‐min bouts of physical activity at light‐intensity (LPA), moderate‐ to vigorous‐intensity (MVPA) and light‐ to vigorous‐intensity (LMVPA) were computed from accelerometer (ActiGraph GT3X+) data. Percent body fat was assessed by bioelectrical impedance. Associations between physical activity and percent body fat were examined by multiple regression, adjusted for accelerometer wear time, MVPA (in analyses of LPA), maternal body mass index (BMI) and maternal education. A total of 450 participants ( n = 450) had valid data. There was evidence of associations between physical activity and adiposity: each additional hour of LVPA was associated with 0.6% (CI 95 –0.2%, 1.3%) higher body fat ≥1‐min bouts of LPA was associated with 1.0% (CI 95 0.1%, 1.9%) higher body fat each additional hour of MVPA was associated with −0.8% (CI 95 −1.6%, −0.1%) less body fat and ≥1‐min bouts of MVPA was associated with −1.3% (CI 95 −2.5%, −0.1%) body fat. Among a cohort of preschool‐aged children, there was evidence that more intensive physical activity assessed by an accelerometer is associated with reduced body fat.
Insufficient sleep during infancy is correlated with excessive weight gain in childhood: a longitudinal twin cohort study
Publisher: American Academy of Sleep Medicine (AASM)
Date: 11-2021
DOI: 10.5664/JCSM.9350
The CODATwins Project: The Cohort Description of Collaborative Project of Development of Anthropometrical Measures in Twins to Study Macro-Environmental Variation in Genetic and Environmental Effects on Anthropometric Traits
Publisher: Cambridge University Press (CUP)
Date: 27-05-2015
DOI: 10.1017/THG.2015.29
Abstract: For over 100 years, the genetics of human anthropometric traits has attracted scientific interest. In particular, height and body mass index (BMI, calculated as kg/m 2 ) have been under intensive genetic research. However, it is still largely unknown whether and how heritability estimates vary between human populations. Opportunities to address this question have increased recently because of the establishment of many new twin cohorts and the increasing accumulation of data in established twin cohorts. We started a new research project to analyze systematically (1) the variation of heritability estimates of height, BMI and their trajectories over the life course between birth cohorts, ethnicities and countries, and (2) to study the effects of birth-related factors, education and smoking on these anthropometric traits and whether these effects vary between twin cohorts. We identified 67 twin projects, including both monozygotic (MZ) and dizygotic (DZ) twins, using various sources. We asked for in idual level data on height and weight including repeated measurements, birth related traits, background variables, education and smoking. By the end of 2014, 48 projects participated. Together, we have 893,458 height and weight measures (52% females) from 434,723 twin in iduals, including 201,192 complete twin pairs (40% monozygotic, 40% same-sex dizygotic and 20% opposite-sex dizygotic) representing 22 countries. This project demonstrates that large-scale international twin studies are feasible and can promote the use of existing data for novel research purposes.
Genetic and environmental factors affecting birth size variation: a pooled individual-based analysis of secular trends and global geographical differences using 26 twin cohorts
Publisher: Oxford University Press (OUP)
Date: 19-05-2018
DOI: 10.1093/IJE/DYY081
Diabetes in pregnancy and epigenetic mechanisms—how the first 9 months from conception might affect the child's epigenome and later risk of disease
Publisher: Elsevier BV
Date: 10-2019
Population epidemiology and concordance for plasma amino acids and precursors in 11-12-year-old children and their parents.
Publisher: Springer Science and Business Media LLC
Date: 11-02-2021
DOI: 10.1038/S41598-020-80923-9
Abstract: Amino acid (AA) concentrations are influenced by both exogenous (e.g. diet, lifestyle) and endogenous factors (e.g. genetic, transcriptomic, epigenetic, and metabolomic). Fasting plasma AA profiles in adulthood are predictive of diabetes risk over periods of up to 12 years. Data on AA profiles in cross-generational cohorts, including in iduals from shared gene-environment settings are scarce, but would allow the identification of the contribution of heritable and environmental factors characterising the levels of circulating AAs. This study aimed to investigate parent–child (familial dyad) concordance, absolute differences between generations- (children versus adults), age- (in adults: 28–71 years), and sex-dependent differences in plasma AA concentrations. Plasma AA concentrations were measured by UHPLC/MS–MS in 1166 children [mean (SD) age 11 (0.5) years, 51% female] and 1324 of their parents [44 (5.1) years, 87% female]. AA concentrations were variably concordant between parents and their children (5–41% of variability explained). Most AA concentrations were higher in adults than children, except for the non-essential AAs arginine, aspartic acid, glutamine, hydroxy-proline, proline, and serine. Male adults and children typically had higher AA concentrations than females. The exceptions were alanine, glutamine, glycine, hydroxy-proline, serine, and threonine in girls and glycine and serine in women. Age, sex, and shared familial factors are important determinants of plasma AA concentrations.
IFPA Meeting 2010 Workshops Report II: Placental pathology; Trophoblast invasion; Fetal sex; Parasites and the placenta; Decidua and embryonic or fetal loss; Trophoblast differentiation and syncytiali
Publisher: Elsevier BV
Date: 03-2011
Genetic and environmental effects on body mass index from infancy to the onset of adulthood: an individual-based pooled analysis of 45 twin cohorts participating in the COllaborative project of Develo
Publisher: Elsevier BV
Date: 08-2016
X-ray diffuse scattering from HMTA: Analysis via a Monte Carlo model
Publisher: International Union of Crystallography (IUCr)
Date: 14-06-2008
DOI: 10.1107/S0108768108010604
Abstract: Hexamethylenetetramine (HMT, C 6 H 12 N 4 , also referred to as urotropin) and azelaic acid [A, HOOC—(CH 2 ) 7 —COOH] form a co-crystal or adduct (HMTA, also referred to as urotropin azelate) which exhibits several structural phases as a function of temperature. At room temperature, the structure is orthorhombic, but shows substantial disorder. Here, this disorder is explored by analyzing the diffuse scattering from single crystals of HMTA via Monte Carlo simulation. The disorder is in part occupational, with two orientations of azelaic acid occurring, and in part thermally induced, which is to say dynamic. The occupational disorder can be thought of as a combination of limited-range in-plane ( bc plane) negative correlations combined with effectively zero correlation between planes (along a ), rather like stacking faults. Size effect, the cross-correlation between molecular orientation and displacement from average position, is required to reproduce the observed diffuse scattering.
Differential network analysis of oral microbiome metatranscriptomes identifies community scale metabolic restructuring in dental caries
Publisher: Oxford University Press (OUP)
Date: 18-10-2022
DOI: 10.1093/PNASNEXUS/PGAC239
Abstract: Dental caries is a microbial disease and the most common chronic health condition, affecting nearly 3.5 billion people worldwide. In this study, we used a multiomics approach to characterize the supragingival plaque microbiome of 91 Australian children, generating 658 bacterial and 189 viral metagenome-assembled genomes with transcriptional profiling and gene-expression network analysis. We developed a reproducible pipeline for clustering s le-specific genomes to integrate metagenomics and metatranscriptomics analyses regardless of bios le overlap. We introduce novel feature engineering and compositionally-aware ensemble network frameworks while demonstrating their utility for investigating regime shifts associated with caries dysbiosis. These methods can be applied when differential abundance modeling does not capture statistical enrichments or the results from such analysis are not adequate for providing deeper insight into disease. We identified which organisms and metabolic pathways were central in a coexpression network as well as how these networks were rewired between caries and caries-free phenotypes. Our findings provide evidence of a core bacterial microbiome that was transcriptionally active in the supragingival plaque of all participants regardless of phenotype, but also show highly diagnostic changes in the ways that organisms interact. Specifically, many organisms exhibit high connectedness with central carbon metabolism to Cardiobacterium and this shift serves a bridge between phenotypes. Our evidence supports the hypothesis that caries is a multifactorial ecological disease.
Effects of early-life environment and epigenetics on cardiovascular disease risk in children: Highlighting the role of twin studies
Publisher: Springer Science and Business Media LLC
Date: 11-01-2013
DOI: 10.1038/PR.2013.6
Abstract: Cardiovascular disease (CVD) is the leading cause of death worldwide and originates in early life. The exact mechanisms of this early-life origin are unclear, but a likely mediator at the molecular level is epigenetic dysregulation of gene expression. Epigenetic factors have thus been posited as the likely drivers of early-life programming of adult-onset diseases. This review summarizes recent advances in epidemiology and epigenetic research of CVD risk in children, with a particular focus on twin studies. Classic twin studies enable partitioning of phenotypic variance within a population into additive genetic, shared, and nonshared environmental variances, and are invaluable in research in this area. Longitudinal cohort twin studies, in particular, may provide important insights into the role of epigenetics in the pathogenesis of CVD. We describe candidate gene and epigenome-wide association studies (EWASs) and transgenerational epigenetic inheritance of CVD, and discuss the potential for evidence-based interventions. Identifying epigenetic changes associated with CVD-risk biomarkers in children will provide new opportunities to unravel the underlying biological mechanism of the origins of CVD and enable identification of those at risk for early-life interventions to alter the risk trajectory and potentially reduce CVD incidence later in life.
In vitro exposure of human blood mononuclear cells to active vitamin D does not induce substantial change to DNA methylation on a genome-scale
Publisher: Elsevier BV
Date: 05-2014
DOI: 10.1016/J.JSBMB.2014.01.018
Abstract: It is well-established that vitamin D impacts gene regulation via vitamin D response elements (VDREs) across the genome. Recent evidence, primarily at a locus-specific level, suggests that alterations to DNA methylation may also be a relevant mechanism through which vitamin D regulates gene expression. Given the intense interest in vitamin D, particularly as an immune modifier, we sought to examine the impact of vitamin D exposure on the immune cell methylome in vitro. We exposed primary human blood mononuclear cells with up to 100nM calcitriol for up to 120h, and measured genome-scale DNA methylation response using the Illumina Infinium HumanMethylation450 beadchip array. We observed that, while the expression of known vitamin D responsive genes was clearly altered by calcitriol exposure, substantial genome-scale changes to DNA methylation were not induced. Our data suggests that, over the exposure period measured, changes to DNA methylation may not be a predominant mechanism through which vitamin D impacts gene expression in human immune cells.
Independent confirmation of juvenile idiopathic arthritis genetic risk loci previously identified by immunochip array analysis
Publisher: Springer Science and Business Media LLC
Date: 12-2014
A twin study of body mass index and dental caries in childhood
Publisher: Springer Science and Business Media LLC
Date: 17-01-2020
DOI: 10.1038/S41598-020-57435-7
Abstract: Sub-optimal nutrition and dental caries are both common with significant short and long-term implications for child health and development. We applied twin statistical methods to explore the relationship between body mass index (BMI) and dental caries. We measured BMI at 18 months and six years of age and cumulative dental caries experience at six years in 344 twin children. Dental caries in primary teeth was categorised into ‘any’ or ‘advanced’ and BMI was analysed as both a continuous and categorical variable. Statistical analyses included multiple logistic regression using generalized estimating equations and within/between-pair analyses. There was no association between BMI and ‘any’ dental caries experience at either time-point, neither overall nor in within/between pair analyses. However, ‘advanced’ dental caries at six years was associated with a within-pair difference in BMI of −0.55 kg/m 2 (95% CI −1.00, −0.11, p = 0.015). A within-pair increase of 1 kg/m 2 in BMI was associated with a lower within-pair risk of advanced dental caries (OR 0.68, 95% CI 0.52, 0.90, p = 0.007). These findings reveal a possible causal relationship between lower BMI and dental caries. As dental outcomes were only measured at one time point, the direction of this potentially causal relationship is unclear.
Evidence for age-related and individual-specific changes in DNA methylation profile of mononuclear cells during early immune development in humans
Publisher: Informa UK Limited
Date: 09-2011
Abstract: Environment induced epigenetic effects on gene expression in early life are likely to play important roles in mediating the risk of several immune-related diseases. In order to investigate this fully, it is essential to first document temporal changes in epigenetic profile in disease-free in iduals as a prelude to defining environmentally mediated changes. Mononuclear cells (MC) were collected longitudinally from a small number of females at birth, 1 year, 2.5 years and 5 years of age and examined for changes in genome-scale DNA methylation profiles using the Illumina Infinium HumanMethylation27 BeadChip array platform. MC from two males were included for comparative purposes. Flow cytometry was used to define MC cell populations in each s le in order to exclude this as the major driver of epigenetic change. The data underwent quality control and normalization within the R programming environment. Unsupervised hierarchical clustering of s les clearly delineated neonatal MC from all other ages. A further clear distinction was observed between 1 year and 5 year s les, with 2.5 year s les showing a mixed distribution between the 1 and 5 year groups. Gene ontology of probes significantly variable over the neonatal period revealed methylation changes in genes associated with cell surface receptor and signal transduction events. In the postnatal period, methylation changes were mostly associated with the development of effector immune responses and homeostasis. Unlike all other chromosomes tested, a predominantly genetic effect was identified as controlling maintenance of X-chromosome methylation profile in females, largely refractory to change over time. This data suggests that the primary driver of neonatal epigenome is determined in utero, whilst postnatally, multiple genetic and environmental factors are implicated in the development of MC epigenetic profile, particularly between the ages of 1-5 years, when the highest level of inter in idual variation is apparent. This supports a model for differential sensitivity of specific in iduals to disruption in the developing epigenome during the first years of life. Further studies are now needed to examine evolving epigenetic variations in specific cell populations in relation to environmental exposures, immune phenotype and subsequent disease susceptibility.
Genomewide association study of peanut allergy reproduces association with amino acid polymorphisms in HLA-DRB1
Publisher: Wiley
Date: 11-01-2017
DOI: 10.1111/CEA.12863
Abstract: Genetic variants for IgE-mediated peanut allergy are yet to be fully characterized and to date only one genomewide association study (GWAS) has been published. To identify genetic variants associated with challenge-proven peanut allergy. We carried out a GWAS comparing 73 infants with challenge-proven IgE-mediated peanut allergy against 148 non-allergic infants (all ~ 1 year old). We tested a total of 3.8 million single nucleotide polymorphisms, as well as imputed HLA alleles and amino acids. Replication was assessed by de novo genotyping in a panel of additional 117 cases and 380 controls, and in silico testing in two independent GWAS cohorts. We identified 21 independent associations at P ≤ 5 × 10 Genetic determinants for challenge-proven peanut allergy include alleles at the HLA-DRB1 locus.
Blood DNA methylation biomarkers predict clinical reactivity in food-sensitized infants
Publisher: Elsevier BV
Date: 05-2015
DOI: 10.1016/J.JACI.2014.12.1933
Abstract: The diagnosis of food allergy (FA) can be challenging because approximately half of food-sensitized patients are asymptomatic. Current diagnostic tests are excellent makers of sensitization but poor predictors of clinical reactivity. Thus oral food challenges (OFCs) are required to determine a patient's risk of reactivity. We sought to discover genomic biomarkers of clinical FA with utility for predicting food challenge outcomes. Genome-wide DNA methylation (DNAm) profiling was performed on blood mononuclear cells from volunteers who had undergone objective OFCs, concurrent skin prick tests, and specific IgE tests. Fifty-eight food-sensitized patients (aged 11-15 months) were assessed, half of whom were clinically reactive. Thirteen nonallergic control subjects were also assessed. Reproducibility was assessed in an additional 48 s les by using methylation data from an independent population of patients with clinical FA. Using a supervised learning approach, we discovered a DNAm signature of 96 CpG sites that predict clinical outcomes. Diagnostic scores were derived from these 96 methylation sites, and cutoffs were determined in a sensitivity analysis. Methylation biomarkers outperformed allergen-specific IgE and skin prick tests for predicting OFC outcomes. FA status was correctly predicted in the replication cohort with an accuracy of 79.2%. DNAm biomarkers with clinical utility for predicting food challenge outcomes are readily detectable in blood. The development of this technology in detailed follow-up studies will yield highly innovative diagnostic assays.
Epigenome-wide association study reveals longitudinally stable DNA methylation differences in CD4+ T cells from children with IgE-mediated food allergy
Publisher: Informa UK Limited
Date: 24-04-2014
DOI: 10.4161/EPI.28945
Decreased maternal serum acetate and impaired fetal thymic and regulatory T cell development in preeclampsia
Publisher: Springer Science and Business Media LLC
Date: 10-07-2019
DOI: 10.1038/S41467-019-10703-1
Abstract: Maternal immune dysregulation seems to affect fetal or postnatal immune development. Preecl sia is a pregnancy-associated disorder with an immune basis and is linked to atopic disorders in offspring. Here we show reduction of fetal thymic size, altered thymic architecture and reduced fetal thymic regulatory T (Treg) cell output in preecl tic pregnancies, which persists up to 4 years of age in human offspring. In germ-free mice, fetal thymic CD4 + T cell and Treg cell development are compromised, but rescued by maternal supplementation with the intestinal bacterial metabolite short chain fatty acid (SCFA) acetate, which induces upregulation of the autoimmune regulator (AIRE), known to contribute to Treg cell generation. In our human cohorts, low maternal serum acetate is associated with subsequent preecl sia, and correlates with serum acetate in the fetus. These findings suggest a potential role of acetate in the pathogenesis of preecl sia and immune development in offspring.
Problems in measuring diffuse X-ray scattering
Publisher: Walter de Gruyter GmbH
Date: 2005
Causal effect of smoking on DNA methylation in peripheral blood
Publisher: Springer Science and Business Media LLC
Date: 09-02-2018
Prenatal phthalate exposure, oxidative stress-related genetic vulnerability and early life neurodevelopment: A birth cohort study.
Publisher: Elsevier BV
Date: 09-2020
HIF3A cord blood methylation and systolic blood pressure at 4 years – a population-based cohort study
Publisher: Informa UK Limited
Date: 27-06-2020
Diabetes and Overweight/Obesity Are Independent, Nonadditive Risk Factors for In-Hospital Severity of COVID-19: An International, Multicenter Retrospective Meta-analysis.
Publisher: American Diabetes Association
Date: 15-04-2021
DOI: 10.2337/DC20-2676
Abstract: Obesity is an established risk factor for severe coronavirus disease 2019 (COVID-19), but the contribution of overweight and/or diabetes remains unclear. In a multicenter, international study, we investigated if overweight, obesity, and diabetes were independently associated with COVID-19 severity and whether the BMI-associated risk was increased among those with diabetes. We retrospectively extracted data from health care records and regional databases of hospitalized adult patients with COVID-19 from 18 sites in 11 countries. We used standardized definitions and analyses to generate site-specific estimates, modeling the odds of each outcome (supplemental oxygen/noninvasive ventilatory support, invasive mechanical ventilatory support, and in-hospital mortality) by BMI category (reference, overweight, obese), adjusting for age, sex, and prespecified comorbidities. Subgroup analysis was performed on patients with preexisting diabetes. Site-specific estimates were combined in a meta-analysis. Among 7,244 patients (65.6% overweight/obese), those with overweight were more likely to require oxygen/noninvasive ventilatory support (random effects adjusted odds ratio [aOR], 1.44 95% CI 1.15–1.80) and invasive mechanical ventilatory support (aOR, 1.22 95% CI 1.03–1.46). There was no association between overweight and in-hospital mortality (aOR, 0.88 95% CI 0.74–1.04). Similar effects were observed in patients with obesity or diabetes. In the subgroup analysis, the aOR for any outcome was not additionally increased in those with diabetes and overweight or obesity. In adults hospitalized with COVID-19, overweight, obesity, and diabetes were associated with increased odds of requiring respiratory support but were not associated with death. In patients with diabetes, the odds of severe COVID-19 were not increased above the BMI-associated risk.
American Heart Association ideal cardiovascular health score and subclinical atherosclerosis in 22–35-year-old adults conceived with and without assisted reproductive technologies
Publisher: Oxford University Press (OUP)
Date: 13-12-2019
Abstract: Is ART related with the association of American Heart Association (AHA) ideal cardiovascular health score and markers of subclinical atherosclerosis? The associations between AHA score and markers of subclinical atherosclerosis in ART and non-ART groups were similar in magnitude. Long-term consequences of ART on cardiovascular health are unknown. The study cohort for the cross-sectional analyses consisted of 172 ART-conceived and 78 non-ART conceived in iduals of same age (range 22–35 years). Cardiovascular risk factor status was evaluated with American Heart Association (AHA) ideal cardiovascular health score consisting of seven factors (body mass index, blood pressure, total cholesterol, glucose, diet and physical activity, non-smoking). Carotid artery intima-media thickness (cIMT), arterial pulse-wave velocity (PWV) and retinal microvascular parameters were evaluated as markers of early atherosclerosis. Group comparisons in continuous variables were performed with t-tests. For categorical variables, comparisons were performed with chi-square tests. The relationships between AHA score and the markers of atherosclerosis were examined with linear regression analyses adjusted for age and sex. There was no difference in AHA ideal health score between the ART and non-ART groups mean (SD) scores were 4.1(1.4) versus 4.0(1.5), respectively, P = 0.65. No differences were observed between groups for any in idual ideal health metric (P always & .2). AHA score was not associated with cIMT or retinal measures in either group (P always & .05). An inverse association was observed between AHA score and PWV in the ART group (beta (95% CI) −0.18(−0.26 to −0.10)). A numerically similar relationship was observed in the smaller non-ART group (−0.19(−0.39 to 0.01)). Even though this cohort is among the largest ART studies with extensive cardiovascular data, the s le is still relatively small and the statistical power is limited. As the study population was still in early adulthood, we were not able to evaluate the associations with clinical cardiovascular events, but utilized non-invasive methods to assess early markers of subclinical atherosclerosis. These findings suggest that ART-conceived in iduals do not have increased vulnerability for cardiovascular risk factors. This study was funded by a National Health & Medical Research Council Project Grant (APP1099641), The Royal Children’s Hospital Research Foundation, Monash IVF Research and Education Foundation, and Reproductive Biology Unit Sperm Fund, Melbourne IVF. The authors have no conflicts of interest relevant to this article to disclose.
Twin's Birth-Order Differences in Height and Body Mass Index From Birth to Old Age: A Pooled Study of 26 Twin Cohorts Participating in the CODATwins Project
Publisher: Cambridge University Press (CUP)
Date: 09-03-2016
DOI: 10.1017/THG.2016.11
Abstract: We analyzed birth order differences in means and variances of height and body mass index (BMI) in monozygotic (MZ) and dizygotic (DZ) twins from infancy to old age. The data were derived from the international CODATwins database. The total number of height and BMI measures from 0.5 to 79.5 years of age was 397,466. As expected, first-born twins had greater birth weight than second-born twins. With respect to height, first-born twins were slightly taller than second-born twins in childhood. After adjusting the results for birth weight, the birth order differences decreased and were no longer statistically significant. First-born twins had greater BMI than the second-born twins over childhood and adolescence. After adjusting the results for birth weight, birth order was still associated with BMI until 12 years of age. No interaction effect between birth order and zygosity was found. Only limited evidence was found that birth order influenced variances of height or BMI. The results were similar among boys and girls and also in MZ and DZ twins. Overall, the differences in height and BMI between first- and second-born twins were modest even in early childhood, while adjustment for birth weight reduced the birth order differences but did not remove them for BMI.
Gender-affirming hormone therapy induces specific DNA methylation changes in blood.
Publisher: Springer Science and Business Media LLC
Date: 17-02-2022
DOI: 10.1186/S13148-022-01236-4
Abstract: DNA methylation is an epigenetic mark that is influenced by underlying genetic profile, environment, and ageing. In addition to X-linked DNA methylation, sex-specific methylation patterns are widespread across autosomal chromosomes and can be present from birth or arise over time. In in iduals where gender identity and sex assigned at birth are markedly incongruent, as in the case of transgender people, feminization or masculinization may be sought through gender-affirming hormone therapy (GAHT). GAHT is a cornerstone of transgender care, yet no studies to date have investigated its effect on genome-wide methylation. We profiled genome-wide DNA methylation in blood of transgender women ( n = 13) and transgender men ( n = 13) before and during GAHT (6 months and 12 months into feminizing or masculinizing hormone therapy). We identified several thousand differentially methylated CpG sites (DMPs) (Δ β ≥ 0.02, unadjusted p value 0.05) and several differentially methylated regions (DMRs) in both people undergoing feminizing and masculinizing GAHT, the vast majority of which were progressive changes over time. X chromosome and sex-specific autosomal DNA methylation patterns established in early development are largely refractory to change in association with GAHT, with only 3% affected (Δ β ≥ 0.02, unadjusted p value 0.05). The small number of sex-specific DMPs that were affected by GAHT were those that become sex-specific during the lifetime, known as sex-and-age DMPs, including DMRs in PRR4 and VMP1 genes. The GAHT-induced changes at these sex-associated probes consistently demonstrated a shift towards the methylation signature of the GAHT-naïve opposite sex, and we observed enrichment of previously reported adolescence-associated methylation changes. We provide evidence for GAHT inducing a unique blood methylation signature in transgender people. This study advances our understanding of the complex interplay between sex hormones, sex chromosomes, and DNA methylation in the context of immunity. We highlight the need to broaden the field of ‘sex-specific’ immunity beyond cisgender males and cisgender females, as transgender people on GAHT exhibit a unique molecular profile.
Epigenetic modifications: mechanisms of disease and biomarkers of food allergy
Publisher: Elsevier BV
Date: 10-2016
DOI: 10.1016/J.COI.2016.05.005
Abstract: The rise in IgE-mediated food allergy in recent times is the likely result of gene-environment interactions mediated via epigenetic pathways. As epigenetic modifications, including DNA methylation, are at the interface between the environment and the genome, they may be ideal biomarkers of modifiable disease pathways. High-throughput methylation profiling of immune cell subtypes or whole blood from patients allows the identification of disease specific epigenetic variants. If faithfully tracking with disease parameters, these 'signatures' may have clinical applications as biomarkers of disease or therapeutic response. Development of such tools will depend on a number of factors, including determining the most appropriate experimental approach, analysis methodology, patient groups, and informative target cells/tissues. Here we discuss these potential applications and their implications for food allergy practise.
Metabolic Biomarkers of Monochorionic Twins Complicated With Selective Intrauterine Growth Restriction in Cord Plasma and Placental Tissue
Publisher: Springer Science and Business Media LLC
Date: 29-10-2018
DOI: 10.1038/S41598-018-33788-Y
Abstract: The selective intrauterine growth restriction (sIUGR) of monochorionic diamniotic (MCDC) twins causes phenotypic growth discordance, which is correlated with metabolomic pertubations. A global, untargeted identification of the metabolic fingerprint may help elucidate the etiology of sIUGR. Umbilical cord blood and placentas collected from 15 pairs of sIUGR monochorionic twins, 24 pairs of uncomplicated twins, and 14 singletons diagnosed with intrauterine growth restriction (IUGR) were subjected to gas chromatography-mass spectrometry based metabolomic analyses. Supervised multivariate regression analysis and pathway analysis were performed to compare control twins with sIUGR twins. A generalized estimating equation (GEE) model was utilized to explore metabolic differences within sIUGR co-twins. Linear logistic regression was applied to screen metabolites that significantly differed in concentration between control twins and sIUGR twins or IUGR singletons. Umbilical cord blood demonstrated better global metabolomic separation of sIUGR and control twins compared to the placenta. Disrupted amino acid and fatty acid metabolism as well as high levels of exposure to environmental xenobiotics were associated with sIUGR. The metabolic abnormalities in MCDA twins suggested that in utero growth discordance is caused by intrauterine and extrauterine environmental factors, rather than genetics. Thus, this study provides new therapeutic targets and strategies for sIUGR management and prevention.
Conservation of centromere proteins in vertebrates
Publisher: Springer Science and Business Media LLC
Date: 1999
Abstract: The chicken genome comprises 78 chromosomes which include several macrochromosomes and many microchromosomes. Very little information is currently available concerning chicken centromere structure and function and it is unclear if the two types of chromosomes share a common centromere mechanism or whether this mechanism resembles those in other species. Immunofluorescence studies using antibodies to mammalian constitutive centromere proteins CENP-A, CENP-B, and CENP-C and the passenger proteins CENP-E, and CENP-F revealed the presence of each of these proteins at the centromeres of both macro- and microchromsomes. CENP-A, CENP-B, and CENP-E levels showed variability between metaphase centromeres while CENP-C and CENP-F levels were relatively constant. These results suggest a common centromere mechanism for both types of chromosomes as well as indicating a high degree of conservation of in idual proteins between widely ergent vertebrate classes and an overall conservation of centromere function throughout vertebrate evolution.
Maternal gut microbiota during pregnancy and the composition of immune cells in infancy
Publisher: Frontiers Media SA
Date: 21-09-2022
DOI: 10.3389/FIMMU.2022.986340
Abstract: Preclinical studies have shown that maternal gut microbiota during pregnancy play a key role in prenatal immune development but the relevance of these findings to humans is unknown. The aim of this prebirth cohort study was to investigate the association between the maternal gut microbiota in pregnancy and the composition of the infant’s cord and peripheral blood immune cells over the first year of life. The Barwon Infant Study cohort ( n =1074 infants) was recruited using an unselected s ling frame. Maternal fecal s les were collected at 36 weeks of pregnancy and flow cytometry was conducted on cord eripheral blood collected at birth, 6 and 12 months of age. Among a randomly selected sub-cohort with available s les ( n =293), maternal gut microbiota was characterized by sequencing the 16S rRNA V4 region. Operational taxonomic units (OTUs) were clustered based on their abundance. Associations between maternal fecal microbiota clusters and infant granulocyte, monocyte and lymphocyte subsets were explored using compositional data analysis. Partial least squares (PLS) and regression models were used to investigate the relationships/associations between environmental, maternal and infant factors, and OTU clusters. We identified six clusters of co-occurring OTUs. The first two components in the PLS regression explained 39% and 33% of the covariance between the maternal prenatal OTU clusters and immune cell populations in offspring at birth. A cluster in which Dialister, Escherichia , and Ruminococcus were predominant was associated with a lower proportion of granulocytes ( p =0.002), and higher proportions of both central naïve CD4 + T cells (CD4 + /CD45RA + /CD31 − ) ( p & .001) and naïve regulatory T cells (Treg) (CD4 + /CD45RA + /FoxP3 low ) ( p =0.02) in cord blood. The association with central naïve CD4 + T cells persisted to 12 months of age. This birth cohort study provides evidence consistent with past preclinical models that the maternal gut microbiota during pregnancy plays a role in shaping the composition of innate and adaptive elements of the infant’s immune system following birth.
Cloning and characterization of the promoter for the rat insulin-like growth factor-binding protein-3 gene.
Publisher: The Endocrine Society
Date: 02-1995
DOI: 10.1210/ENDO.136.2.7530650
Abstract: Insulin-like growth factor-binding protein-3 (IGFBP-3), the major IGFBP in the adult circulation, is produced by a wide range of cell and tissue types. IGFBP-3 appears to be regulated by transcriptional and/or posttranslational mechanisms in a species-, cell-, and development-specific manner. In vitro and in vivo studies suggest that a number of factors (e.g. cAMP, GH, insulin-like growth factor-I, epidermal growth factor, TSH, and FSH) can act as transcriptional regulators of IGFBP-3 in particular cell types. To address the mechanistic basis for these observations, we isolated the rat IGFBP-3 gene and began characterization and analysis of the hormonal regulation of its promoter. The rat IGFBP-3 gene is located within 2 adjacent EcoRI fragments spanning about 10 kilobases. Southern analysis indicated a single copy gene. A 1.18-kilobase fragment 5' to the translation initiation codon has been sequenced and showed 65% homology with the corresponding human IGFBP-3 sequence. The region between -100 and -1 bp relative to the transcription start site showed 85% homology. The transcription start site was 118 basepairs (bp) up-stream of the initiation codon, and a TATA box consensus was located 27 bp 5' to this CAP site. No CAAT box was present, but a CpG island was identified. Consensus sequences for a number of putative response elements (e.g. activating protein-2, insulin, TSH/insulin-like growth factor, and GH) were present within -700 bp of the CAP site. A series of 5'-truncated chlor henicol acetyltransferase reporter constructs has been transfected into both COS-1 cells and the rat thyroid cell line FRTL-5. Both basal and hormonally responsive (TSH and phorbol ester) promoter activities have been localized within the first 472 bases of the promoter region. These data indicate that suitable transfected cell systems can be established in which additional investigations can be undertaken into the mechanisms of cell- and species-specific hormonal regulation of IGFBP-3 gene expression.
Cord blood monocyte-derived inflammatory cytokines suppress IL-2 and induce nonclassic TH2-type immunity associated with development of food allergy.
Publisher: American Association for the Advancement of Science (AAAS)
Date: 13-01-2016
DOI: 10.1126/SCITRANSLMED.AAD4322
Abstract: Infants who develop food allergy display hyperresponsive innate immunity at birth that promotes nonclassical T H 2 differentiation.
Wide-ranging DNA methylation differences of primary trophoblast cell populations and derived cell lines: implications and opportunities for understanding trophoblast function†
Publisher: Oxford University Press (OUP)
Date: 02-02-2011
DNA methylation profiling identifies epigenetic differences between early versus late stages of diabetic chronic kidney disease
Publisher: Oxford University Press (OUP)
Date: 04-11-2021
DOI: 10.1093/NDT/GFAA226
Abstract: We investigated a cross-sectional epigenome-wide association study of patients with early and late diabetes-associated chronic kidney disease (CKD) to identify possible epigenetic differences between the two groups as well as changes in methylation across all stages of diabetic CKD. We also evaluated the potential of using a panel of identified 5′-C-phosphate-G-3′ (CpG) sites from this cohort to predict the progression of diabetic CKD. This cross-sectional study recruited 119 adults. DNA was extracted from blood using the Qiagen QIA DNA Mini Spin Kit. Genome-wide methylation analysis was performed using Illumina Infinium MethylationEPIC BeadChips (HM850K). Intensity data files were processed and analysed using the minfi and MissMethyl packages for R. We examined the degree of methylation of CpG sites in early versus late diabetic CKD patients for CpG sites with an unadjusted P-value & .01 and an absolute change in methylation of 5% (n = 239 CpG sites). Hierarchical clustering of the 239 CpG sites largely separated the two groups. A heat map for all 239 CpG sites demonstrated distinct methylation patterns in the early versus late groups, with CpG sites showing evidence of progressive change. Based on our differentially methylated region (DMR) analysis of the 239 CpG sites, we highlighted two DMRs, namely the cysteine-rich secretory protein 2 (CRISP2) and piwi-like RNA-mediated gene silencing 1 (PIWIL1) genes. The best predictability for the two groups involved a receiver operating characteristics curve of eight CpG sites alone and achieved an area under the curve of 0.976. We have identified distinct DNA methylation patterns between early and late diabetic CKD patients as well as demonstrated novel findings of potential progressive methylation changes across all stages (1–5) of diabetic CKD at specific CpG sites. We have also identified associated genes CRISP2 and PIWIL1, which may have the potential to act as stage-specific diabetes-associated CKD markers, and showed that the use of a panel of eight identified CpG sites alone helps to increase the predictability for the two groups.
The X-factor in ART: does the use of Assisted Reproductive Technologies influence DNA methylation on the X chromosome?
Publisher: Cold Spring Harbor Laboratory
Date: 07-10-2022
DOI: 10.1101/2022.10.06.510603
Abstract: Assisted reproductive technologies (ART) may perturb DNA methylation (DNAm) in early embryonic development. Although a handful of epigenome-wide association studies of ART have been published, none have investigated CpGs on the X chromosome. To bridge this knowledge gap, we leveraged one of the largest collections of mother-father-newborn trios of ART and non-ART (natural) conceptions to date to investigate DNAm differences on the X chromosome. The discovery cohort consisted of 982 ART and 963 non-ART trios from the Norwegian Mother, Father, and Child Cohort Study (MoBa). The replication cohort consisted of 149 ART and 58 non-ART neonates from the Australian “Clinical review of the Health of adults conceived following Assisted Reproductive Technologies” (CHART) study. The Illumina EPIC array was used to measure DNA methylation (DNAm) in both datasets. In the MoBa cohort, we performed a set of X-chromosome-wide association studies (“XWASs” hereafter) to search for sex-specific DNAm differences between ART and non-ART newborns. We tested several models to investigate the influence of various confounders, including parental DNAm. We also searched for differentially methylated regions (DMRs) and regions of co-methylation flanking the most significant CpGs. For replication purposes, we ran an analogous model to our main model on the CHART dataset. In the MoBa cohort, we found more differentially methylated CpGs and DMRs in girls than boys. Most of the associations persisted even after controlling for parental DNAm and other confounders. Many of the significant CpGs and DMRs were in gene-promoter regions, and several of the genes linked to these CpGs are expressed in tissues relevant for both ART and sex (testis, placenta, and fallopian tube). We found no support for parental infertility as an explanation for the observed associations in the newborns. The most significant CpG in the boys-only analysis was in UBE2DNL , which is expressed in testes but with unknown function. The most significant CpGs in the girls-only analysis were in EIF2S3 and AMOT . These three loci also displayed differential DNAm in the CHART cohort. Overall, genes that co-localized with the significant CpGs and DMRs are implicated in several key biological processes (e.g., neurodevelopment) and disorders (e.g., intellectual disability and autism. These connections are particularly compelling in light of previous findings indicating that neurodevelopmental outcomes differ in ART-conceived children compared to naturally-conceived.
Mass cytometry analysis of blood from peanut-sensitized tolerant and clinically allergic infants.
Publisher: Springer Science and Business Media LLC
Date: 12-2022
DOI: 10.1038/S41597-022-01861-X
Abstract: IgE-mediated food allergies in infants are a significant health concern, with peanut allergy being of particular interest due to its prevalence and severity. Among in iduals who produce peanut-specific IgE some experience no adverse reaction on peanut consumption. This asymptomatic phenotype is known as sensitized tolerance. To elucidate the immune environment of peanut sensitized tolerant and clinically allergic one-year-olds, high-dimensional mass cytometry was conducted as part of the HealthNuts study. The resulting data includes peripheral blood mononuclear cells from 36 participants encompassing non-allergic, peanut sensitized with tolerance, and clinically peanut allergic infants. The raw mass cytometry data is described here and freely available for reuse through the Immunology Database and Analysis Portal (ImmPort). Additional allergy information and serum vitamin D levels of the participants were measured and are also included in the data upload. These high-dimensional mass cytometry data, when combined with clinical information, offer a broad immune profile of peanut allergic and sensitized tolerant infants.
Methylation of the LEP gene promoter in blood at 12 months and BMI at 4 years of age—a population-based cohort study
Publisher: Springer Science and Business Media LLC
Date: 27-02-2020
Modelling disorder in 3,3′-dimethoxybenzil, C16 H 14 O4
Publisher: Walter de Gruyter GmbH
Date: 2005
Association of medically assisted reproduction with offspring cord blood DNA methylation across cohorts
Publisher: Oxford University Press (OUP)
Date: 17-06-2021
Abstract: Is cord blood DNA methylation associated with having been conceived by medically assisted reproduction? This study does not provide strong evidence of an association of conception by medically assisted reproduction with variation in infant blood cell DNA methylation. Medically assisted reproduction consists of procedures used to help infertile/subfertile couples conceive, including ART. Due to its importance in gene regulation during early development programming, DNA methylation and its perturbations associated with medically assisted reproduction could reveal new insights into the biological effects of assisted reproductive technologies and potential adverse offspring outcomes. We investigated the association of DNA methylation and medically assisted reproduction using a case–control study design (N = 205 medically assisted reproduction cases and N = 2439 naturally conceived controls in discovery cohorts N = 149 ART cases and N = 58 non-ART controls in replication cohort). We assessed the association between medically assisted reproduction and DNA methylation at birth in cord blood (205 medically assisted conceptions and 2439 naturally conceived controls) at & 000 CpG sites across the genome in two sub-s les of the UK Avon Longitudinal Study of Parents and Children (ALSPAC) and two sub-s les of the Norwegian Mother, Father and Child Cohort Study (MoBa) by meta-analysis. We explored replication of findings in the Australian Clinical review of the Health of adults conceived following Assisted Reproductive Technologies (CHART) study (N = 149 ART conceptions and N = 58 controls). The ALSPAC and MoBa meta-analysis revealed evidence of association between conception by medically assisted reproduction and DNA methylation (false-discovery-rate-corrected P-value & 0.05) at five CpG sites which are annotated to two genes (percentage difference in methylation per CpG, cg24051276: Beta = 0.23 (95% CI 0.15,0.31) cg00012522: Beta = 0.47 (95% CI 0.31, 0.63) cg17855264: Beta = 0.31 (95% CI 0.20, 0.43) cg17132421: Beta = 0.30 (95% CI 0.18, 0.42) cg18529845: Beta = 0.41 (95% CI 0.25, 0.57)). Methylation at three of these sites has been previously linked to cancer, aging, HIV infection and neurological diseases. None of these associations replicated in the CHART cohort. There was evidence of a functional role of medically assisted reproduction-induced hypermethylation at CpG sites located within regulatory regions as shown by putative transcription factor binding and chromatin remodelling. While insufficient power is likely, heterogeneity in types of medically assisted reproduction procedures and between populations may also contribute. Larger studies might identify replicable variation in DNA methylation at birth due to medically assisted reproduction. Newborns conceived with medically assisted procedures present with ergent DNA methylation in cord blood white cells. If these associations are true and causal, they might have long-term consequences for offspring health. This study has been supported by the US National Institute of Health (R01 DK10324), the European Research Council under the European Union’s Seventh Framework Programme (FP7/2007-2013)/ERC Grant agreement no. 669545, European Union’s Horizon 2020 research and innovation programme under Grant agreement no. 733206 (LifeCycle) and the NIHR Biomedical Centre at the University Hospitals Bristol NHS Foundation Trust and the University of Bristol. The UK Medical Research Council and Wellcome (Grant ref: 102215/2/13/2) and the University of Bristol provide core support for ALSPAC. Methylation data in the ALSPAC cohort were generated as part of the UK BBSRC funded (BB/I025751/1 and BB/I025263/1) Accessible Resource for Integrated Epigenomic Studies (ARIES, www.ariesepigenomics.org.uk). D.C., J.J., C.L.R. D.A.L and H.R.E. work in a Unit that is supported by the University of Bristol and the UK Medical Research Council (Grant nos. MC_UU_00011/1, MC_UU_00011/5 and MC_UU_00011/6). B.N. is supported by an NHMRC (Australia) Investigator Grant (1173314). ALSPAC GWAS data were generated by S le Logistics and Genotyping Facilities at Wellcome Sanger Institute and LabCorp (Laboratory Corporation of America) using support from 23andMe. The Norwegian Mother, Father and Child Cohort Study is supported by the Norwegian Ministry of Health and Care Services and the Ministry of Education and Research, NIH/NIEHS (Contract no. N01-ES-75558), NIH/NINDS (Grant nos. (i) UO1 NS 047537-01 and (ii) UO1 NS 047537-06A1). For this work, MoBa 1 and 2 were supported by the Intramural Research Program of the NIH, National Institute of Environmental Health Sciences (Z01-ES-49019) and the Norwegian Research Council/BIOBANK (Grant no. 221097). This work was partly supported by the Research Council of Norway through its Centres of Excellence funding scheme, Project no. 262700. D.A.L. has received support from national and international government and charity funders, as well as from Roche Diagnostics and Medtronic for research unrelated to this study. The other authors declare no conflicts of interest. N/A.
Cohort Profile: The Pregnancy and Neonatal Diabetes Outcomes in Remote Australia (PANDORA) Study
Publisher: Oxford University Press (OUP)
Date: 29-03-2018
DOI: 10.1093/IJE/DYY046
Maternal depression, antidepressant use and placental oxytocin receptor DNA methylation: Findings from the MPEWS study
Publisher: Elsevier BV
Date: 04-2018
DOI: 10.1016/J.PSYNEUEN.2018.01.004
Abstract: The aim of this study was to investigate placental DNA methylation of the oxytocin receptor gene (OXTR) in women with depression in pregnancy. We also explored the role of antidepressant medication in pregnancy on placental OXTR methylation. Data were obtained from 239 women in the Mercy Pregnancy and Emotional Wellbeing Study (MPEWS), a selected pregnancy cohort. Current depressive disorders were diagnosed using the Structured Clinical Interview for Diagnostic and Statistical Manual of Mental Disorders (SCID-IV). Depressive symptoms were measured during the third trimester in pregnancy using the Edinburgh Postnatal Depression Scale (EPDS). Plasma levels of antidepressant drugs were measured in maternal and cord blood obtained at delivery. OXTR DNA methylation was measured in placenta s les. Depressive symptoms in pregnancy were not associated with significant changes in DNA methylation of OXTR in the placenta. Cord plasma antidepressant levels were more strongly associated than maternal antidepressant dose or circulating blood antidepressant levels with increased DNA methylation of a specific unit within the promotor region of OXTR. This study provides preliminary data to suggest that antidepressant use during pregnancy can alter OXTR methylation in placental tissue. Our findings also indicate that the way exposures are measured in pregnancy can influence the direction and strength of findings. Future studies should investigate whether altered OXTR methylation might mediate the impacts of maternal antidepressant treatment on pregnancy and offspring outcomes.
Human active X-specific DNA methylation events showing stability across time and tissues
Publisher: Springer Science and Business Media LLC
Date: 09-04-2014
DOI: 10.1038/EJHG.2014.34
Zygosity Differences in Height and Body Mass Index of Twins From Infancy to Old Age: A Study of the CODATwins Project.
Publisher: Cambridge University Press (CUP)
Date: 04-09-2015
DOI: 10.1017/THG.2015.57
Abstract: A trend toward greater body size in dizygotic (DZ) than in monozygotic (MZ) twins has been suggested by some but not all studies, and this difference may also vary by age. We analyzed zygosity differences in mean values and variances of height and body mass index (BMI) among male and female twins from infancy to old age. Data were derived from an international database of 54 twin cohorts participating in the COllaborative project of Development of Anthropometrical measures in Twins (CODATwins), and included 842,951 height and BMI measurements from twins aged 1 to 102 years. The results showed that DZ twins were consistently taller than MZ twins, with differences of up to 2.0 cm in childhood and adolescence and up to 0.9 cm in adulthood. Similarly, a greater mean BMI of up to 0.3 kg/m 2 in childhood and adolescence and up to 0.2 kg/m 2 in adulthood was observed in DZ twins, although the pattern was less consistent. DZ twins presented up to 1.7% greater height and 1.9% greater BMI than MZ twins these percentage differences were largest in middle and late childhood and decreased with age in both sexes. The variance of height was similar in MZ and DZ twins at most ages. In contrast, the variance of BMI was significantly higher in DZ than in MZ twins, particularly in childhood. In conclusion, DZ twins were generally taller and had greater BMI than MZ twins, but the differences decreased with age in both sexes.
Centromere RNA is a key component for the assembly of nucleoproteins at the nucleolus and centromere
Publisher: Cold Spring Harbor Laboratory
Date: 10-07-2007
DOI: 10.1101/GR.6022807
Abstract: The centromere is a complex structure, the components and assembly pathway of which remain inadequately defined. Here, we demonstrate that centromeric α-satellite RNA and proteins CENPC1 and INCENP accumulate in the human interphase nucleolus in an RNA polymerase I–dependent manner. The nucleolar targeting of CENPC1 and INCENP requires α-satellite RNA, as evident from the delocalization of both proteins from the nucleolus in RNase-treated cells, and the nucleolar relocalization of these proteins following α-satellite RNA replenishment in these cells. Using protein truncation and in vitro mutagenesis, we have identified the nucleolar localization sequences on CENPC1 and INCENP. We present evidence that CENPC1 is an RNA-associating protein that binds α-satellite RNA by an in vitro binding assay. Using chromatin immunoprecipitation, RNase treatment, and “RNA replenishment” experiments, we show that α-satellite RNA is a key component in the assembly of CENPC1, INCENP, and survivin (an INCENP-interacting protein) at the metaphase centromere. Our data suggest that centromere satellite RNA directly facilitates the accumulation and assembly of centromere-specific nucleoprotein components at the nucleolus and mitotic centromere, and that the sequestration of these components in the interphase nucleolus provides a regulatory mechanism for their timely release into the nucleoplasm for kinetochore assembly at the onset of mitosis.
DNA Methylation Profiles of Purified Cell Types in Bronchoalveolar Lavage: Applications for Mixed Cell Paediatric Pulmonary Studies
Publisher: Frontiers Media SA
Date: 22-12-2021
DOI: 10.3389/FIMMU.2021.788705
Abstract: In epigenome-wide association studies analysing DNA methylation from s les containing multiple cell types, it is essential to adjust the analysis for cell type composition. One well established strategy for achieving this is reference-based cell type deconvolution, which relies on knowledge of the DNA methylation profiles of purified constituent cell types. These are then used to estimate the cell type proportions of each s le, which can then be incorporated to adjust the association analysis. Bronchoalveolar lavage is commonly used to s le the lung in clinical practice and contains a mixture of different cell types that can vary in proportion across s les, affecting the overall methylation profile. A current barrier to the use of bronchoalveolar lavage in DNA methylation-based research is the lack of reference DNA methylation profiles for each of the constituent cell types, thus making reference-based cell composition estimation difficult. Herein, we use bronchoalveolar lavage s les collected from children with cystic fibrosis to define DNA methylation profiles for the four most common and clinically relevant cell types: alveolar macrophages, granulocytes, lymphocytes and alveolar epithelial cells. We then demonstrate the use of these methylation profiles in conjunction with an established reference-based methylation deconvolution method to estimate the cell type composition of two different tissue types a publicly available dataset derived from artificial blood-based cell mixtures and further bronchoalveolar lavage s les. The reference DNA methylation profiles developed in this work can be used for future reference-based cell type composition estimation of bronchoalveolar lavage. This will facilitate the use of this tissue in studies examining the role of DNA methylation in lung health and disease.
Epigenetics as the mediator of fetal programming of adult onset disease: what is the evidence?
Publisher: Wiley
Date: 18-06-2014
DOI: 10.1111/AOGS.12431
Abstract: The Developmental Origins of Health and Disease hypothesis describes how early life environmental factors influence development in a way that impacts later health and disease risk. The hypothesis is supported by a large number of animal studies and a smaller number of observational studies in humans. Epigenetic variation induced in early life has emerged as a prime candidate to be the mediator of such effects, but little direct evidence of this relation exists in humans, primarily due to the inherent problems associated with unraveling the relative contributions of genetic and environmental variables to phenotypic ersity. There are several prerequisites for establishing a causal link that include demonstrating interin idual epigenetic variability in early life in response to specific environmental exposures. Further, compelling evidence linking epigenetic change to disease, prior to onset is required. Finally, the functional relevance of specific epigenetic change must be demonstrated. Evidence is emerging in all of these areas but, ultimately, only large longitudinal life-course studies, commencing prior to birth, can provide direct evidence in support of a role of epigenetic processes as a driver of Developmental Origins of Health and Disease in humans.
Analysis of mitotic and expression properties of human neocentromere-based transchromosomes in mice
Publisher: Elsevier BV
Date: 02-2005
Diffuse scattering as an aid to the understanding of polymorphism in pharmaceuticals
Publisher: Springer Science and Business Media LLC
Date: 10-05-2012
Health of adults aged 22 to 35 years conceived by assisted reproductive technology
Publisher: Elsevier BV
Date: 07-2019
DOI: 10.1016/J.FERTNSTERT.2019.03.001
Abstract: To determine the health outcomes for adults aged 22-35 years old who were conceived via assisted reproduction technology (ART) compared with adults of the same age conceived without use of ART. Cohort study. Not applicable. Adult men and women aged 22-35 years who were conceived with and without use of ART. Questionnaire and clinical review. Vascular structure (carotid artery intima-media thickness, pulse wave velocity), vascular function (blood pressure), metabolic markers (fasting blood glucose, insulin, and standard lipid profiles), anthropometric measurements, and respiratory function (spirometry). The mean age of the 193 ART and 86 non-ART participants was 27.0 and 26.9 years, respectively. There were no substantial intragroup differences in demographics or vascular intermediate phenotypes, metabolic parameters, or anthropometric measures, before or after adjusting for perinatal factors and a quality of life measure with four domains. Diastolic blood pressure was lower in the ART men than the non-ART men (adjusted mean difference -4.4 mm Hg, 95% CI, -8.7 to -0.1). The ART group reported a higher prevalence of ever having asthma, (40.8% vs. 28.6% odds ratio 1.7 95% CI, 1.0-3.0), but expiratory flow rates were similar. This study of the health of 193 adults conceived via ART, the largest to date globally, found no evidence of increased vascular or cardiometabolic risk, or growth or respiratory problems in the ART group compared with a non-ART group from the same source population. Follow-up observation for reproductive and later-onset adverse health effects remains important.
A distinct DNA methylation signature defines pediatric pre-B cell acute lymphoblastic leukemia
Publisher: Informa UK Limited
Date: 06-2012
DOI: 10.4161/EPI.20193
Abstract: Pre-B cell acute lymphoblastic leukemia (ALL) is the most prevalent childhood malignancy and remains one of the highest causes of childhood mortality. Despite this, the mechanisms leading to disease remain poorly understood. We asked if recurrent aberrant DNA methylation plays a role in childhood ALL and have defined a genome-scale DNA methylation profile associated with the ETV6-RUNX1 subtype of pediatric ALL. Archival bone marrow smears from 19 children collected at diagnosis and remission were used to derive a disease specific DNA methylation profile. The gene signature was confirmed in an independent cohort of 86 patients. A further 163 patients were analyzed for DNA methylation of a three gene signature. We found that the DNA methylation signature at diagnosis was unique from remission. Fifteen loci were sufficient to discriminate leukemia from disease-free s les and purified CD34+ cells. DNA methylation of these loci was recurrent irrespective of cytogenetic subtype of pre-B cell ALL. We show that recurrent aberrant genomic methylation is a common feature of pre-B ALL, suggesting a shared pathway for disease development. By revealing new DNA methylation markers associated with disease, this study has identified putative targets for development of novel epigenetic-based therapies.
The utility of twins for epigenetic analysis
Publisher: Springer Netherlands
Date: 11-2012
Maternal oxidative stress during pregnancy associated with emotional and behavioural problems in early childhood: implications for foetal programming
Publisher: Springer Science and Business Media LLC
Date: 16-10-2023
Clinical review of 24–35 year olds conceived with and without in vitro fertilization: study protocol
Publisher: Springer Science and Business Media LLC
Date: 20-09-2017
Gestational weight gain is associated with childhood height, weight and BMI in the Peri/Postnatal Epigenetic Twins Study
Publisher: Cambridge University Press (CUP)
Date: 24-03-2022
DOI: 10.1017/S2040174422000113
Abstract: Multifetal pregnancies are at risk of adverse maternal, neonatal and long-term health outcomes, and gestational weight gain (GWG) is a potentially modifiable risk factor for several of these. However, studies assessing the associations of GWG with long-term health in twins are rare, and studies which do assess these associations in twins often do not account for gestational age. Since longer gestations are likely to lead to larger GWG and lower risk of adverse outcomes, adjusting for gestational age is necessary to better understand the association of GWG with twin health outcomes. We aimed to explore long-term associations of GWG-for-gestational-age with twin anthropometric measures. The Peri/Postnatal Epigenetic Twins Study (PETS) is a prospective cohort study, which recruited women pregnant with twins from 2007 to 2009. Twins were followed-up at 18 months and 6 years of age. GWG-for-gestational-age z -scores were calculated from pre-pregnancy weight and weight at delivery. We fitted regression models to assess associations of GWG with twin weight, height and BMI at birth, 18 months, and 6 years. Of the 250 women in the PETS, 172 had GWG measured throughout pregnancy. Overall, higher GWG-for-gestational-age z -scores were associated with higher birthweight (β: 0.32 z -scores, 95% Confidence Interval (95% CI): 0.19, 0.45), BMI (β: 0.29 z -scores, 95% CI: 0.14, 0.43) and length (β: 0.27 z -scores, 95% CI: 0.09, 0.45). However, these associations were not observed at 18 months or 6 years of age. GWG was associated with twin length, weight and BMI at birth but not during childhood. Further research is needed to determine the long-term effects of GWG on twin health outcomes.
DNA-Methylation and Body Composition in Preschool Children: Epigenome-Wide-Analysis in the European Childhood Obesity Project (CHOP)-Study
Publisher: Springer Science and Business Media LLC
Date: 30-10-2017
DOI: 10.1038/S41598-017-13099-4
Abstract: Adiposity and obesity result from the interaction of genetic variation and environmental factors from very early in life, possibly mediated by epigenetic processes. Few Epigenome-Wide-Association-Studies have identified DNA-methylation (DNAm) signatures associated with BMI and body composition in children. Body composition by Bio-Impedance-Analysis and genome-wide DNAm in whole blood were assessed in 374 pre-school children from four European countries. Associations were tested by linear regression adjusted for sex, age, centre, education, 6 WBC-proportions according to Houseman and 30 principal components derived from control probes. Specific DNAm variants were identified to be associated with BMI (212), fat-mass (230), fat-free-mass (120), fat-mass-index (24) and fat-free-mass-index (15). Probes in genes SNED1 ( IRE-BP1 ), KLHL6 , WDR51A ( POC1A ), CYTH4-ELFN2 , CFLAR , PRDM14 , SOS1 , ZNF643 ( ZFP69B ), ST6GAL1 , C3orf7 0 , CILP2 , MLLT4 and ncRNA LOC101929268 remained significantly associated after Bonferroni-correction of P -values. We provide novel evidence linking DNAm with (i) altered lipid and glucose metabolism, (ii) diabetes and (iii) body size and composition in children. Both common and specific epigenetic signatures among measures were also revealed. The causal direction with phenotypic measures and stability of DNAm variants throughout the life course remains unclear and longitudinal analysis in other populations is required. These findings give support for potential epigenetic programming of body composition and obesity.
Shortened Infant Telomere Length Is Associated with Attention Deficit/Hyperactivity Disorder Symptoms in Children at Age Two Years: A Birth Cohort Study
Publisher: MDPI AG
Date: 21-04-2022
DOI: 10.3390/IJMS23094601
Abstract: Environmental factors can accelerate telomere length (TL) attrition. Shortened TL is linked to attention deficit/hyperactivity disorder (ADHD) symptoms in school-aged children. The onset of ADHD occurs as early as preschool-age, but the TL-ADHD association in younger children is unknown. We investigated associations between infant TL and ADHD symptoms in children and assessed environmental factors as potential confounders and/or mediators of this association. Relative TL was measured by quantitative polymerase chain reaction in cord and 12-month blood in the birth cohort study, the Barwon Infant Study. Early life environmental factors collected antenatally to two years were used to measure confounding. ADHD symptoms at age two years were evaluated by the Child Behavior Checklist Attention Problems (AP) and the Attention Deficit/Hyperactivity Problems (ADHP). Associations between early life environmental factors on TL or ADHD symptoms were assessed using multivariable regression models adjusted for relevant factors. Telomere length at 12 months (TL12), but not at birth, was inversely associated with AP (β = −0.56 95% CI (−1.13, 0.006) p = 0.05) and ADHP (β = −0.66 95% CI (−1.11, −0.21) p = 0.004). Infant secondhand smoke exposure at one month was independently associated with shorter TL12 and also higher ADHD symptoms. Further work is needed to elucidate the mechanisms that influence TL attrition and early neurodevelopment.
DNA methylation profiling highlights the unique nature of the human placental epigenome
Publisher: Future Medicine Ltd
Date: 10-2010
DOI: 10.2217/EPI.10.45
Abstract: As the ‘gateway’ to the fetus, the placenta is subject to a myriad of environmental factors, each with the potential to alter placental epigenetic and gene expression profile. This can have direct consequences for the developing fetus and potentially even long-term health implications. As a result, interest in placental epigenetics generally, and changes occurring in placenta-associated disease, has intensified over recent years. This article will discuss the general features of placental DNA methylation and will describe current technologies for profiling genome-wide DNA methylation patterns in this tissue, the approaches to data analysis and some of the major findings from recent studies.
Use of Monte Carlo simulation for the interpretation and analysis of diffuse scattering
Publisher: Informa UK Limited
Date: 02-2010
Immune responses to SARS-CoV-2 in three children of parents with symptomatic COVID-19
Publisher: Springer Science and Business Media LLC
Date: 11-11-2020
DOI: 10.1038/S41467-020-19545-8
Abstract: Compared to adults, children with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) have predominantly mild or asymptomatic infections, but the underlying immunological differences remain unclear. Here, we describe clinical features, virology, longitudinal cellular, and cytokine immune profile, SARS-CoV-2-specific serology and salivary antibody responses in a family of two parents with PCR-confirmed symptomatic SARS-CoV-2 infection and their three children, who tested repeatedly SARS-CoV-2 PCR negative. Cellular immune profiles and cytokine responses of all children are similar to their parents at all timepoints. All family members have salivary anti-SARS-CoV-2 antibodies detected, predominantly IgA, that coincide with symptom resolution in 3 of 4 symptomatic members. Plasma from both parents and one child have IgG antibody against the S1 protein and virus-neutralizing activity detected. Using a systems serology approach, we demonstrate higher levels of SARS-CoV-2-specific antibody features of these family members compared to healthy controls. These data indicate that children can mount an immune response to SARS-CoV-2 without virological confirmation of infection, raising the possibility that immunity in children can prevent the establishment of SARS-CoV-2 infection. Relying on routine virological and serological testing may not identify exposed children, with implications for epidemiological and clinical studies across the life-span.
Telomere Length and Vascular Phenotypes in a Population-Based Cohort of Children and Midlife Adults.
Publisher: Ovid Technologies (Wolters Kluwer Health)
Date: 04-06-2019
Abstract: Telomere length has been inversely associated with cardiovascular disease in adulthood, but its relationship to preclinical cardiovascular phenotypes across the life course remains unclear. We investigated associations of telomere length with vascular structure and function in children and midlife adults. Population‐based cross‐sectional CheckPoint (Child Health CheckPoint) study of 11‐ to 12‐year‐old children and their parents, nested within the LSAC (Longitudinal Study of Australian Children). Telomere length (telomeric genomic DNA [T]/β‐globin single‐copy gene [S] [T/S ratio]) was measured by quantitative polymerase chain reaction from blood‐derived genomic DNA. Vascular structure was assessed by carotid intima‐media thickness, and vascular function was assessed by carotid‐femoral pulse‐wave velocity and carotid elasticity. Mean (SD) T/S ratio was 1.09 (0.55) in children (n=1206 51% girls) and 0.81 (0.38) in adults (n=1343 87% women). Linear regression models, adjusted for potential confounders, revealed no evidence of an association between T/S ratio and carotid intima‐media thickness, carotid‐femoral pulse‐wave velocity, or carotid elasticity in children. In adults, longer telomeres were associated with greater carotid elasticity (0.14% per 10–mm Hg higher per unit of T/S ratio 95% CI, 0.04%–0.2% P =0.007), but not carotid intima‐media thickness (−0.9 μm 95% CI, −14 to 13 μm P =0.9) or carotid‐femoral pulse‐wave velocity (−0.10 m/s 95% CI, −0.3 to 0.07 m/s P =0.2). In logistic regression analysis, telomere length did not predict poorer vascular measures at either age. In midlife adults, but not children, there was some evidence that telomere length was associated with vascular elasticity but not thickness. Associations between telomere length and cardiovascular phenotypes may become more evident in later life, with advancing pathological changes.
Genome-wide average DNA methylation is determined in utero
Publisher: Oxford University Press (OUP)
Date: 06-03-2018
DOI: 10.1093/IJE/DYY028
Gene modifiers of cystic fibrosis lung disease: A systematic review
Publisher: Wiley
Date: 29-05-2019
DOI: 10.1002/PPUL.24366
Abstract: Lung disease is the major source of morbidity and mortality in cystic fibrosis (CF), with large variability in severity between patients. Although accurate prediction of lung disease severity would be extremely useful, no robust methods exist. Twin and sibling studies have highlighted the importance of non-cystic fibrosis transmembrane conductance regulator (CFTR) genes in determining lung disease severity but how these impact on the severity in CF remains unclear. A systematic review was undertaken to answer the question "In patients with CF which non-CFTR genes modify the severity of lung disease?" The method for this systematic review was based upon the "Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA)" statement, with a narrative synthesis of results planned. A total of 1168 articles were screened for inclusion, with 275 articles undergoing detailed assessment for inclusion. One hundred and forty articles were included. Early studies focused on candidate genes, whereas more recent studies utilized genome-wide approaches and also examined epigenetic mechanisms, gene expression, and therapeutic response. A large body of evidence regarding non-CFTR gene modifiers of lung disease severity has been generated, examining a wide array of genes. Limitations to existing studies include heterogeneity in outcome measures used, limited replication, and relative lack of clinical impact. Future work examining non-CFTR gene modifiers will have to overcome these limitations if gene modifiers are to have a meaningful role in the care of patients with CF.
Telomere length and lung function in a population-based cohort of children and mid-life adults.
Publisher: Wiley
Date: 27-08-2019
DOI: 10.1002/PPUL.24489
Abstract: Telomere length is associated with poorer lung health in older adults, possibly from cumulative risk factor exposure, but data are lacking in pediatric and population-based cohorts. We examined associations of telomere length with lung function in children and mid-life adults. Data were drawn from a population-based cross-sectional study of 11 to 12 year-olds and mid-life adults. Lung function was assessed by spirometric FEV Mean T/S ratio was 1.09 (n = 1206 SD 0.55) in children and 0.81 (n = 1343 SD 0.38) in adults. In adults, for every additional unit in T/S ratio, FEV Shorter telomere length showed moderate associations with poorer airflow parameters, but not vital capacity (lung volume) in mid-life adults. However, there was no convincing evidence of associations in children.
Methylation of the adenomatous polyposis coli (APC) gene in human placenta and hypermethylation in choriocarcinoma cells.
Publisher: Elsevier BV
Date: 09-2008
DOI: 10.1016/J.CANLET.2008.03.033
Abstract: Methylation of the human APC gene promoter is associated with several different types of cancers and has also been documented in some pre-cancerous tissues. We have examined the methylation of APC gene promoters in human placenta and choriocarcinoma cells. This revealed a general hypomethylation of the APC-1b promoter and a pattern with monoallelic methylation of the APC-1a promoter in full term placental tissue. However, there was no evidence of a parent-of-origin effect, suggesting random post zygotic origin of methylation. Increased methylation of this promoter was observed in all choriocarcinoma-derived trophoblast cell lines, suggesting a trophoblastic origin of placental APC methylation and implicating APC hypermethylation in the development of this group of gestational tumours. Our demonstration of placental methylation of the APC-1a promoter represents the first observation of monoallelic methylation of this gene in early development, and provides further support for a role of canonical Wnt signalling in placental trophoblast invasiveness. This also implicates tumour suppressor gene silencing as an integral part of normal human placental development.
Associations between birth size and later height from infancy through adulthood: An individual based pooled analysis of 28 twin cohorts participating in the CODATwins project
Publisher: Elsevier BV
Date: 05-2018
Single-crystal diffuse scattering studies on polymorphs of molecular crystals. I. the room-temperature polymorphs of the drug benzocaine
Publisher: International Union of Crystallography (IUCr)
Date: 19-05-2009
DOI: 10.1107/S0108768109015857
Abstract: The drug benzocaine (ethyl 4-aminobenzoate), commonly used as a local anaesthetic, is a bimorphic solid at room temperature. Form (I) is monoclinic P 2 1 / c , while the metastable form (II) is orthorhombic P 2 1 2 1 2 1 . Three-dimensional diffuse X-ray scattering data have been collected for the two forms on the 11-ID-B beamline at the Advanced Photon Source (APS). Both forms show strong and highly structured diffuse scattering. The data have been interpreted and analysed using Monte Carlo (MC) modelling on the basis that the scattering is purely thermal in origin and indicates the presence of highly correlated molecular motions. In both forms (I) and (II) broad diffuse streaks are observed in the 0 kl section which indicate strong longitudinal displacement correlations between molecules in the 〈031〉 directions, extending over distances of up to 50 Å. Streaks extending between Bragg peaks in the hk 0 section normal to [100] correspond to correlated motions of chains of molecules extending along a that are linked by N—H...O=C hydrogen bonds and which occur together as coplanar ribbon pairs. The main difference between the two forms is in the dynamical behaviour of the ribbon pairs and in particular how they are able to slide relative to each other. While for form (I) a model involving harmonic springs is able to describe the motion satisfactorily, as simple excursions away from the average structure, there is evidence in form (II) of anharmonic effects that are precursors of a phase transition to a new low-temperature phase, form (III), that was subsequently found.
Disorder in pentachloronitrobenzene, C6Cl5NO2: a diffuse scattering study
Publisher: International Union of Crystallography (IUCr)
Date: 17-07-2007
DOI: 10.1107/S0108768107024305
Abstract: Monte Carlo computer simulation has been used to interpret and model observed single-crystal diffuse X-ray scattering data for pentachloronitrobenzene, C 6 Cl 5 NO 2 . Each site in the crystal contains a molecule in one of six different basic orientations with equal probability. However, no short-range order amongst these different orientations has been detected. The strong, detailed and very distinctive diffraction patterns can be accounted for almost entirely on the assumption of random occupancy of each molecular site, but with very large local relaxation displacements that tend to increase the neighbouring distances for contacts involving NO 2 ...NO 2 and NO 2 ...Cl with a corresponding reduction for those involving Cl...Cl. The results show that the mean NO 2 ...NO 2 distance is increased by ∼ 0.6 Å, compared with that given by the average structure determination.
Clarifying the Sweeping Consequences of COVID-19 in Pregnant Women, Newborns, and Children With Existing Cohorts
Publisher: American Medical Association (AMA)
Date: 02-2020
Maternal nutritional history modulates the hepatic IGF–IGFBP axis in adult male rat offspring
Publisher: Springer Science and Business Media LLC
Date: 21-08-2013
DOI: 10.1007/S12020-013-0034-8
Abstract: Alterations in early life nutrition lead to an increased risk of obesity and metabolic syndrome in offspring. We have shown that both relative maternal undernutrition (UN) and maternal obesity result in metabolic derangements in offspring, independent of the postnatal dietary environment. Since insulin-like growth factor binding protein 2 (IGFBP2) has been shown to be independently associated with obesity and diabetes risk, we examined the IGF-IGFBP axis in male rat offspring following either maternal UN or maternal obesity to explain possible common pathways in the development of metabolic disorders. Wistar rats were time-mated and fed either a control diet (CONT), 50 % of CONT (UN) or a high-fat (HF) diet throughout pregnancy. Male offspring were weaned onto a standard chow diet and blood and tissues were collected at postnatal day 160. Plasma and hepatic tissue s les were analysed for key players in the IGF-IGFBP system. Both maternal UN and HF resulted in increased fat mass, hyperinsulinemia, hyperleptinemia and altered blood lipid profiles in offspring compared to CONT. Circulating IGF-1 and IGFBP3 levels and hepatic mRNA expression of IGFBP1 and IGFBP2 were significantly decreased in UN and HF offspring compared to CONT. DNA methylation of the IGFBP2 promotor region was similar between maternal dietary groups. Although chaperone gene heat-shock protein 90 and hepatic IGFBP1 were significantly correlated in CONT offspring this effect was absent in both UN and HF offspring. In conclusion, this study is one of the first to directly compare two experimental models of developmental programming representing both ends of the maternal dietary spectrum. Our data suggest that two disparate nutritional models that elicit similar adverse metabolic phenotypes in offspring are characterised by common alterations in the IGF-IGFBP pathway.
DNA methylation analysis of multiple tissues from newborn twins reveals both genetic and intrauterine components to variation in the human neonatal epigenome
Publisher: Oxford University Press (OUP)
Date: 10-08-2010
DOI: 10.1093/HMG/DDQ336
Abstract: Mounting evidence from both animal and human studies suggests that the epigenome is in constant drift over the life course in response to stochastic and environmental factors. In humans, this has been highlighted by a small number of studies that have demonstrated discordant DNA methylation patterns in adolescent or adult monozygotic (MZ) twin pairs. However, to date, it remains unclear when such differences emerge, and how prevalent they are across different tissues. To address this, we examined the methylation of four differentially methylated regions associated with the IGF2/H19 locus in multiple birth tissues derived from 91 twin pairs: 56 MZ and 35 dizygotic (DZ). Tissues included cord blood-derived mononuclear cells and granulocytes, human umbilical vein endothelial cells, buccal epithelial cells and placental tissue. Considerable variation in DNA methylation was observed between tissues and between unrelated in iduals. Most interestingly, methylation discordance was also present within twin pairs, with DZ pairs showing greater discordance than MZ pairs. These data highlight the variable contribution of both intrauterine environmental exposures and underlying genetic factors to the establishment of the neonatal epigenome of different tissues and confirm the intrauterine period as a sensitive time for the establishment of epigenetic variability in humans. This has implications for the effects of maternal environment on the development of the newborn epigenome and supports an epigenetic mechanism for the previously described phenomenon of 'fetal programming' of disease risk.
Differential methylation pattern of xenobiotic metabolizing genes and susceptibility to Balkan endemic nephropathy, in a cohort of Romanian patients
Publisher: Springer Science and Business Media LLC
Date: 20-06-2019
DOI: 10.1007/S40620-019-00621-2
Abstract: A severe, chronic and irreversible kidney disease affecting discrete rural populations in the Balkan Peninsula countries, Balkan endemic nephropathy (BEN) has been a scientific puzzle for more than half a century. Many environmental and other factors have been suggested as the primary cause and recent significant findings have linked BEN to aristolochic acids, phytotoxins derived from the plant Aristolochia clematitis, found in high density in the endemic areas. However, given that the incidence of BEN is less than 10% in affected villages, and it tends to have a family aggregation, as yet unidentified genetic factors may also play a role. To further explore this possibility, a pilot study was initiated to investigate the DNA methylation of CYP1A1, CYP1A2, NAT1, NQO1 and GSTT1 in blood s les from a group of Romanian BEN patients, compared to healthy controls and non-BEN chronic kidney disease (CKD) subjects. Our study revealed a more pronounced hypomethylation pattern in BEN and non-BEN CKD groups, compared to the healthy control group at specific CpGs across all five genes interrogated. Average methylation across the five regions investigated indicated significant differences only at GSTT1, in both BEN patients (p = 0.028) and non-BEN disease subjects (p = 0.015), relative to healthy in iduals. Since GSTT1 active genotype appears to be a common feature of Serbian and Romanian BEN patients, GSTT1 epigenetic variation and increased gene activity could act as a predisposing (co)factor in BEN populations from the affected countries. BEN and non-BEN CKD groups show similar methylation patterns with exception of GSTT1 CpG8 (p = 0.046).
Epigenetic dysregulation of naive CD4+ T-cell activation genes in childhood food allergy
Publisher: Springer Science and Business Media LLC
Date: 17-08-2018
DOI: 10.1038/S41467-018-05608-4
Abstract: Food allergy poses a significant clinical and public health burden affecting 2–10% of infants. Using integrated DNA methylation and transcriptomic profiling, we found that polyclonal activation of naive CD4+ T cells through the T cell receptor results in poorer lymphoproliferative responses in children with immunoglobulin E (IgE)-mediated food allergy. Reduced expression of cell cycle-related targets of the E2F and MYC transcription factor networks, and remodeling of DNA methylation at metabolic ( RPTOR , PIK3D , MAPK1 , FOXO1 ) and inflammatory genes ( IL1R , IL18RAP , CD82 ) underpins this suboptimal response. Infants who fail to resolve food allergy in later childhood exhibit cumulative increases in epigenetic disruption at T cell activation genes and poorer lymphoproliferative responses compared to children who resolved food allergy. Our data indicate epigenetic dysregulation in the early stages of signal transduction through the T cell receptor complex, and likely reflects pathways modified by gene–environment interactions in food allergy.
Local order in wüstite using a pair distribution function (PDF) approach
Publisher: Mineralogical Society
Date: 04-2014
DOI: 10.1180/MINMAG.2014.078.2.10
Abstract: We show how different aspects of a model of the complex disordered structure of wüstite, Fe 1−x O, affect the pair distribution function (PDF) and powder diffraction pattern. The aim is to assess the efficacy of using these techniques to determine details of local structure. The different aspects include the nature of the in idual defect clusters, the nature of the paracrystalline superlattice on which they are distributed and the ‘size-effect’ relaxation of the basic rocksalt FeO matrix around the defects. The results show that PDF data are sensitive to those aspects of the models that have a significant effect on the populations of interatomic spacings but are less able to determine correlation structures in the s les if these do not have a substantial interaction with interatomic separations.
Epigenetic Aberrations in Human Allergic Diseases
Publisher: Elsevier
Date: 2012
Polymorphous low-grade neuroepithelial tumor of the young (PLNTY): an epileptogenic neoplasm with oligodendroglioma-like components, aberrant CD34 expression, and genetic alterations involving the MAP
Publisher: Springer Science and Business Media LLC
Date: 03-11-2016
Birth size and gestational age in opposite-sex twins as compared to same-sex twins: An individual-based pooled analysis of 21 cohorts
Publisher: Springer Science and Business Media LLC
Date: 19-04-2018
DOI: 10.1038/S41598-018-24634-2
Abstract: It is well established that boys are born heavier and longer than girls, but it remains unclear whether birth size in twins is affected by the sex of their co-twin. We conducted an in idual-based pooled analysis of 21 twin cohorts in 15 countries derived from the COllaborative project of Development of Anthropometrical measures in Twins (CODATwins), including 67,850 dizygotic twin in iduals. Linear regression analyses showed that boys having a co-twin sister were, on average, 31 g (95% CI 18 to 45) heavier and 0.16 cm (95% CI 0.045 to 0.274) longer than those with a co-twin brother. In girls, birth size was not associated (5 g birth weight 95% CI −8 to −18 and −0.089 cm birth length 95% CI −0.202 to 0.025) with the sex of the co-twin. Gestational age was slightly shorter in boy-boy pairs than in boy-girl and girl-girl pairs. When birth size was standardized by gestational age, the magnitude of the associations was attenuated in boys, particularly for birth weight. In conclusion, boys with a co-twin sister are heavier and longer at birth than those with a co-twin brother. However, these differences are modest and partly explained by a longer gestation in the presence of a co-twin sister.
VariableDAXXgene methylation is a common feature of placental trophoblast differentiation, preeclampsia, and response to hypoxia
Publisher: Wiley
Date: 21-02-2017
Potential for novel biomarkers in diabetes-associated chronic kidney disease: Epigenome, metabolome, and gut microbiome
Publisher: MDPI AG
Date: 10-09-2020
DOI: 10.3390/BIOMEDICINES8090341
Abstract: Diabetes-associated chronic kidney disease is a pandemic issue. Despite the global increase in the number of in iduals with this chronic condition together with increasing morbidity and mortality, there are currently only limited therapeutic options to slow disease progression. One of the reasons for this is that the current-day “gold standard” biomarkers lack adequate sensitivity and specificity to detect early diabetic chronic kidney disease (CKD). This review focuses on the rapidly evolving areas of epigenetics, metabolomics, and the gut microbiome as potential sources of novel biomarkers in diabetes-associated CKD and discusses their relevance to clinical practice. However, it also highlights the problems associated with many studies within these three areas—namely, the lack of adequately powered longitudinal studies, and the lack of reproducibility of results which impede biomarker development and clinical validation in this complex and susceptible population.
Identification of Potential Biomarkers of Chronic Kidney Disease in Individuals with Diabetes: Protocol for a Cross-sectional Observational Study
Publisher: JMIR Publications Inc.
Date: 31-07-2020
DOI: 10.2196/16277
Abstract: The importance of identifying people with diabetes and progressive kidney dysfunction relates to the excess morbidity and mortality of this group. Rates of cardiovascular disease are much higher in people with both diabetes and kidney dysfunction than in those with only one of these conditions. By the time these people are identified in current clinical practice, proteinuria and renal dysfunction are already established, limiting the effectiveness of therapeutic interventions. The identification of an epigenetic or blood metabolite signature or gut microbiome profile may identify those with diabetes at risk of progressive chronic kidney disease, in turn providing targeted intervention to improve patient outcomes. This study aims to identify potential biomarkers in people with diabetes and chronic kidney disease (CKD) associated with progressive renal injury and to distinguish between stages of chronic kidney disease. Three sources of biomarkers will be explored, including DNA methylation profiles in blood lymphocytes, the metabolomic profile of blood-derived plasma and urine, and the gut microbiome. The cross-sectional study recruited 121 people with diabetes and varying stages (stages 1-5) of chronic kidney disease. Single-point data collection included blood, urine, and fecal s les in addition to clinical data such as anthropometric measurements and biochemical parameters. Additional information obtained from medical records included patient demographics, medical comorbidities, and medications. Data collection commenced in January 2018 and was completed in June 2018. At the time of submission, 121 patients had been recruited, and 119 s les remained after quality control. There were 83 participants in the early diabetes-associated CKD group with a mean estimated glomerular filtration rate (eGFR) of 61.2 mL/min/1.73 m2 (early CKD group consisting of stage 1, 2, and 3a CKD), and 36 participants in the late diabetic CKD group with a mean eGFR of 23.9 mL/min/1.73 m2 (late CKD group, consisting of stage 3b, 4, and 5), P .001. We have successfully obtained DNA for methylation and microbiome analyses using the biospecimens collected via this protocol and are currently analyzing these results together with the metabolome of this cohort of in iduals with diabetic CKD. Recent advances have improved our understanding of the epigenome, metabolomics, and the influence of the gut microbiome on the incidence of diseases such as cancers, particularly those related to environmental exposures. However, there is a paucity of literature surrounding these influencers in renal disease. This study will provide insight into the fundamental understanding of the pathophysiology of CKD in in iduals with diabetes, especially in novel areas such as epigenetics, metabolomics, and the kidney-gut axis. DERR1-10.2196/16277
Microbial exposure, interferon gamma gene demethylation in naïve T-cells, and the risk of allergic disease
Publisher: Wiley
Date: 23-02-2009
DOI: 10.1111/J.1398-9995.2009.01970.X
Abstract: The period of immune programming during early life presents a critical window of opportunity for the prevention of allergic diseases. There is mounting evidence that inappropriate immune programming may involve disruption of specific epigenetic modifications (switches) at immune-related genes. This novel area of research has great potential, as epigenetic changes are known to be sensitive to environmental factors and may therefore provide a mechanistic link for the observed association between specific environmental cues, faulty immune development, and the risk of allergic disease. In addition, the dynamic and potentially reversible nature of epigenetic modifications offers potentially novel targets for therapeutic and/or preventative interventions. We review the evidence that (1) failure to up-regulate the interferon gamma (IFNgamma) response during infancy is an important determinant of the risk of allergic disease, (2) expression of the IFNgamma gene in naïve T-cells is regulated by epigenetic mechanisms, and (3) failure to up-regulate IFNgamma gene expression of naïve T-cells associated with low early life microbial exposure. Taken together, these lines of evidence suggest that low microbial exposure during early life increases the risk of allergic disease by reducing demethylation (activation) of the IFNgamma gene of naive T-cells.
Host Genetic Control of the Oral Microbiome in Health and Disease
Publisher: Elsevier BV
Date: 09-2017
Altered immune cell profiles and impaired CD4 T cell activation in single and multi-food allergic adolescents.
Publisher: Wiley
Date: 08-03-2021
DOI: 10.1111/CEA.13857
Abstract: Approximately 5% of adolescents have a food allergy, with peanut and tree nut allergies the most common. Having two or more food allergies in adolescence also doubles the risk of any adverse food reaction, and is associated with increased dietary and social burden. Investigations of immune function in persistently food allergic children are rare. In the present study, we aimed to investigate the immune mechanisms that underlie food allergy in adolescence. We used high-dimensional flow cytometry, unsupervised computational analysis and functional studies to comprehensively phenotype a range of non-antigen-specific immune parameters in a group of well-characterized adolescents with clinically defined single peanut allergy, multi-food allergy and aged-matched non-food allergic controls. We show that food allergic adolescents have higher circulating proportions of dendritic cells (p = .0084, FDR-adjusted p = .087, median in no FA: 0.63% live cells, in FA: 0.93%), and higher frequency of activated, memory-like Tregs relative to non-food allergic adolescents (p = .011, FDR-adjusted p = .087, median in no FA: 0.49% live cells, in FA: 0.65%). Cytokine profiling revealed that CD3/CD28 stimulated naïve CD4 T cells from food allergic adolescents produced less IL-6 (p = .0020, FDR-adjusted p = .018, median log2 fold change [stimulated/unstimulated] in no FA: 3.03, in FA: 1.92) and TNFα (p = .0044, FDR-adjusted p = .020, median in no FA: 9.16, in FA: 8.64) and may secrete less IFNγ (p = .035, FDR-adjusted p = .11, median in no FA: 6.29, in FA: 5.67) than naïve CD4 T cells from non-food allergic controls. No differences between clinical groups were observed for LPS-stimulated monocyte secretion of cytokines. These results have important implications for understanding the evolution of the immune response in food allergy throughout childhood, revealing that dendritic cell and T-cell signatures previously identified in early life may persist through to adolescence.
DNA methylation analysis of candidate genes associated with dementia in peripheral blood
Publisher: Future Medicine Ltd
Date: 12-2020
Abstract: Aim: To investigate whether genes implicated in dementia pathogenesis are differently methylated in peripheral blood. Materials & methods: Participants included 160 cognitively healthy in iduals aged 70+ years: 73 who were subsequently diagnosed with dementia and 87 controls matched on age, gender, education, smoking and baseline cognition. A total of 49 participants also provided blood s les at diagnosis. Blood DNA methylation of APOE, APP, BDNF, PIN1, SNCA and TOMM40 was examined. Results: A total of 56 of 299 probes were differentially methylated in dementia compared with controls and 39 probes prior to diagnosis. The greatest effect size was in APP (cg19423170, Δ-8.32%, adjusted p = 0.009 at diagnosis cg19933173, Δ-4.18%, adjusted p 0.0001 prediagnosis). Conclusion: Genes implicated in dementia pathogenesis show differential blood methylation in dementia, even prior to diagnosis.
Epigenome-wide analysis of neonatal CD4+T-cell DNA methylation sites potentially affected by maternal fish oil supplementation
Publisher: Informa UK Limited
Date: 02-12-2014
A refinement strategy for Monte Carlo modelling of diffuse scattering from molecular crystal systems
Publisher: International Union of Crystallography (IUCr)
Date: 07-2010
DOI: 10.1107/S0021889810022260
Abstract: A new strategy for modelling diffuse scattering from molecular crystals using Monte Carlo simulation is described. The use of harmonic (Hooke's law) springs to represent effective intermolecular interactions is preserved, in order to minimize computer requirements, but use is now made of a simple empirical formula to specify spring constants and provide an objective means for limiting the number of springs needed to be used. The method has been tested on diffuse scattering data obtained for form I of paracetamol.
Upregulated LncZBTB39 in pre-eclampsia and its effects on trophoblast invasion and migration via antagonizing the inhibition of miR-210 on THSD7A expression
Publisher: Elsevier BV
Date: 05-2020
DOI: 10.1016/J.EJOGRB.2020.03.035
Abstract: Pre-ecl sia (PE) is a major cause of maternal morbidity and mortality, but its etiology remains to be elucidated. Accumulating evidence suggests that placental long noncoding RNAs (lncRNAs) might contribute to the pathogenesis of pre-ecl sia. In the present study, the expression levels of lncRNAs in human placenta were first determined by microarray analysis and then validated by secondary RT-qPCR and FISH. LncZBTB39 expression manipulation in HTR8/SVneo trophoblast cells was achieved by shRNA and plasmid transfection. Then, the invasion and migration of lncZBTB39-deficient and lncZBTB39-overexpressing trophoblast cells were evaluated by transwell assays and wound-healing assays, respectively. MMP2 activity was measured by gelatin zymography. The downstream target genes of lncZBTB39 were then identified by a transcriptomic microarray, followed by RT-qPCR validation. We found that lncZBTB39 was upregulated in PE-complicated human placentas, and overexpression of lncZBTB39 inhibited invasion and migration, as well as MMP2 activity in HTR8/SVneo cells, while downregulation of lncZBTB39 enhanced invasion, migration and MMP2 activity. In addition, THSD7A expression was elevated by lncZBTB39 overexpression but reduced in lncZBTB39-deficient cells moreover, lncZBTB39 antagonized the inhibitory effects of miR-210 on THSD7A expression. PE-complicated placentas are associated with upregulated lncZBTB39, which negatively regulates trophoblast invasion and migration, most likely by preserving the expression of THSD7A mRNA through sponging miR-210. The results of this study not only provide novel evidence that lncRNAs regulate trophoblastic activities but also suggest that lncZBTB39 may be a potential interventional target for PE.
Folate levels in pregnancy and offspring food allergy and eczema
Publisher: Wiley
Date: 24-10-2020
DOI: 10.1111/PAI.13128
Abstract: High folate status in pregnancy has been implicated in the increased prevalence of allergic disease, but there are no published data relating directly measured folate status in pregnancy to challenge-proven food allergy among offspring. The study aim was to examine the association between red blood cell (RBC) folate status in trimester three of pregnancy and allergic disease among offspring. Red blood cell folate levels were measured at 28-32 weeks' gestation in a prospective birth cohort (n = 1074). Food allergy outcomes were assessed in 1-year-old infants by skin prick testing and subsequent food challenge. Eczema was assessed by questionnaire and clinical review. High trimester three RBC folate was defined as greater than (>) 1360 nmol/L. Binomial regression was used to examine associations between trimester three RBC folate and allergic outcomes, adjusting for potential confounders. Red blood cell folate levels were measured in 88% (894/1064) of pregnant women. The mean concentration was 1695.6 nmol/L (standard deviation 415.4) with 82% (731/894) >1360 nmol/L. There was no evidence of either linear or non-linear relationships between trimester three RBC folate and allergic outcomes, nor evidence of associations between high RBC folate and food allergy (adjusted risk ratio (aRR) 2.89, 95% CI 0.90-9.35), food sensitization (aRR 1.72, 95% CI 0.85-3.49), or eczema (aRR 0.97, 95% CI 0.67-1.38). The majority of pregnant women in this study had high RBC folate levels. There was no evidence of associations between trimester three RBC folate and food allergy, food sensitization, or eczema among the offspring, although larger studies are required.
Association of infant feeding patterns with body fat mass and obesity in the first 2 years of life: a longitudinal twin birth cohort study
Publisher: Informa UK Limited
Date: 19-08-2021
DOI: 10.1080/09637486.2021.1968357
Abstract: Childhood obesity is a major public health problem with no effective intervention. We explored the influence of feeding patterns on infants' growth indices within the first 2 years in a twin birth cohort. Dietary intake at 12 months was recorded with a food frequency questionnaire, and dietary patterns were identified by principal component analysis. Milk feeding methods in first 6 months were categorised as breastfeeding or exclusive formula feeding. Correlations between feeding patterns and infants' growth indices were examined via generalised estimating equations. Two dietary patterns were identified and neither of which was related to growth indices. Breastfed infants had a higher body fat mass (BFM) percentage at 12 months, a higher body mass index (BMI) increment from birth to 6 months and a lower BMI increment from 6 to 12 months. Breastfed infants were likely positively correlated with BFM at 12 months as complementary food was added, the effect of breastfeeding on growth gradually decreased.
Differential gene expression and limited epigenetic dysregulation at the materno-fetal interface in preeclampsia
Publisher: Oxford University Press (OUP)
Date: 23-12-2019
DOI: 10.1093/HMG/DDZ287
Abstract: Despite the many advances made in the diagnosis and management of preecl sia, this syndrome remains a leading cause of maternal mortality and life-long morbidity, as well as adverse fetal outcomes. Successful prediction and therapeutic intervention require an improved understanding of the molecular mechanisms, which underlie preecl sia pathophysiology. We have used an integrated approach to discover placental genetic and epigenetic markers of preecl sia and validated our findings in an independent cohort of women. We observed the microRNA, MIR138, to be upregulated in singleton preecl tic placentas however, this appears to be a female infant sex-specific effect. We did not identify any significant differentially methylated positions (DMPs) in singleton pregnancies, indicating that DNA methylation changes in mild forms of the disease are likely limited. However, we identified infant sex-specific preecl sia-associated differentially methylated regions among singletons. Disease-associated DMPs were more obvious in a limited s ling of twin pregnancies. Interestingly, 2 out of the 10 most significant changes in methylation over larger regions overlap between singletons and twins and correspond to NAPRT1 and ZNF417.
Maternal dietary patterns and risk of gestational diabetes mellitus in twin pregnancies: a longitudinal twin pregnancies birth cohort study
Publisher: Springer Science and Business Media LLC
Date: 10-02-2020
DOI: 10.1186/S12937-020-00529-9
Abstract: Gestational diabetes mellitus (GDM) is correlated with an increased risk of adverse perinatal outcomes for both the mother and offspring. Previous research has reported correlations between maternal dietary patterns and GDM, but such evidence for twin pregnancies is lacking. This study aimed to identify maternal dietary patterns in the second trimester and investigate their relationships with the risk of GDM among women who were pregnant with twins in China. A longitudinal twin pregnancies birth cohort study of women who were pregnant with twins in China was conducted. Maternal dietary intake in the second trimester was recorded by using a food frequency questionnaire prior to the diagnosis of GDM among participants from the prospective twin pregnancies birth cohort in Chongqing City. GDM was diagnosed with a 75 g 2-h oral glucose tolerance test at 23–26 weeks of gestation. Dietary patterns were identified by principal components analysis, and the correlations between dietary pattern and GDM were examined using multivariable logistic regression analyses. Of the 324 participants, 101 (31.2%) were diagnosed with GDM. Four dietary patterns were identified: a vegetable-based pattern, a poultry-and-fruit-based pattern, a sweet-based pattern and a plant-protein-based pattern. Multivariate analysis showed that none of the dietary patterns were correlated with the risk of GDM among women who were pregnant with twins, but the sweet-based dietary pattern, which was associated with a higher GDM risk for quartile 4 versus quartile 1 (OR 2.69 95% CI: 1.09, 6.66) among non-overweight women (prepregnancy BMI 24.0). Dietary patterns were not correlated with later GDM risk among women who were pregnant with twins in western China, whereas a high intake of sweets was associated with a higher risk for GDM among women who were not overweight prior to pregnancy. ChiCTR-OOC-16008203 . Retrospectively registered on 1 April 2016.
Early-life determinants of hypoxia-inducible factor 3A gene (HIF3A) methylation: A birth cohort study
Publisher: Springer Science and Business Media LLC
Date: 07-2019
DNA methylation changes at infertility genes in newborn twins conceived by in vitro fertilisation
Publisher: Springer Science and Business Media LLC
Date: 24-03-2017
Simultaneous fitting of X-ray and neutron diffuse scattering data
Publisher: International Union of Crystallography (IUCr)
Date: 19-12-2007
Naïve regulatory T cells in infancy: Associations with perinatal factors and development of food allergy
Publisher: Wiley
Date: 02-06-2019
DOI: 10.1111/ALL.13822
Abstract: In previous studies, deficits in regulatory T-cell (Treg) number and function at birth have been linked with subsequent allergic disease. However, longitudinal studies that account for relevant perinatal factors are required. The aim of this study was to investigate the relationship between perinatal factors, naïve Treg (nTreg) over the first postnatal year and development of food allergy. In a birth cohort (n = 1074), the proportion of nTreg in the CD4 A higher proportion of nTreg at birth, larger birth size and male sex was each associated with higher nTreg in infancy. Exposure to labour, as compared to delivery by prelabour Caesarean section, was associated with a transient decrease nTreg. Infants that developed food allergy had decreased nTreg at birth, and the labour-associated decrease in nTreg at birth was more evident among infants with subsequent food allergy. Mode of birth was not associated with risk of food allergy, and there was no evidence that nTreg at either 6 or 12 months were related to food allergy. The proportion of nTreg at birth is a major determinant of the proportion present throughout infancy, highlighting the importance of prenatal immune development. Exposure to the inflammatory stimulus of labour appears to reveal differences in immune function among infants at risk of food allergy.
Stability of gene expression and epigenetic profiles highlights the utility of patient-derived paediatric acute lymphoblastic leukaemia xenografts for investigating molecular mechanisms of drug resistance
Publisher: Springer Science and Business Media LLC
Date: 06-2014
Supragingival plaque microbiome ecology and functional potential in the context of health and disease
Publisher: Cold Spring Harbor Laboratory
Date: 21-05-2018
DOI: 10.1101/325407
Abstract: To address the question of how microbial ersity and function in the oral cavities of children relates to caries diagnosis, we surveyed the supragingival plaque biofilm microbiome in 44 juvenile twin pairs. Using shotgun sequencing, we constructed a genome encyclopedia describing the core supragingival plaque microbiome. Caries phenotypes contained statistically significant enrichments in specific genome abundances and distinct community composition profiles including strain-level changes. Metabolic pathways that are statistically associated with caries include several sugar-associated phosphotransferase systems, antimicrobial resistance, and metal transport. Numerous closely-related previously-uncharacterized microbes had substantial variation in central metabolism, including the loss of biosynthetic pathways resulting in auxotrophy, changing the ecological role. We also describe the first complete Gracilibacteria genomes from the human microbiome. Caries is a microbial community metabolic disorder that cannot be described by a single etiology and our results provide the information needed for next generation diagnostic tools and therapeutics for caries.
B-cell phenotype and function in infants with egg allergy
Publisher: Wiley
Date: 17-01-2019
DOI: 10.1111/ALL.13707
Twin birth changes DNA methylation of subsequent siblings.
Publisher: Springer Science and Business Media LLC
Date: 16-08-2017
DOI: 10.1038/S41598-017-08595-6
Abstract: We asked if twin birth influences the DNA methylation of subsequent siblings. We measured whole blood methylation using the HumanMethylation450 array for siblings from two twin and family studies in Australia and Korea. We compared the means and correlations in methylation between pairs of siblings born before a twin birth (BT siblings), born on either side of a twin birth (B/AT pairs) and born after a twin birth (AT siblings). For the genome-wide average DNA methylation, the correlation for AT pairs (r AT ) was larger than the correlation for BT pairs (r BT ) in both studies, and from the meta-analysis, r AT = 0.46 (95% CI: 0.26, 0.63) and r BT = −0.003 (95% CI: −0.30, 0.29) ( P = 0.02). B/AT pairs were not correlated (from the meta-analysis r BAT = 0.08 95% CI: −0.31, 0.45). Similar results were found for the average methylation of several genomic regions, e.g., CpG shelf and gene body. BT and AT pairs were differentially correlated in methylation for 15 probes (all P 10 −7 ), and the top 152 differentially correlated probes (at P 10 −4 ) were enriched in cell signalling and breast cancer regulation pathways. Our observations are consistent with a twin birth changing the intrauterine environment such that siblings both born after a twin birth are correlated in DNA methylation.
Gestational diabetes mellitus-associated changes in the breast milk metabolome alters the neonatal growth trajectory
Publisher: Elsevier BV
Date: 06-2021
DOI: 10.1016/J.CLNU.2021.02.014
Abstract: Gestational diabetes mellitus (GDM) is the most common metabolic disturbance during pregnancy and leads to an altered metabolic profile of human breast milk (HBM). The association between HBM metabolites and neonatal growth in GDM pregnancies has not been thoroughly investigated. The primary aim was to quantify differences in the HBM metabolome between normal and GDM pregnancies. The secondary aim was to identify metabolites associated with neonatal growth during the first year postpartum. In the present study, mothers intending to exclusively breastfeed (BF) and their newborns (mother-infant pairs) were recruited at delivery (n = 129 normal pregnancies and n = 98 GDM pregnancies). HBM s les (colostrum, transition milk, and mature milk) from mothers with normal pregnancies (n = 50) and GDM pregnancies (n = 50) were subjected to metabolomic profiling via liquid chromatography tandem mass spectrometry (LC-MS/MS). Receiver operating characteristic (ROC) analysis revealed the metabolomic fingerprints of GDM-associated mature HBM. Correlations between metabolites and neonatal body weight gain (BWG) were evaluated by Spearman correlation analysis. In total, 620 metabolites were identified in each HBM s le 253 compounds had the same variation patterns, whereas 38 compounds had significantly different pattern transitions between the GDM and normal groups. Moreover, 12, 49 and 28 metabolites exhibited significant differences in the 3 milk types between the 2 groups. Twenty-two metabolites were confirmed by ROC analysis as metabolomic fingerprints in the mature BM of GDM patients. Ten compounds were significantly negatively correlated with neonatal growth, and only 2 unsaturated lipids (eicosatrienoic acid (FA 20:3) and lysophosphatidylcholine (LysoPC) (22:6)) were positively correlated with neonatal BWG. GDM is associated with alterations in the HBM metabolome. Only a small subset of compounds are associated with neonatal body weight (BW). ChiCTR-ROC-17011508. Prospectively registered on 26 May 2017 (www.chictr.org.cn/listbycreater.aspx).
ZNF397, a new class of interphase to early prophase-specific, SCAN-zinc-finger, mammalian centromere protein
Publisher: Springer Science and Business Media LLC
Date: 28-03-2008
DOI: 10.1007/S00412-008-0155-7
Abstract: The centromere is a complex structure required for equal segregation of newly synthesised sister chromatids at mitosis. One of the significant objectives in centromere research is to determine the complete repertoire of protein components that constitute the kinetochore. Here, we identify a novel centromere protein using a centromere-positive autoimmune serum from a patient with watermelon stomach disease. Western blot and screening of a lambda phage expression library revealed a 60-kDa protein, ZNF397. This protein belongs to the classical Cys(2)His(2) group of the zinc-finger protein superfamily and contains two conserved domains: a leucine-rich SCAN domain and nine Cys(2)His(2) zinc fingers. Bioinformatic analysis shows that ZNF397 is conserved in placental mammals. Stable GFP:ZNF397-expressing human cells show co-localisation of ZNF397 with the constitutive centromere protein CENP-A during interphase and early prophase. Deletion and domain-swap constructs indicate that the SCAN domain is necessary but not sufficient for centromere localisation. Gene-knockout studies in mice using the mouse orthologue (Zfp397) reveal that ZNF397 is a non-essential protein. These properties define ZNF397 as a member of a new class of interphase to early prophase-specific and SCAN domain-containing mammalian centromere protein. The possible role of this protein in transcription at the centromere is discussed.
Early life infection and proinflammatory, atherogenic metabolomic and lipidomic profiles in infancy: a population-based cohort study
Publisher: eLife Sciences Publications, Ltd
Date: 10-05-2022
DOI: 10.7554/ELIFE.75170
Abstract: The risk of adult onset cardiovascular and metabolic (cardiometabolic) disease accrues from early life. Infection is ubiquitous in infancy and induces inflammation, a key cardiometabolic risk factor, but the relationship between infection, inflammation, and metabolic profiles in early childhood remains unexplored. We investigated relationships between infection and plasma metabolomic and lipidomic profiles at age 6 and 12 months, and mediation of these associations by inflammation. Matched infection, metabolomics, and lipidomics data were generated from 555 infants in a pre-birth longitudinal cohort. Infection data from birth to 12 months were parent-reported (total infections at age 1, 3, 6, 9, and 12 months), inflammation markers (high-sensitivity C-reactive protein [hsCRP] glycoprotein acetyls [GlycA]) were quantified at 12 months. Metabolic profiles were 12-month plasma nuclear magnetic resonance metabolomics (228 metabolites) and liquid chromatography/mass spectrometry lipidomics (776 lipids). Associations were evaluated with multivariable linear regression models. In secondary analyses, corresponding inflammation and metabolic data from birth (serum) and 6-month (plasma) time points were used. At 12 months, more frequent infant infections were associated with adverse metabolomic (elevated inflammation markers, triglycerides and phenylalanine, and lower high-density lipoprotein [HDL] cholesterol and apolipoprotein A1) and lipidomic profiles (elevated phosphatidylethanolamines and lower trihexosylceramides, dehydrocholesteryl esters, and plasmalogens). Similar, more marked, profiles were observed with higher GlycA, but not hsCRP. GlycA mediated a substantial proportion of the relationship between infection and metabolome/lipidome, with hsCRP generally mediating a lower proportion. Analogous relationships were observed between infection and 6-month inflammation, HDL cholesterol, and apolipoprotein A1. Infants with a greater infection burden in the first year of life had proinflammatory and proatherogenic plasma metabolomic/lipidomic profiles at 12 months of age that in adults are indicative of heightened risk of cardiovascular disease, obesity, and type 2 diabetes. These findings suggest potentially modifiable pathways linking early life infection and inflammation with subsequent cardiometabolic risk. The establishment work and infrastructure for the BIS was provided by the Murdoch Children’s Research Institute (MCRI), Deakin University, and Barwon Health. Subsequent funding was secured from National Health and Medical Research Council of Australia (NHMRC), The Shepherd Foundation, The Jack Brockhoff Foundation, the Scobie & Claire McKinnon Trust, the Shane O’Brien Memorial Asthma Foundation, the Our Women’s Our Children’s Fund Raising Committee Barwon Health, the Rotary Club of Geelong, the Minderoo Foundation, the Ilhan Food Allergy Foundation, GMHBA, Vanguard Investments Australia Ltd, and the Percy Baxter Charitable Trust, Perpetual Trustees. In-kind support was provided by the Cotton On Foundation and CreativeForce. The study sponsors were not involved in the collection, analysis, and interpretation of data writing of the report or the decision to submit the report for publication. Research at MCRI is supported by the Victorian Government’s Operational Infrastructure Support Program. This work was also supported by NHMRC Senior Research Fellowships to ALP (1008396) DB (1064629) and RS (1045161) , NHMRC Investigator Grants to ALP (1110200) and DB (1175744), NHMRC-A*STAR project grant (1149047). TM is supported by an MCRI ECR Fellowship. SB is supported by the Dutch Research Council (452173113).
Maternal carriage of Prevotella during pregnancy associates with protection against food allergy in the offspring
Publisher: Springer Science and Business Media LLC
Date: 24-03-2020
DOI: 10.1038/S41467-020-14552-1
Abstract: In mice, the maternal microbiome influences fetal immune development and postnatal allergic outcomes. Westernized populations have high rates of allergic disease and low rates of gastrointestinal carriage of Prevotella , a commensal bacterial genus that produces short chain fatty acids and endotoxins, each of which may promote the development of fetal immune tolerance. In this study, we use a prebirth cohort ( n = 1064 mothers) to conduct a nested case-cohort study comparing 58 mothers of babies with clinically proven food IgE mediated food allergy with 258 randomly selected mothers. Analysis of the V4 region of the 16S rRNA gene in fecal s les shows maternal carriage of Prevotella copri during pregnancy strongly predicts the absence of food allergy in the offspring. This association was confirmed using targeted qPCR and was independent of infant carriage of P. copri . Larger household size, which is a well-established protective factor for allergic disease, strongly predicts maternal carriage of P. copri .
Assisted reproductive technologies are associated with limited epigenetic variation at birth that largely resolves by adulthood
Publisher: Springer Science and Business Media LLC
Date: 02-09-2019
DOI: 10.1038/S41467-019-11929-9
Abstract: More than 7 million in iduals have been conceived by Assisted Reproductive Technologies (ART) and there is clear evidence that ART is associated with a range of adverse early life outcomes, including rare imprinting disorders. The periconception period and early embryogenesis are associated with widespread epigenetic remodeling, which can be influenced by ART, with effects on the developmental trajectory in utero, and potentially on health throughout life. Here we profile genome-wide DNA methylation in blood collected in the newborn period and in adulthood (age 22–35 years) from a unique longitudinal cohort of ART-conceived in iduals, previously shown to have no differences in health outcomes in early adulthood compared with non-ART-conceived in iduals. We show evidence for specific ART-associated variation in methylation around birth, most of which occurred independently of embryo culturing. Importantly, ART-associated epigenetic variation at birth largely resolves by adulthood with no direct evidence that it impacts on development and health.
Vitamins D and A can be successfully measured by LC–MS/MS in cord blood diluted plasma
Publisher: Elsevier BV
Date: 11-2015
DOI: 10.1016/J.CLINBIOCHEM.2015.04.014
Abstract: In widely used protocols for the collection and isolation of cord blood mononuclear cells, investigators are left with substantial volumes of diluted plasma which could be used for other measurements. The aim of this study was to ascertain the validity of umbilical cord blood (UCB) diluted plasma s les for vitamin D, A and E analysis compared to UCB serum s les. Twenty UCB matched s les of diluted plasma and serum were collected. The s les were analysed by two liquid chromatography-tandem mass spectrometry (LC-MS/MS) methods on two separate occasions. The results of 25(OH)D3 obtained by the two laboratories demonstrated close agreement with a mean difference of 0.14nmol/L [95% confidence interval (95% CI), -6.8 to 7.1]. Both methods demonstrate close agreement for 25(OH)D3 in UCB serum versus diluted UCB plasma mean difference 2.2nmol/L [95% CI, -9.5 to 13.9] and 4.1nmol/L [95% CI, -14.5 to 6.1] for the results from Lab A and Lab B, respectively. Vitamin A was quantified by Lab A in UCB serum and diluted UCB plasma mean difference 0.07μmol/L [95% CI, -0.41 to 0.28]. Results of 25(OH)D3 epimer and vitamin E in the diluted UCB plasma were below the limit of quantification, and could not be compared with UCB serum. Diluted UCB plasma can be used for the quantification of retinol and 25(OH)D3 by LC-MS/MS. By contrast, quantification of 25(OH)D3 epimer and vitamin E in diluted UCB plasma is not supported by this study due to limitations in analytical sensitivity.
Advanced maternal age causes premature placental senescence and malformation via dysregulated α‐Klotho expression in trophoblasts
Publisher: Wiley
Date: 09-06-2021
DOI: 10.1111/ACEL.13417
Abstract: Advanced maternal age (AMA) pregnancy is associated with higher risks of adverse perinatal outcomes, which may result from premature senescence of the placenta. α‐Klotho is a well‐known antiaging protein however, its expression and effect on the placenta in AMA pregnancies have not yet been fully elucidated. The expression patterns of α‐Klotho in mouse and human placentas from AMA pregnancies were determined by Western blotting and immunohistochemistry (IHC) staining. α‐Klotho expression in JAR cells was manipulated to investigate its role in trophoblastic senescence, and transwell assays were performed to assess trophoblast invasion. The downstream genes regulated by α‐Klotho in JAR cells were first screened by mRNA sequencing in α‐Klotho‐knockdown and control JAR cells and then validated. α‐Klotho‐deficient mice were generated by injecting klotho ‐interfering adenovirus (Ad‐Klotho) via the tail vein on GD8.5. Ablation of α‐Klotho resulted in not only a senescent phenotype and loss of invasiveness in JAR cells but also a reduction in the transcription of cell adhesion molecule (CAM) genes. Overexpression of α‐Klotho significantly improved invasion but did not alter the expression of senescence biomarkers. α‐Klotho‐deficient mice exhibited placental malformation and, consequently, lower placental and fetal weights. In conclusion, AMA results in reduced α‐Klotho expression in placental trophoblasts, therefore leading to premature senescence and loss of invasion (possibly through the downregulation of CAMs), both of which ultimately result in placental malformation and adverse perinatal outcomes.
Association between birthweight and later body mass index: an individual-based pooled analysis of 27 twin cohorts participating in the CODATwins project
Publisher: Oxford University Press (OUP)
Date: 19-03-2017
DOI: 10.1093/IJE/DYX031
Low birth weight in MZ twins discordant for birth weight is associated with shorter telomere length and lower IQ, but not anxiety/depression in later life
Publisher: Cambridge University Press (CUP)
Date: 06-03-2015
DOI: 10.1017/THG.2015.3
Abstract: Shorter telomere length (TL) has found to be associated with lower birth weight and with lower cognitive ability and psychiatric disorders. However, the direction of causation of these associations and the extent to which they are genetically or environmentally mediated are unclear. Within-pair comparisons of monozygotic (MZ) and dizygotic (DZ) twins can throw light on these questions. We investigated correlations of within pair differences in telomere length, IQ, and anxiety/depression in an initial s le from Brisbane (242 MZ pairs, 245 DZ same sex (DZSS) pairs) and in replication s les from Amsterdam (514 MZ pairs, 233 DZSS pairs) and Melbourne (19 pairs selected for extreme high or low birth weight difference). Intra-pair differences of birth weight and telomere length were significantly correlated in MZ twins, but not in DZSS twins. Greater intra-pair differences of telomere length were observed in the 10% of MZ twins with the greatest difference in birth weight compared to the bottom 90% in both s les and also in the Melbourne s le. Intra-pair differences of telomere length and IQ, but not of TL and anxiety/depression, were correlated in MZ twins, and to a smaller extent in DZSS twins. Our findings suggest that the same prenatal effects that reduce birth weight also influence telomere length in MZ twins. The association between telomere length and IQ is partly driven by the same prenatal effects that decrease birth weight.
Can adult polygenic scores improve prediction of body mass index in childhood?
Publisher: Springer Science and Business Media LLC
Date: 03-05-2022
DOI: 10.1038/S41366-022-01130-2
Abstract: Modelling genetic pre-disposition may identify children at risk of obesity. However, most polygenic scores (PGSs) have been derived in adults, and lack validation during childhood. This study compared the utility of existing large-scale adult-derived PGSs to predict common anthropometric traits (body mass index (BMI), waist circumference, and body fat) in children and adults, and examined whether childhood BMI prediction could be improved by combining PGSs and non-genetic factors (maternal and earlier child BMI). Participants (n = 1365 children, and n = 2094 adults made up of their parents) were drawn from the Longitudinal Study of Australian Children. Children were weighed and measured every two years from 0-1 to 12-13 years, and adults were measured or self-reported measurements were obtained concurrently (average analysed). Participants were genotyped from blood or oral s les, and PGSs were derived based on published genome-wide association studies. We used linear regression to compare the relative utility of these PGSs to predict their respective traits at different ages. BMI PGSs explained up to 12% of child BMI z-score variance in 10-13 year olds, compared with up to 15% in adults. PGSs for waist circumference and body fat explained less variance (up to 8%). An interaction between BMI PGSs and puberty (p = 0.001-0.002) suggests the effect of some variants may differ across the life course. In idual BMI measures across childhood predicted 10-60% of the variance in BMI at 12-13 years, and maternal BMI and BMI PGS each added 1-9% above this. Adult-derived PGSs for BMI, particularly those derived by modelling between-variant interactions, may be useful for predicting BMI during adolescence with similar accuracy to that obtained in adulthood. The level of precision presented here to predict BMI during childhood may be relevant to public health, but is likely to be less useful for in idual clinical purposes.
Trimethylamine N-oxide (TMAO) Is not Associated with Cardiometabolic Phenotypes and Inflammatory Markers in Children and Adults.
Publisher: Elsevier BV
Date: 2020
DOI: 10.1093/CDN/NZAA179
Early life innate immune signatures of persistent food allergy
Publisher: Elsevier BV
Date: 09-2018
DOI: 10.1016/J.JACI.2017.10.024
Abstract: Food allergy naturally resolves in a proportion of food-allergic children without intervention however the underlying mechanisms governing the persistence or resolution of food allergy in childhood are not understood. This study aimed to define the innate immune profiles associated with egg allergy at age 1 year, determine the phenotypic changes that occur with the development of natural tolerance in childhood, and explore the relationship between early life innate immune function and serum vitamin D. This study used longitudinally collected PBMC s les from a population-based cohort of challenge-confirmed egg-allergic infants with either persistent or transient egg allergy outcomes in childhood to phenotype and quantify the functional innate immune response associated with clinical phenotypes of egg allergy. We show that infants with persistent egg allergy exhibit a unique innate immune signature, characterized by increased numbers of circulating monocytes and dendritic cells that produce more inflammatory cytokines both at baseline and following endotoxin exposure when compared with infants with transient egg allergy. Follow-up analysis revealed that this unique innate immune signature continues into childhood in those with persistent egg allergy and that increased serum vitamin D levels correlate with changes in innate immune profiles observed in children who developed natural tolerance to egg. Early life innate immune dysfunction may represent a key immunological driver and predictor of persistent food allergy in childhood. Serum vitamin D may play an immune-modulatory role in the development of natural tolerance.
Human fetoplacental arterial and venous endothelial cells are differentially programmed by gestational diabetes mellitus, resulting in cell-specific barrier function changes
Publisher: Springer Science and Business Media LLC
Date: 08-08-2018
Maternal Utero-Placental Perfusion Discordance in Monochorionic-Diamniotic Twin Pregnancies with Selective Growth Restriction Assessed by Three-Dimensional Power Doppler Ultrasound
Publisher: International Scientific Information, Inc.
Date: 17-01-2020
DOI: 10.12659/MSM.919247
Genotype-dependent associations between serotonin transporter gene (SLC6A4) DNA methylation and late-life depression
Publisher: Springer Science and Business Media LLC
Date: 04-09-2018
Reduced placental FOXP3 associated with subsequent infant allergic disease
Publisher: Elsevier BV
Date: 10-2011
Sexual Dimorphism in Innate Immunity: The Role of Sex Hormones and Epigenetics
Publisher: Frontiers Media SA
Date: 21-01-2021
DOI: 10.3389/FIMMU.2020.604000
Abstract: Sexual dimorphism refers to differences between biological sexes that extend beyond sexual characteristics. In humans, sexual dimorphism in the immune response has been well demonstrated, with females exhibiting lower infection rates than males for a variety of bacterial, viral, and parasitic pathogens. There is also a substantially increased incidence of autoimmune disease in females compared to males. Together, these trends indicate that females have a heightened immune reactogenicity to both self and non-self-molecular patterns. However, the molecular mechanisms driving the sexually dimorphic immune response are not fully understood. The female sex hormones estrogen and progesterone, as well as the male androgens, such as testosterone, elicit direct effects on the function and inflammatory capacity of immune cells. Several studies have identified a sex-specific transcriptome and methylome, independent of the well-described phenomenon of X-chromosome inactivation, suggesting that sexual dimorphism also occurs at the epigenetic level. Moreover, distinct alterations to the transcriptome and epigenetic landscape occur in synchrony with periods of hormonal change, such as puberty, pregnancy, menopause, and exogenous hormone therapy. These changes are also mirrored by changes in immune cell function. This review will outline the evidence for sex hormones and pregnancy-associated hormones as drivers of epigenetic change, and how this may contribute to the sexual dimorphism. Determining the effects of sex hormones on innate immune function is important for understanding sexually dimorphic autoimmune diseases, sex-specific responses to pathogens and vaccines, and how innate immunity is altered during periods of hormonal change (endogenous or exogenous).
Adolescence and the next generation
Publisher: Springer Science and Business Media LLC
Date: 22-02-2018
DOI: 10.1038/NATURE25759
Abstract: Adolescent growth and social development shape the early development of offspring from preconception through to the post-partum period through distinct processes in males and females. At a time of great change in the forces shaping adolescence, including the timing of parenthood, investments in today’s adolescents, the largest cohort in human history, will yield great idends for future generations.
Correlation between second trimester weight gain and perinatal outcomes in dichorionic twin pregnancies: The LoTiS cohort study
Publisher: Elsevier BV
Date: 02-2019
DOI: 10.1016/J.EJOGRB.2018.12.014
Abstract: To investigate how second trimester gestational weight gain relates to perinatal outcomes in twin pregnancies of the LoTiS cohort in Chongqing, China. A cohort study was conducted among women with dichorionic twin pregnancies pregnancies that culminated in delivery at ≥20 gestational weeks were included in the analysis (n = 177). Data were collected through the Longitudinal Twin Study (LoTiS). The second trimester was ided into two periods: 12-20 and 21-28 gestational weeks. Correlations between maternal weight gain and perinatal outcomes were estimated using linear or logistic regression models the crude OR and adjusted OR were calculated. The average total gestational weight gain for the whole pregnancy was 17.71 ± 4.98 kg and average gestational weight gains during 12-20 gestational weeks and 20-28 gestational weeks were 5.11 ± 1.81 kg and 5.84 ± 2.05 kg, respectively. Insufficient gestational weight gain was associated with higher risk of preterm birth (OR = 0.92, 95% CI 0.86-0.99) and spontaneous preterm birth (OR = 0.89, 95% CI 0.82-0.97). Reduced gestational weight gain during 12-20 gestational weeks was associated with higher risk of small for gestational age. Additionally, the mean birth weight of a twin pair increased by 45.78 g or 13.03 g when gestational weight gain during 12-20 weeks or total gestational weight gain increased by 1 kg. Maternal weight gain in the early second trimester was correlated with birth weight in dichorionic twins.
Maternal prenatal mental health and placental 11?-HSD2 gene expression: Initial findings from the mercy pregnancy and emotionalwellbeing study
Publisher: MDPI AG
Date: 17-11-2015
Genome-scale profiling reveals a subset of genes regulated by DNA methylation that program somatic T-cell phenotypes in humans
Publisher: Springer Science and Business Media LLC
Date: 12-04-2012
DOI: 10.1038/GENE.2012.7
Abstract: The aim of this study was to investigate the dynamics and relationship between DNA methylation and gene expression during early T-cell development. Mononuclear cells were collected at birth and at 12 months from 60 infants and were either activated with anti-CD3 for 24 h or cultured in media alone, and the CD4+ T-cell subset purified. DNA and RNA were co-harvested and DNA methylation was measured in 450 000 CpG sites in parallel with expression measurements taken from 25 000 genes. In unstimulated cells, we found that a subset of 1188 differentially methylated loci were associated with a change in expression in 599 genes (adjusted P value 0.1). These genes were enriched in reprogramming regions of the genome known to control pluripotency. In contrast, over 630 genes were induced following low-level T-cell activation, but this was not associated with any significant change in DNA methylation. We conclude that DNA methylation is dynamic during early T-cell development, and has a role in the consolidation of T-cell-specific gene expression. During the early phase of clonal expansion, DNA methylation is stable and therefore appears to be of limited importance in short-term T-cell responsiveness.
The potential for epigenetic analysis of paediatric CNS tumours to improve diagnosis, treatment and prognosis
Publisher: Elsevier BV
Date: 07-2015
Abstract: Tumours of central nervous system (CNS) origin are the second most prevalent group of cancers in children, yet account for the majority of childhood cancer-related deaths. Such tumours show erse location, cell type of origin, disease course and long-term outcome, both across and within tumour types, making treatment problematic and contributing to the relatively modest progress in reducing mortality over recent decades. As technological advances begin to reveal the genetic landscape of all cancers, it is becoming increasingly clear that genetic disruption represents only one 'layer' of molecular disruption associated with disease aetiology. Obtaining a full understanding of tumour behaviour requires an understanding of the cellular and molecular pathways disrupted during tumourigenesis, particularly in relation to gene expression. The utility of such an approach has allowed stratification of cancers such as medulloblastoma into subgroups based on molecular features, with potential to refine risk prediction. Given that epigenetic disruption is a universal feature of all human cancers, it is logical to speculate that interrogating epigenetic marks may help to further define the molecular profile, and therefore the clinical trajectory, of tumours. An integrated approach to build a molecular 'signature' of in idual tumours that incorporates traditional morphological and demographic information, genetic and transcriptome analysis, in addition to epigenomics (DNA methylation and non-coding RNA analysis), offers tremendous promise to (i) inform treatment approach, (ii) facilitate accurate early identification (preferably at diagnosis) of variable risk groups (both good and poor prognosis groups), and (iii) track disease progression in childhood CNS tumours.
Epigenetics: a missing link in understanding psychiatric disorders?
Publisher: Elsevier BV
Date: 2018
Neighbourhood socioeconomic circumstances, adiposity and cardiometabolic risk measures in children with severe obesity
Publisher: Elsevier BV
Date: 07-2019
DOI: 10.1016/J.ORCP.2019.05.004
Abstract: It has recently been shown that neighbourhood socioeconomic disadvantage in childhood is associated with obesity, hypertension, fatty liver, and type 2 diabetes in adulthood. However, it is largely unknown whether neighbourhood socioeconomic circumstances are important predictors of adiposity and associated measures in children, especially in those with severe obesity. Therefore, we evaluated the associations between neighbourhood socioeconomic factors with the severity of obesity, and related cardiometabolic risk factors in a cohort of obese children. The Childhood Overweight BioRepository of Australia (COBRA) cohort study comprises 444 children (mean age 11.1years, mean BMI z-score 2.5). Neighbourhood socioeconomic advantage/disadvantage was evaluated based on postcode information by the national Australian Socio-Economic Indexes for Areas (SEIFA) scores. Participants arents also completed self-administered questionnaires on neighbourhood related facilities, family education and family income. In analyses adjusted for age, sex and pubertal status, SEIFA indicating neighbourhood education/occupation was negatively associated with BMI, waist circumference and body fat%. Higher family education was associated with lower BMI. Neighbourhood walkability was related to lower waist circumference. Good shopping facilities in the neighbourhood were associated with increased risk of dyslipidemia and fatty liver, and the existence of parks and playgrounds nearby was related to dyslipidemia. The present data suggest that neighbourhood-related issues are associated with less severe adiposity among children with established obesity. Concerning cardiometabolic risk factors, shopping facilities were related to dyslipidemia and fatty liver. These findings suggest that increased awareness and efforts are needed to diminish socioeconomic inequalities between neighbourhoods.
A convergent model for placental dysfunction encompassing combined sub-optimal one-carbon donor and vitamin D bioavailability
Publisher: Elsevier BV
Date: 12-2009
DOI: 10.1016/J.MEHY.2009.03.057
Abstract: We hypothesise that the risk of placental dysfunction/insufficiency rises cumulatively in response to several interdependent risk factors that convergently regulate 1,25-dihydroxyvitamin D (the biologically active form of vitamin D, [1,25-(OH)(2)D]) levels at the feto-maternal interface. These factors include (i) disturbances in genetic or epigenetic regulation of one-carbon metabolism and/or vitamin D metabolism and (ii) insufficiency in maternal vitamin D or in dietary intake of micronutrients that are involved in one-carbon donation. We predict that the sub-optimal functioning of folate and vitamin D metabolic pathways, in concert, represents a potential novel risk pathway for adverse pregnancy outcomes. We base this prediction on five observations: In order to test this model, future epidemiological studies aimed at identifying risk factors for disorders linked to sub-optimal placental development and functioning, should: (a) measure circulating precursor molecules (including folate, vitamin B12, homocysteine, and vitamin D) in maternal and cord blood (b) collect s les for examination of genotypic variation in both one-carbon and vitamin D regulatory genes and, (c) collect s les for examination of epigenetic status of genes regulating vitamin D homeostasis and action in the placenta.
A child with Klinefelter syndrome and both IgE‐mediated food allergy and low proportion of naive Treg
Publisher: Wiley
Date: 07-01-2019
DOI: 10.1002/CCR3.1928
Perspective: Advancing Understanding of Population Nutrient-Health Relations via Metabolomics and Precision Phenotypes.
Publisher: Elsevier BV
Date: 11-2019
Monte Carlo Modeling of Diffuse Scattering from Single Crystals: The Program ZMC
Publisher: Springer Science and Business Media LLC
Date: 22-04-2010
Exploring the utility of human DNA methylation arrays for profiling mouse genomic DNA
Publisher: Elsevier BV
Date: 07-2013
DOI: 10.1016/J.YGENO.2013.04.014
Abstract: Illumina Infinium Human Methylation (HM) BeadChips are widely used for measuring genome-scale DNA methylation, particularly in relation to epigenome-wide association studies (EWAS) studies. The methylation profile of human s les can be assessed accurately and reproducibly using the HM27 BeadChip (27,578 CpG sites) or its successor, the HM450 BeadChip (482,421 CpG sites). To date no mouse equivalent has been developed, greatly hindering the application of this methodology to the wide range of valuable murine models of disease and development currently in existence. We found 1308 and 13,715 probes from HM27 and HM450 BeadChip respectively, uniquely matched the bisulfite converted reference mouse genome (mm9). We demonstrate reproducible measurements of DNA methylation at these probes in a range of mouse tissue s les and in a murine cell line model of acute myeloid leukaemia. In the absence of a mouse counterpart, the Infinium Human Methylation BeadChip arrays have utility for methylation profiling in non-human species.
Machine Learning SNP Based Prediction for Precision Medicine
Publisher: Frontiers Media SA
Date: 27-03-2019
Intrauterine programming of obesity and type 2 diabetes
Publisher: Springer Science and Business Media LLC
Date: 27-08-2019
Exploring the effect of antenatal depression treatment on children’s epigenetic profiles: findings from a pilot randomized controlled trial
Publisher: Springer Science and Business Media LLC
Date: 04-02-2019
Does acculturation affect one’s implicit leadership theories? Evidence from Chinese professionals in Australia and China
Publisher: Springer Science and Business Media LLC
Date: 02-12-2019
Transcription within a Functional Human Centromere
Publisher: Elsevier BV
Date: 08-2003
DOI: 10.1016/S1097-2765(03)00279-X
Abstract: Recent data in yeast and Drosophila suggest a domain-like centromere structure with a modified chromatin core and flanking regions of heterochromatin. We have analyzed a functional human centromere and defined a region of increased chromosome scaffold/matrix attachment that overlaps three other distinct and nonoverlapping domains for constitutive centromere proteins CENP-A and CENP-H, and heterochromatin protein HP1. Transcriptional competency is intact throughout the S/MAR-enriched region and within the CENP-A- and CENP-H-associated chromatin. These results provide insights into the relationship between centromeric chromatin and transcriptional competency in vivo, highlighting the permissibility of transcription within the constitutively modified, nonheterochromatic chromatin of a functional eukaryotic centromere.
Specific tumour-associated methylation in normal human term placenta and first-trimester cytotrophoblasts
Publisher: Oxford University Press (OUP)
Date: 16-08-2008
Abstract: Human placentation displays many similarities with tumourigenesis, including rapid cell ision, migration and invasion, overlapping gene expression profiles and escape from immune detection. Recent data have identified promoter methylation in the Ras association factor and adenomatous polyposis coli tumour suppressor genes as part of this process. However, the extent of tumour-associated methylation in the placenta remains unclear. Using whole genome methylation data as a starting point, we have examined this phenomenon in placental tissue. We found no evidence for methylation of the majority of common tumour suppressor genes in term placentas, but identified methylation in several genes previously described in some human tumours. Notably, promoter methylation of four independent negative regulators of Wnt signalling has now been identified in human placental tissue and purified trophoblasts. Methylation is present in baboon, but not in mouse placentas. This supports a role for elevated Wnt signalling in primate trophoblast invasiveness and placentation. Examination of invasive choriocarcinoma cell lines revealed altered methylation patterns consistent with a role of methylation change in gestational trophoblastic disease. This distinct pattern of tumour-associated methylation implicates a coordinated series of epigenetic silencing events, similar to those associated with some tumours, in the distinct features of normal human placental invasion and function.
Origins of lifetime health around the time of conception: causes and consequences
Publisher: Elsevier BV
Date: 05-2018
Vitamin D status in women with dichorionic twin pregnancies and their neonates: a pilot study in China
Publisher: Springer Science and Business Media LLC
Date: 08-04-2021
DOI: 10.1186/S12884-021-03707-7
Abstract: Vitamin D deficiency is a global public health issue in women and children and is associated with adverse impacts on child growth, such as rickets. However, prior studies have mainly focused on measuring vitamin D levels in singleton pregnant women and their offspring, and very limited studies have revealed the prevalence of vitamin D deficiency in twin pregnant women and their offspring. The aim of this study was to investigate vitamin D levels in twin-pregnant women and their neonates. We also explored the correlation of maternal vitamin D levels with neonatal outcomes and infant growth. A prospective subcohort investigation was carried out among 72 dichorionic, diamniotic twin-pregnant mothers and their twin offspring from the Longitudinal Twin Study. Peripheral blood was collected from the mothers in the third trimester, and cord blood was collected from neonates at birth to identify 25[OH]D levels. Data on the characteristics of the mothers and neonates were collected. Infant growth data and food sensitivities were also collected. The average maternal 25[OH]D level was 31.78 ng/mL, with 19.4% being deficient and 20.8% insufficient, while the average neonatal 25[OH]D level was 15.37 ng/mL, with 99.3% being deficiency or insufficient. A positive correlation was found between maternal and neonatal 25[OH]D levels (beta-value: 0.43, 95% CI: 0.37, 0.49). Interestingly, the higher the maternal 25[OH]D level was, the smaller the cotwin birthweight discordance (beta-value: -2.67, 95% CI: − 5.11, − 0.23). In addition, the infants of mothers with vitamin D deficiency were more likely to be allergic to foods at 6 months than those of mothers with vitamin D sufficiency. Twin neonates were at high risk of vitamin D deficiency, although their mothers’ vitamin D deficiency partially improved. Higher maternal vitamin D levels were associated with smaller discordance of cotwin birthweight. Chinese Clinical Trial Registry ChiCTR-OOC-16008203 , 1st April 2016.
Effect of common pregnancy and perinatal complications on offspring metabolic traits across the life course: a multi-cohort study
Publisher: Cold Spring Harbor Laboratory
Date: 07-04-2022
DOI: 10.1101/2022.04.05.22273388
Abstract: Common pregnancy and perinatal complications are associated with offspring cardiometabolic risk factors. These complications may influence multiple metabolic traits in offspring and these associations might differ with offspring age. We used data from eight population-based cohort studies to examine and compare associations of pre-ecl sia (PE), gestational hypertension (GH), gestational diabetes (GD), preterm birth (PTB), small (SGA) and large (LGA) for gestational age (vs. appropriate size for gestational age (AGA)) with up to 167 plasma/serum-based nuclear magnetic resonance-derived metabolic traits encompassing lipids, lipoproteins, fatty acids, amino acids, ketones, glycerides hospholipids, glycolysis, fluid balance, and inflammation. Confounder-adjusted regression models were used to examine associations (adjusted for maternal education, parity age at pregnancy, ethnicity, pre/early pregnancy body mass index and smoking, and offspring sex and age at metabolic trait assessment), and results were combined using meta-analysis by five age categories representing different periods of the offspring life course: neonates (cord blood), infancy (mean ages: 1.1-1.6y), childhood (4.2-7.5y) adolescence (12.0-16.0y), and adulthood (22.0-67.8y). Offspring numbers for each age category/analysis varied from 8,925 adults (441 PTB) to 1,181 infants (135 GD) 48.4% to 60.0% were females. Pregnancy complications (PE, GH, GD) were each associated with up to three metabolic traits in neonates ( P ≤0.001) with some limited evidence of persistence to older ages. PTB and SGA were associated with 32 and 12 metabolic traits in neonates respectively, which included an adjusted standardised mean difference of -0.89 standard deviation (SD) units for albumin with PTB (95%CI: -1.10 to -0.69, P =1.3×10 −17 ) and -0.41SD for total lipids in medium HDL with SGA (95%CI: -0.56 to -0.25, P =2.6×10 −7 ), with limited evidence of persistence to older ages. LGA was inversely associated with 19 metabolic traits including lower levels of cholesterol, lipoproteins, fatty acids, and amino acids, with associations emerging in adolescence, (e.g., -0.11SD total fatty acids , 95%CI: -0.18 to -0.05, P =0.0009), and attenuating with older age across adulthood. These reassuring findings suggest little evidence of wide-spread and long-term impact of common pregnancy and perinatal complications on offspring metabolic traits, with most associations only observed for new-borns rather than older ages, and for perinatal rather than pregnancy complications.
Multi-omics analysis from archival neonatal dried blood spots: limitations and opportunities.
Publisher: Walter de Gruyter GmbH
Date: 08-06-2022
Abstract: Newborn screening (NBS) programs operate in many countries, processing millions of dried bloodspot (DBS) s les annually. In addition to early identification of various adverse health outcomes, these s les have considerable potential as a resource for population-based research that could address key questions related to child health. The feasibility of archival DBS s les for emerging targeted and untargeted multi-omics analysis has not been previously explored in the literature. This review aims to critically evaluate the latest advances to identify opportunities and challenges of applying omics analyses to NBS cards in a research setting. Medline, Embase and PubMed databases were searched to identify studies utilizing DBS for genomic, proteomic and metabolomic assays. A total of 800 records were identified after removing duplicates, of which 23 records were included in this review. These papers consisted of one combined genomic/metabolomic, four genomic, three epigenomic, four proteomic and 11 metabolomic studies. Together they demonstrate that the increasing sensitivity of multi-omic analytical techniques makes the broad use of NBS s les achievable for large cohort studies. Maintaining the pre-analytical integrity of the DBS s le through storage at temperatures below −20 °C will enable this important resource to be fully realized in a research capacity.
Centromere proteins Cenpa, Cenpb, and Bub3 interact with poly(ADP-ribose) polymerase-1 protein and are poly(ADP-ribosyl)ated
Publisher: Elsevier BV
Date: 07-2002
Twin‐twin transfusion syndrome is associated with alterations in the metabolic profile of maternal plasma in early gestation: a pilot study
Publisher: Wiley
Date: 23-03-2021
DOI: 10.1002/PD.5933
Abstract: Twin‐twin transfusion syndrome (TTTS) causes perinatal mortality and morbidity in monochorionic twins. The early recognition of and interventional therapy for TTTS is associated with a more favorable overall prognosis. However, the prediction by the use of ultrasound in the first trimester has relatively poor sensitivity and specificity. This study aimed to identify metabolic biomarkers to aid in ultrasound screening of TTTS. Maternal plasma was prospectively collected between 11 and 15 weeks of gestation in apparently uncomplicated monochorionic‐diamniotic twin pregnancies. This cohort was ided into: (i) patients who were subsequently diagnosed with TTTS by using ultrasound (ii) uncomplicated matched controls. Metabolome was profiled by using gas chromatography‐mass spectrometry. The levels of fatty acids, organic acids, oxaloacetic acid, and beta‐alanine were significantly lower in the TTTS maternal plasma at 11–15 weeks of gestation, and methionine and glycine were also higher ( p 0.05, FDR .12). Generally, in TTTS pregnancies, the metabolisms of amino acid, carbohydrate, cofactors, vitamins, and purine were “down‐regulated” whereas bile secretion and pyrimidine metabolism were “upregulated.” The metabolomics scanning of early gestation maternal plasma may identify those pregnancies that subsequently develop TTTS in particular, downregulated fatty acid levels may be biologically plausible to be implicated in the pathogenesis of TTTS.
Neonatal BCG vaccination is associated with a long-term DNA methylation signature in circulating monocytes
Publisher: American Association for the Advancement of Science (AAAS)
Date: 05-08-2022
Abstract: Trained immunity describes the capacity of innate immune cells to develop heterologous memory in response to certain exogenous exposures. This phenomenon mediates, at least in part, the beneficial off-target effects of the BCG vaccine. Using an in vitro model of trained immunity, we show that BCG exposure induces a persistent change in active histone modifications, DNA methylation, transcription, and adenosine-to-inosine RNA modification in human monocytes. By profiling DNA methylation of circulating monocytes from infants in the MIS BAIR clinical trial, we identify a BCG-associated DNA methylation signature that persisted more than 12 months after neonatal BCG vaccination. Genes associated with this epigenetic signature are involved in viral response pathways, consistent with the reported off-target protection against viral infections in neonates, adults, and the elderly. Our findings indicate that the off-target effects of BCG in infants are accompanied by epigenetic remodeling of circulating monocytes that lasts more than 1 year.
Trisomy 20p resulting from inverted duplication and neocentromere formation
Publisher: Wiley
Date: 06-08-1999
DOI: 10.1002/(SICI)1096-8628(19990806)85:4<403::AID-AJMG18>3.0.CO;2-R
A Cross-Cohort Study Examining the Associations of Metabolomic Profile and Subclinical Atherosclerosis in Children and Their Parents: The Child Health CheckPoint Study and Avon Longitudinal Study of Parents and Children.
Publisher: Ovid Technologies (Wolters Kluwer Health)
Date: 16-07-2019
Abstract: High‐throughput nuclear magnetic resonance profiling of circulating metabolites is suggested as an adjunct for cardiovascular risk evaluation. The relationship between metabolites and subclinical atherosclerosis remains unclear, particularly among children. Therefore, we examined the associations of metabolites with carotid intima‐media thickness ( cIMT ) and arterial pulse wave velocity ( PWV ). Data from two independent population‐based studies was examined (1) cross‐sectional associations with cIMT and PWV in 1178 children (age 11–12 years, 51% female) and 1316 parents (mean age 45 years, 87% female) from the CheckPoint study (Australia) and (2) longitudinal associations in 4249 children (metabolites at 7–8 years, PWV at 10–11 years, 52% female), and cross‐sectional associations in 4171 of their mothers (mean age 48 years, cIMT data) from ALSPAC (The Avon Longitudinal Study of Parents and Children UK ). Metabolites were measured by the same nuclear magnetic resonance platform in both studies, comprising of 69 biomarkers. Biophysical assessments included body mass index, blood pressure, cIMT and PWV . In linear regression analyses adjusted for age, sex, body mass index, and blood pressure, there was no evidence of metabolite associations in either children or adults for cIMT at a 10% false discovery threshold. In CheckPoint adults, glucose was positively, and some high‐density lipoprotein‐cholesterol derived measures and amino acids (glutamine, histidine, tyrosine) inversely associated with PWV. These data suggest that in children circulating metabolites have no consistent association with cIMT and PWV once adjusted for body mass index and blood pressure. In their middle‐aged parents, some evidence of metabolite associations with PWV were identified that warrant further investigation.
Single Cell Flow Cytometry Profiling of Bronchoalveolar Lavage in Children
Publisher: American Thoracic Society
Date: 08-2020
The role of glucocorticoid and mineralocorticoid receptor DNA methylation in antenatal depression and infant stress regulation
Publisher: Elsevier BV
Date: 05-2020
Genetic variation, intrauterine growth, and adverse pregnancy conditions predict leptin gene DNA methylation in blood at birth and 12 months of age
Publisher: Springer Science and Business Media LLC
Date: 21-10-2020
DOI: 10.1038/S41366-019-0472-3
Abstract: Leptin regulates satiety and energy homoeostasis, and plays a key role in placentation in pregnancy. Previous studies have demonstrated regulation of leptin gene (LEP) expression and/or methylation in placenta and cord blood in association with early life exposures, but most have been small and have not considered the influence of genetic variation. Here, we investigated the relationship between maternal factors in pregnancy, infant anthropometry and LEP genetic variation with LEP promoter methylation at birth and 12 months of age. LEP methylation was measured in cord (n = 877) and 12-month (n = 734) blood in the Barwon Infant Study, a population-based pre-birth cohort. Infant adiposity at birth and 12-months was measured as triceps and subscapular skinfold thickness. Cross-sectional regression tested associations of methylation with pregnancy and anthropometry measures, while longitudinal regression tested if birth anthropometry predicted 12-month LEP methylation levels. Male infants had lower LEP methylation in cord blood (-2.07% average methylation, 95% CI (-2.92, -1.22), p < 0.001). Genetic variation strongly influenced DNA methylation at a single CpG site, which was also negatively associated with birth weight (r = -0.10, p = 0.003). Pre-ecl sia was associated with lower cord blood methylation at another CpG site (-6.06%, 95% CI (-10.70, -1.42), p = 0.01). Gestational diabetes was more modestly associated with methylation at two other CpG units. Adiposity at birth was associated with 12-month LEP methylation, modified by rs41457646 genotype. There was no association of LEP methylation with 12-month anthropometric measures. Infant sex, weight, genetic variation, and exposure to pre-ecl sia and gestational diabetes, are associated with LEP methylation in cord blood. Infant adiposity at birth predicts 12-month blood LEP methylation in a genotype-dependent manner. These findings are consistent with genetics and anthropometry driving altered LEP epigenetic profile and expression in infancy. Further work is required to confirm this and to determine the long-term impact of altered LEP methylation on health.
DNA methylation and miRNA expression profiling in childhood B-cell acute lymphoblastic leukemia.
Publisher: Future Medicine Ltd
Date: 10-2010
DOI: 10.2217/EPI.10.39
Abstract: Acute lymphoblastic leukemia (ALL) is the most common cancer in children in the modern world. Recent efforts in characterizing the genetic contribution to this disease through uncovering gene mutations, deletions and structural variation by genome-scale methods have only accounted for a modest proportion of children with ALL. This suggests that either further genetic contributions to ALL have yet to be characterized or other factors, such as epigenetic aberrations are involved. A number of DNA methylation and miRNA profiling studies have investigated the role of both in childhood ALL. Here, we review these profiling efforts, summarize their major findings and speculate as to what the future may hold.
Construction of neocentromere-based human minichromosomes by telomere-associated chromosomal truncation
Publisher: Proceedings of the National Academy of Sciences
Date: 05-2001
Abstract: Neocentromeres (NCs) are fully functional centromeres that arise ectopically in noncentromeric regions lacking α-satellite DNA. Using telomere-associated chromosome truncation, we have produced a series of minichromosomes (MiCs) from a mardel(10) marker chromosome containing a previously characterized human NC. These MiCs range in size from ≈0.7 to 1.8 Mb and contain single-copy intact genomic DNA from the 10q25 region. Two of these NC-based Mi-Cs (NC-MiCs) appear circular whereas one is linear. All demonstrate stability in both structure and mitotic transmission in the absence of drug selection. Presence of a functional NC is shown by binding a host of key centromere-associated proteins. These NC-MiCs provide direct evidence for mitotic segregation function of the NC DNA and represent ex les of stable mammalian MiCs lacking centromeric repeats.
Normal DNA Methylation Dynamics in DICER1-Deficient Mouse Embryonic Stem Cells
Publisher: Public Library of Science (PLoS)
Date: 06-09-2012
Immune responses to SARS-CoV-2 in children of parents with symptomatic COVID-19
Publisher: Research Square Platform LLC
Date: 28-07-2020
DOI: 10.21203/RS.3.RS-47021/V1
Abstract: Compared to adults, children with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) have mild or asymptomatic infection, but the underlying immunological differences remain unclear. We describe clinical features, virology, longitudinal cellular and cytokine immune profile, SARS-CoV-2-specific serology and salivary antibody responses in a family of two parents with PCR-confirmed symptomatic SARS-CoV-2 infection and their three children, who were repeatedly SARS-CoV-2 PCR negative. Cellular immune profiles and cytokine responses of all children were similar to their parents at all timepoints. All family members had salivary anti-SARS-CoV-2 antibodies detected, predominantly IgA, that coincided with symptom resolution in 3 of 4 symptomatic members. Plasma from both parents and one child had IgG antibody detected against the S1 protein and virus neutralising activity ranging from just detectable to robust titers. Using a systems serology approach, we show that all family members demonstrated higher levels of SARS-CoV-2-specific antibody features than healthy controls. These data indicate that children can mount an immune response to SARS-CoV-2 without virological evidence of infection. This raises the possibility that despite chronic exposure, immunity in children prevents establishment of SARS-CoV-2 infection. Relying on routine virological and serological testing may therefore not identify exposed children, with implications for epidemiological and clinical studies across the life-span.
Association of Assisted Reproductive Technologies with offspring cord blood DNA methylation across cohorts
Publisher: Cold Spring Harbor Laboratory
Date: 20-06-2020
DOI: 10.1101/2020.06.18.20134940
Abstract: Is DNA methylation at birth associated with having been conceived by assisted reproductive technologies (ART)? This study shows does not provide strong evidence of an association of conception by ART with variation in infant blood cell DNA methylation. Assisted reproductive technologies (ART) are procedures used to help infertile/subfertile couples conceive. Due to its importance in gene regulation during early development programming, DNA methylation and its perturbations associated with ART could reveal new insights into the biological effects of ART and potential adverse offspring outcomes. We investigated the association of DNA methylation and ART using a case-control study design (N=205 ART cases and N=2439 non-ART controls in discovery cohorts N=149 ART cases and N=58 non-ART controls in replication cohort). We assessed the association between ART and DNA methylation at birth in cord blood (205 ART conceptions and 2439 naturally conceived controls) at CpG sites across the genome in two sub-s les of the UK Avon Longitudinal Study of Parents and Children (ALSPAC) and two sub-s les of the Norwegian Mother, Father and Child Cohort Study (MoBa) by meta-analysis. We explored replication of findings in the Australian Clinical review of the Health of adults conceived following Assisted Reproductive Technologies (CHART) study (N=149 ART conceptions and N=58 controls). The ALSPAC and MoBa meta-analysis revealed evidence of association between conception by ART and DNA methylation (false-discovery-rate-corrected p-value 0.05) at 5 CpG sites which are annotated to 2 genes. Methylation at 3 of these sites has been previously linked to cancer, aging, HIV infection and neurological diseases. None of these associations replicated in the CHART cohort. There was evidence of a functional role of ART-induced hypermethylation at CpG sites located within regulatory regions as shown by putative transcription factor binding and chromatin remodelling. While insufficient power is likely, heterogeneity in types of ART and between populations may also contribute. Larger studies might identify replicable variation in DNA methylation at birth due to ART. ART-conceived newborns present with ergent DNA methylation in cord blood white cells. If these associations are true and causal, they might have long-term consequences for offspring health.
CD39/CD73 Dysregulation of Adenosine Metabolism Increases Decidual Natural Killer Cell Cytotoxicity: Implications in Unexplained Recurrent Spontaneous Abortion
Publisher: Frontiers Media SA
Date: 10-02-2022
DOI: 10.3389/FIMMU.2022.813218
Abstract: Unexplained recurrent spontaneous abortion (URSA) is believed to be associated with impaired immunosuppression at the maternal-fetal interface, but the detailed molecular mechanism remains unclear. The ATP-adenosine metabolic pathway regulated by CD39/CD73 has recently been recognized to be important in immunosuppression. This study aimed to investigate the regulation of decidual natural killer (dNK) cells and fetal extravillous trophoblast (EVT) cells by CD39 and CD73 in URSA, as well as the possible regulatory mechanism of CD39/CD73 via the TGF-β-mTOR-HIF-1α pathway using clinical s les and cell models. Fewer CD39 + and CD73 + cells were found in the URSA decidual and villous tissue, respectively. Inhibition of CD39 on dNK cells transformed the cells to an activated state with increased toxicity and decreased apoptosis, and changed their cytokine secretion, leading to impaired invasion and proliferation of the co-cultured HTR8/SVneo cells. Similarly, inhibition of CD73 on HTR8/SVneo cells decreased the adenosine concentration in the cell culture media, increased the proportion of CD107a + dNK cells, and decreased the invasion and proliferation capabilities of the HTR8/SVneo cells. In addition, transforming growth factor-β (TGF-β) triggered phosphorylation of mammalian target of rapamycin (mTOR) and Smad2/Smad3, which subsequently activated hypoxia-inducible factor-1α (HIF-1α) to induce the CD73 expression on the HTR8/SVneo cells. In summary, reduced numbers of CD39 + and CD73 + cells at the maternal-fetal interface, which may be due to downregulated TGF-β-mTOR-HIF-1α pathway, results in reduced ATP-adenosine metabolism and increased dNK cytotoxicity, and potentially contributes to URSA occurrences.
Genetic and environmental influences on height from infancy to early adulthood: An individual-based pooled analysis of 45 twin cohorts
Publisher: Springer Science and Business Media LLC
Date: 23-06-2016
DOI: 10.1038/SREP28496
Abstract: Height variation is known to be determined by both genetic and environmental factors, but a systematic description of how their influences differ by sex, age and global regions is lacking. We conducted an in idual-based pooled analysis of 45 twin cohorts from 20 countries, including 180,520 paired measurements at ages 1–19 years. The proportion of height variation explained by shared environmental factors was greatest in early childhood, but these effects remained present until early adulthood. Accordingly, the relative genetic contribution increased with age and was greatest in adolescence (up to 0.83 in boys and 0.76 in girls). Comparing geographic-cultural regions (Europe, North-America and Australia and East-Asia), genetic variance was greatest in North-America and Australia and lowest in East-Asia, but the relative proportion of genetic variation was roughly similar across these regions. Our findings provide further insights into height variation during childhood and adolescence in populations representing different ethnicities and exposed to different environments.
Early life environmental factors associated with autism spectrum disorder symptoms in children at age 2 years: A birth cohort study
Publisher: SAGE Publications
Date: 11-01-2022
DOI: 10.1177/13623613211068223
Abstract: Mounting evidence finds that early life environmental factors increased the probability of autism spectrum disorder. We estimated prospective associations between early life environmental factors and autism spectrum disorder symptoms in children at the age of 2 years in a population-derived birth cohort, the Barwon Infant Study. Autism spectrum disorder symptoms at the age of 2 years strongly predicted autism spectrum disorder diagnosis by the age of 4 years (area under curve = 0.93 95% CI (0.82, 1.00)). After adjusting for child’s sex and age at the time of behavioural assessment, markers of socioeconomic disadvantage, such as lower household income and lone parental status maternal health factors, including younger maternal age, maternal pre-pregnancy body mass index, higher gestational weight gain and prenatal maternal stress prenatal alcohol environmental air pollutant exposures, including particulate matter 2.5 µm at birth, child secondhand tobacco smoke exposure at 12 months, d ness/mould and home heating with oil, kerosene or diesel heaters at 2 years postnatal. Lower socioeconomic indexes for area, later birth order, higher maternal prenatal depression, and maternal smoking frequency had a dose-response relationship with autism spectrum disorder symptoms. Future studies on environmental factors and autism spectrum disorder should consider the reasons for the socioeconomic disparity and the combined impact of multiple environmental factors through common mechanistic pathways. Mounting evidence indicates the contribution of early life environmental factors in autism spectrum disorder. We aim to report the prospective associations between early life environmental factors and autism spectrum disorder symptoms in children at the age of 2 years in a population-derived birth cohort, the Barwon Infant Study. Autism spectrum disorder symptoms at the age of 2 years strongly predicted autism spectrum disorder diagnosis by the age of 4 years (area under curve = 0.93 95% CI (0.82, 1.00)). After adjusting for child’s sex and age at the time of behavioural assessment, markers of socioeconomic disadvantage, such as lower household income and lone parental status maternal health factors, including younger maternal age, maternal pre-pregnancy body mass index, higher gestational weight gain and prenatal maternal stress maternal lifestyle factors, such as prenatal alcohol and environmental air pollutant exposures, including particulate matter 2.5 μm at birth, child secondhand tobacco smoke at 12 months, d ness/mould and home heating with oil, kerosene or diesel heaters at 2 years postnatal. Lower socioeconomic indexes for area, later birth order, higher maternal prenatal depression and maternal smoking frequency had a dose-response relationship with autism spectrum disorder symptoms. Future studies on environmental factors and autism spectrum disorder should consider the reasons for the socioeconomic disparity and the combined impact of multiple environmental factors through common mechanistic pathways.
17 beta-hydroxysteroid dehydrogenase type XI localizes to human steroidogenic cells
Publisher: The Endocrine Society
Date: 05-2003
Abstract: We searched expressed sequence tag databases with conserved domains of the short-chain alcohol dehydrogenase superfamily and identified another isoform of 17β-hydroxysteroid dehydrogenase, 17βHSDXI. This enzyme converts 5α-androstane-3α, 17β-diol to androsterone. The substrate has been implicated in supporting gestation and modulating γ-aminobutyric acid receptor activity. 17βHSDXI is colinear with human retinal short-chain dehydrogenase/reductase retSDR2, a protein with no known biological activity (accession no. AAF06939). Of the proteins with known function, 17βHSDXI is most closely related to the retinol-metabolizing enzyme retSDR1, with which it has 30% identity. There is a polymorphic stretch of 15 adenosines in the 5′ untranslated region of the cDNA sequence and a silent polymorphism at C719T. A 17βHSDXI construct with a stretch of 20 adenosines was found to produce significantly more enzyme activity than constructs containing 15 or less adenosines (43% vs. 26%, P & 0.005). The C719T polymorphism is present in 15% of genomic DNA s les. Northern blot analysis showed high levels of 17βHSDXI expression in the pancreas, kidney, liver, lung, adrenal, ovary, and heart. Immunohistochemical staining for 17βHSDXI is strong in steroidogenic cells such as syncytiotrophoblasts, sebaceous gland, Leydig cells, and granulosa cells of the dominant follicle and corpus luteum. In the adrenal 17βHSDXI, staining colocalized with the distribution of 17α-hydroxylase but was stronger in the mid to outer cortex. 17βHSDXI was also found in the fetus and increased after birth. Liver parenchymal cells and epithelium of the endometrium and small intestine also stained. Regulation studies in mouse Y1 cells showed that cAMP down-regulates 17βHSDXI enzymatic activity (40% vs. 32%, P & 0.05) and reduces gene expression to undetectable levels. All-trans-retinoic acid did not affect 17βHSDXI expression or activity, but addition of the retinoid together with cAMP significantly decreased activity over cAMP alone (32% vs. 23%, P & 0.05). Cloning and sequencing of the 17βHSDXI promoter identified the potential nuclear receptor steroidogenic factor-1 half-site TCCAAGGCCGG, and a cluster of three other potential steroidogenic factor-1 half-sites were found in the distal part of intron 1. Collectively, these results suggest a role for 17βHSDXI in androgen metabolism during steroidogenesis and a possible role in nonsteroidogenic tissues including paracrine modulation of 5α-androstane-3α, 17β-diol levels. 17βHSDXI could act by metabolizing compounds that stimulate steroid synthesis and/or by generating metabolites that inhibit it.
Crucial timing in schizophrenia
Publisher: Springer Science and Business Media LLC
Date: 10-2014
Archived Guthrie blood spots as a novel source for quantitative DNA methylation analysis
Publisher: Future Science Ltd
Date: 10-2008
DOI: 10.2144/000112945
Abstract: Sodium bisulfite treatment followed by PCR and DNA sequencing is widely considered the gold standard for the analysis of DNA methylation patterns. However, this technique generally requires substantial quantities of genomic DNA as starting material and is often associated with degradation of DNA. Here, we assess the feasibility of performing bisulfite sequencing on DNA isolated from 3-mm diameter punches of dried blood Guthrie spots. We demonstrate that it is possible to perform bisulfite sequencing from both freshly prepared and archived dried blood spots, using a combination of high purity DNA extraction and efficient bisulfite conversion. With the number of new technologies available for DNA methylation studies, we have extended this analysis and have successfully used a high-throughput mass spectrometry method for DNA methylation analysis on these s les. This provides a new source of material for epigenetic analysis of birth s les and provides an invaluable reference point to track temporal change in epigenetic profiles possibly linked with health and disease.
Inherent promoter bidirectionality facilitates maintenance of sequence integrity and transcription of parasitic DNA in mammalian genomes
Publisher: Springer Science and Business Media LLC
Date: 2009
Association of assisted reproductive technology with long-term offspring cardiometabolic health: a multi-cohort study
Publisher: Cold Spring Harbor Laboratory
Date: 16-04-2022
DOI: 10.1101/2022.04.13.22273455
Abstract: To examine association of conception by assisted reproductive technology (ART) with offspring cardio-metabolic health outcomes, and whether these differ by offspring age. Multi-cohort study. Fourteen population-based cohort studies with offspring from the UK, Ireland, France, the Netherlands, Portugal, Greece, Italy, Norway, Singapore, and Australia for meta-analysis of various ages. Four cohorts (three European and one Singaporean) with repeated measures for pooled age-change (from 3 to 26 years) trajectory analysis. Young people s led from the general population with complete data on mode of conception, confounders, and ≥1 cardio-metabolic outcome measured after birth. Conception by ART versus natural conception (NC). Systolic (SBP) and diastolic blood pressure (DBP), heart rate (HR), total cholesterol (TC), high-density lipoprotein cholesterol (HDLc), low-density lipoprotein cholesterol (LDLc), triglycerides (TG), glucose, insulin, and glycated haemoglobin (HbA1c). Between 35,780 (605 ART) and 4,502 (67 ART) offspring were included in meta-analysis of various ages for each outcome. Mean age at outcome assessment ranged from 13 months to 27.4 years, with most cohorts ((11/14) having mean age years. Compared with NC, ART-conceived offspring had similar SBP (mean difference (ART minus NC): -0.89 mmHg 95%CI: -1.91 to 0.14), DBP (−0.50 mmHg -1.65 to 0.66), and HR (0.02 beats/min -1.00 to 1.03). Cholesterol measures were higher in ART-conceived than NC offspring, for TC (mean % difference: 2.54 % 0.46 to 4.61), HDLc (4.17 % 1.79 to 6.56), and LDLc (4.95 % 0.99 to 8.92), whereas triglycerides were similar (−1.53 % -6.19 to 3.13). No clear differences were seen for glucose (0.25 % -1.38 to 1.88), insulin (−5.04 % -13.20 to 3.12), or HbA1c (−0.07 % -0.14 to 0.00). Trajectory models in up to 17,244 (244 ART) offspring showed that early life trajectory differences were consistent with the above pooled results and showed higher SBP emerging from mid-adolescence to adulthood with ART (e.g., predicted mean difference in SBP at age 26 years for ART versus NC was 5.06 mmHg 1.76 to 8.35). Children conceived through ART had higher cholesterol and similar blood pressure and hyperglycaemic/insulin resistance measures compared with NC children. Whilst overall this is reassuring, our trajectory analysis in a sub-group of cohorts suggested that those conceived by ART may go on to develop higher blood pressure in early adulthood. Our study shows the importance of follow-up into adulthood and requires validation by independent studies with different study designs including within-sibship and mechanistic studies.
Trained Immunity: Linking Obesity and Cardiovascular Disease across the Life-Course?
Publisher: Elsevier BV
Date: 05-2020
DOHaD in the land down under: 11th World Congress 2019
Publisher: Cambridge University Press (CUP)
Date: 29-09-2020
The DNA methylation landscape of CD4+ T cells in oligoarticular juvenile idiopathic arthritis
Publisher: Elsevier BV
Date: 2018
DOI: 10.1016/J.JAUT.2017.09.010
Abstract: Juvenile idiopathic arthritis (JIA) is presumed to be driven by an adverse combination of genes and environment. Epigenetic processes, including DNA methylation, act as a conduit through which the environment can regulate gene activity. Altered DNA methylation has been associated with adult autoimmune rheumatic diseases such as rheumatoid arthritis, but studies are lacking for paediatric autoimmune rheumatic diseases including JIA. Here, we performed a genome-scale case-control analysis of CD4
A Pathway-Based Genetic Score for Oxidative Stress: An Indicator of Host Vulnerability to Phthalate-Associated Adverse Neurodevelopment
Publisher: MDPI AG
Date: 29-03-2022
Abstract: The developing brain is highly sensitive to environmental disturbances, and adverse exposures can act through oxidative stress. Given that oxidative stress susceptibility is determined partly by genetics, multiple studies have employed genetic scores to explore the role of oxidative stress in human disease. However, traditional approaches to genetic score construction face a range of challenges, including a lack of interpretability, bias towards the disease outcome, and often overfitting to the study they were derived on. Here, we develop an alternative strategy by first generating a genetic pathway function score for oxidative stress (gPFSox) based on the transcriptional activity levels of the oxidative stress response pathway in brain and other tissue types. Then, in the Barwon Infant Study (BIS), a population-based birth cohort (n = 1074), we show that a high gPFSox, indicating reduced ability to counter oxidative stress, is linked to higher autism spectrum disorder risk and higher parent-reported autistic traits at age 4 years, with AOR values (per 2 additional pro-oxidant alleles) of 2.10 (95% CI (1.12, 4.11) p = 0.024) and 1.42 (95% CI (1.02, 2.01) p = 0.041), respectively. Past work in BIS has reported higher prenatal phthalate exposure at 36 weeks of gestation associated with offspring autism spectrum disorder. In this study, we examine combined effects and show a consistent pattern of increased neurodevelopmental problems for in iduals with both a high gPFSox and high prenatal phthalate exposure across a range of outcomes, including high gPFSox and high DEHP levels against autism spectrum disorder (attributable proportion due to interaction 0.89 95% CI (0.62, 1.16) p 0.0001). The results highlight the utility of this novel functional genetic score and add to the growing evidence implicating gestational phthalate exposure in adverse neurodevelopment.
Diffuse neutron scattering in benzil, C14 D10 O2 , using the time-of-flight Laue technique
Publisher: International Union of Crystallography (IUCr)
Date: 15-11-2003
DOI: 10.1107/S002188980302209X
Abstract: Diffuse neutron scattering data have been recorded for the molecular crystal d -benzil, C 14 D 10 O 2 , using the time-of-flight Laue technique on the SXD and PRISMA instruments at ISIS. Using SXD it was possible to access a large fraction of the total three-dimensional reciprocal space out to a Q value of 15 Å −1 , using only four in idual exposures and by making use of the \\bar{3}m Laue symmetry of the crystal. By segregating the scattered data according to the incident neutron energy used, patterns were obtained from those neutrons in the range of ∼20 meV to 150 meV, which showed little sign of inelastic effects and so could be compared with previously analysed X-ray data. For neutron energies of meV, interesting inelastic effects were observed, which have been used to obtain an estimate for the energy of phonons associated with a vibrational mode in which an intramolecular mode couples to a low-energy shearing motion of the hydrogen-bonded network linking neighbouring molecules. The estimated value of 8.95 cm −1 (1.11 meV) for this mode is less than the lowest energy mode reported from spectroscopic measurements for hydrogenous benzil (∼16 cm −1 ). A model previously derived from analysis of X-ray data observed over a limited range of Q has been used to calculate neutron patterns over the full Q range. Comparison with the present neutron data has shown that while the model gives a good description of the form of the diffuse patterns, the magnitudes of the atomic displacements are underestimated by a factor of ∼2.25.
Genetic variation at the Th2 immune gene IL13 is associated with IgE-mediated paediatric food allergy
Publisher: Wiley
Date: 21-05-2017
DOI: 10.1111/CEA.12942
Abstract: Food allergies pose a considerable world-wide public health burden with incidence as high as one in ten in 12-month-old infants. Few food allergy genetic risk variants have yet been identified. The Th2 immune gene IL13 is a highly plausible genetic candidate as it is central to the initiation of IgE class switching in B cells. Here, we sought to investigate whether genetic polymorphisms at IL13 are associated with the development of challenge-proven IgE-mediated food allergy. We genotyped nine IL13 "tag" single nucleotide polymorphisms (tag SNPs) in 367 challenge-proven food allergic cases, 199 food-sensitized tolerant cases and 156 non-food allergic controls from the HealthNuts study. 12-month-old infants were phenotyped using open oral food challenges. SNPs were tested using Cochran-Mantel-Haenszel test adjusted for ancestry strata. A replication study was conducted in an independent, co-located s le of four paediatric cohorts consisting of 203 food allergic cases and 330 non-food allergic controls. Replication s le phenotypes were defined by clinical history of reactivity, 95% PPV or challenge, and IL13 genotyping was performed. IL13 rs1295686 was associated with challenge-proven food allergy in the discovery s le (P=.003 OR=1.75 CI=1.20-2.53). This association was also detected in the replication s le (P=.03, OR=1.37, CI=1.03-1.82) and further supported by a meta-analysis (P=.0006, OR=1.50). However, we cannot rule out an association with food sensitization. Carriage of the rs1295686 variant A allele was also associated with elevated total plasma IgE. We show for the first time, in two independent cohorts, that IL13 polymorphism rs1295686 (in complete linkage disequilibrium with functional variant rs20541) is associated with challenge-proven food allergy.
A case-sibling assessment of the association between skin pigmentation and other vitamin d-related factors and type 1 diabetes mellitus
Publisher: Wiley
Date: 31-08-2009
DOI: 10.1111/J.1751-1097.2009.00563.X
Abstract: Fair skin pigmentation has been associated with a higher risk of type 1 diabetes mellitus (T1DM). The aim is to compare children with T1DM directly to a sibling in relation to their skin pigmentation in sun-exposed and unexposed sites, past sun exposure and methylation of the VDR gene promoter. The s le consisted of children with T1DM attending a diabetes outpatient clinic and siblings (total n=42). Cutaneous melanin density was estimated using a spectrophotometer. Parental report on past sun exposure was obtained. DNA methylation analysis of the VDR gene promoter was conducted. Matched data analysis was performed comparing each case directly to their sibling. Cases were significantly more likely to have lighter skin pigmentation at the upper arm (AOR 0.69 [95% CI: 0.52, 0.90] P=0.01). Low infant sun exposure was imprecisely associated with a two-fold increase in T1DM risk (AOR 2.43 [95% CI: 0.91, 6.51] P=0.08 for under 1 h of winter sun exposure per leisure day). The VDR gene promoter was completely unmethylated in both cases and siblings. The previously demonstrated association between light skin pigmentation and T1DM risk was evident even in this comparison across sibling pairs. Further work on past UVR exposure and related factors such as skin pigmentation is required.
Genome‐wide DNA methylation profiling identifies a folate‐sensitive region of differential methylation upstream of ZFP57 ‐imprinting regulator in humans
Publisher: Wiley
Date: 02-06-2014
DOI: 10.1096/FJ.13-249029
Epigenetic Regulation of Pregnancy Outcome
Publisher: BENTHAM SCIENCE PUBLISHERS
Date: 03-06-2012
Association of maternal and nutrient supply line factors with DNA methylation at the imprintedIGF2/H19locus in multiple tissues of newborn twins
Publisher: Informa UK Limited
Date: 10-2013
DOI: 10.4161/EPI.25908
IFPA meeting 2015 workshop report I: placental mitochondrial function, transport systems and epigenetics
Publisher: Elsevier BV
Date: 12-2016
DOI: 10.1016/J.PLACENTA.2015.11.014
Abstract: Workshops are an important part of the IFPA annual meeting as they allow for discussion of specialized topics. At IFPA meeting 2015 there were twelve themed workshops, three of which are summarized in this report. These workshops covered areas of placental regulation and nutrient handling: 1) placental epigenetics 2) placental mitochondrial function 3) placental transport systems.
Mapping Pulmonary and Systemic Inflammation in Preschool Aged Children With Cystic Fibrosis
Publisher: Frontiers Media SA
Date: 15-10-2021
DOI: 10.3389/FIMMU.2021.733217
Abstract: The immune landscape of the paediatric respiratory system remains largely uncharacterised and as a result, the mechanisms of globally important childhood respiratory diseases remain poorly understood. In this work, we used high parameter flow cytometry and inflammatory cytokine profiling to map the local [bronchoalveolar lavage (BAL)] and systemic (whole blood) immune response in preschool aged children with cystic fibrosis (CF) and aged-matched healthy controls. We demonstrate that children with CF show pulmonary infiltration of CD66b + granulocytes and increased levels of MIP-1α, MIG, MCP-1, IL-8, and IL-6 in BAL relative to healthy control children. Proportions of systemic neutrophils positively correlated with age in children with CF, whilst systemic CD4 T cells and B cells were inversely associated with age. Inflammatory cells in the BAL from both CF and healthy children expressed higher levels of activation and migration markers relative to their systemic counterparts. This work highlights the utility of multiplex immune profiling and advanced analytical pipelines to understand mechanisms of lung disease in childhood.
Longitudinal, genome-scale analysis of DNA methylation in twins from birth to 18 months of age reveals rapid epigenetic change in early life and pair-specific effects of discordance
Publisher: Springer Science and Business Media LLC
Date: 2013
MAMMALS IN PORTUGAL : A data set of terrestrial, volant, and marine mammal occurrences in P ortugal
Publisher: Wiley
Date: 12-04-2022
DOI: 10.1002/ECY.3654
Abstract: Mammals are threatened worldwide, with ~26% of all species being included in the IUCN threatened categories. This overall pattern is primarily associated with habitat loss or degradation, and human persecution for terrestrial mammals, and pollution, open net fishing, climate change, and prey depletion for marine mammals. Mammals play a key role in maintaining ecosystems functionality and resilience, and therefore information on their distribution is crucial to delineate and support conservation actions. MAMMALS IN PORTUGAL is a publicly available data set compiling unpublished georeferenced occurrence records of 92 terrestrial, volant, and marine mammals in mainland Portugal and archipelagos of the Azores and Madeira that includes 105,026 data entries between 1873 and 2021 (72% of the data occurring in 2000 and 2021). The methods used to collect the data were: live observations/captures (43%), sign surveys (35%), camera trapping (16%), bioacoustics surveys (4%) and radiotracking, and inquiries that represent less than 1% of the records. The data set includes 13 types of records: (1) burrows | soil mounds | tunnel, (2) capture, (3) colony, (4) dead animal | hair | skulls | jaws, (5) genetic confirmation, (6) inquiries, (7) observation of live animal (8), observation in shelters, (9) photo trapping | video, (10) predators diet | pellets | pine cones/nuts, (11) scat | track | ditch, (12) telemetry and (13) vocalization | echolocation. The spatial uncertainty of most records ranges between 0 and 100 m (76%). Rodentia ( n =31,573) has the highest number of records followed by Chiroptera ( n = 18,857), Carnivora ( n = 18,594), Lagomorpha ( n = 17,496), Cetartiodactyla ( n = 11,568) and Eulipotyphla ( n = 7008). The data set includes records of species classified by the IUCN as threatened (e.g., Oryctolagus cuniculus [ n = 12,159], Monachus monachus [ n = 1,512], and Lynx pardinus [ n = 197]). We believe that this data set may stimulate the publication of other European countries data sets that would certainly contribute to ecology and conservation‐related research, and therefore assisting on the development of more accurate and tailored conservation management strategies for each species. There are no copyright restrictions please cite this data paper when the data are used in publications.
DNA methylation profiling of genomic DNA isolated from urine in diabetic chronic kidney disease: A pilot study
Publisher: Public Library of Science (PLoS)
Date: 20-02-2018
The effects of gestational diabetes mellitus with maternal age between 35 and 40 years on the metabolite profiles of plasma and urine
Publisher: Springer Science and Business Media LLC
Date: 02-03-2022
DOI: 10.1186/S12884-022-04416-5
Abstract: Gestational diabetes mellitus (GDM) is defined as impaired glucose tolerance in pregnancy and without a history of diabetes mellitus. While there are limited metabolomic studies involving advanced maternal age in China, we aim to investigate the metabolomic profiling of plasma and urine in pregnancies complicated with GDM aged at 35–40 years at early and late gestation. Twenty normal and 20 GDM pregnant participants (≥ 35 years old) were enlisted from the Complex Lipids in Mothers and Babies (CLIMB) study. Maternal plasma and urine collected at the first and third trimester were detected using gas chromatography-mass spectrometry (GC-MS). One hundred sixty-five metabolites and 192 metabolites were found in plasma and urine respectively. Urine metabolomic profiles were incapable to distinguish GDM from controls, in comparison, there were 14 and 39 significantly different plasma metabolites between the two groups in first and third trimester respectively. Especially, by integrating seven metabolites including cysteine, malonic acid, alanine, 11,14-eicosadienoic acid, stearic acid, arachidic acid, and 2-methyloctadecanoic acid using multivariant receiver operating characteristic models, we were capable of discriminating GDM from normal pregnancies with an area under curve of 0.928 at first trimester. This study explores metabolomic profiles between GDM and normal pregnancies at the age of 35–40 years longitudinally. Several compounds have the potential to be biomarkers to predict GDM with advanced maternal age. Moreover, the discordant metabolome profiles between the two groups could be useful to understand the etiology of GDM with advanced maternal age.
Cohort Profile: The Barwon Infant Study
Publisher: Oxford University Press (OUP)
Date: 30-03-2015
DOI: 10.1093/IJE/DYV026
Abstract: The modern environment is associated with an increasing burden of non-communicable diseases (NCDs). Mounting evidence implicates environmental exposures, experienced early in life (including in utero), in the aetiology of many NCDs, though the cellular/molecular mechanism(s) underlying this elevated risk across the life course remain unclear. Epigenetic variation has emerged as a candidate mediator of such effects. The Barwon Infant Study (BIS) is a population-derived birth cohort study (n = 1074 infants) with antenatal recruitment, conducted in the south-east of Australia (Victoria). BIS has been designed to facilitate a detailed mechanistic investigation of development within an epidemiological framework. The broad objectives are to investigate the role of specific environmental factors, gut microbiota and epigenetic variation in early-life development, and subsequent immune, allergic, cardiovascular, respiratory and neurodevelopmental outcomes. Participants have been reviewed at birth and at 1, 6, 9 and 12 months, with 2- and 4-year reviews under way. Biological s les and measures include: maternal blood, faeces and urine during pregnancy infant urine, faeces and blood at regular intervals during the first 4 years lung function at 1 month and 4 years cardiovascular assessment at 1 month and 4 years skin-prick allergy testing and food challenge at 1 year and neurodevelopmental assessment at 9 months, 2 and 4 years. Data access enquiries can be made at [www.barwoninfantstudy.org.au] or via [peter.vuillermin@deakin.edu.au].
The newborn metabolome: associations with gestational diabetes, sex, gestation, birth mode, and birth weight.
Publisher: Springer Science and Business Media LLC
Date: 15-09-2021
Increased methylation and decreased expression of homeobox genes TLX1, HOXA10 and DLX5 in human placenta are associated with trophoblast differentiation
Publisher: Springer Science and Business Media LLC
Date: 03-07-2017
DOI: 10.1038/S41598-017-04776-5
Abstract: Homeobox genes regulate embryonic and placental development, and are widely expressed in the human placenta, but their regulatory control by DNA methylation is unclear. DNA methylation analysis was performed on human placentae from first, second and third trimesters to determine methylation patterns of homeobox gene promoters across gestation. Most homeobox genes were hypo-methylated throughout gestation, suggesting that DNA methylation is not the primary mechanism involved in regulating HOX genes expression in the placenta. Nevertheless, several genes showed variable methylation patterns across gestation, with a general trend towards an increase in methylation over gestation. Three genes ( TLX1, HOXA10 and DLX5 ) showed inverse gains of methylation with decreasing mRNA expression throughout pregnancy, supporting a role for DNA methylation in their regulation. Proteins encoded by these genes were primarily localised to the syncytiotrophoblast layer, and showed decreased expression later in gestation. siRNA mediated downregulation of DLX5 , TLX1 and HOXA10 in primary term villous cytotrophoblast resulted in decreased proliferation and increased expression of differentiation markers, including ERVW-1 . Our data suggest that loss of DLX5, TLX1 and HOXA10 expression in late gestation is required for proper placental differentiation and function.
Decreasing severity of obesity from early to late adolescence and young adulthood associates with longitudinal metabolomic changes implicated in lower cardiometabolic disease risk
Publisher: Springer Science and Business Media LLC
Date: 06-01-2022
DOI: 10.1038/S41366-021-01034-7
Abstract: Obesity in childhood is associated with metabolic dysfunction, adverse subclinical cardiovascular phenotypes and adult cardiovascular disease. Longitudinal studies of youth with obesity investigating changes in severity of obesity with metabolomic profiles are sparse. We investigated associations between (i) baseline body mass index (BMI) and follow-up metabolomic profiles (ii) change in BMI with follow-up metabolomic profiles and (iii) change in BMI with change in metabolomic profiles (mean interval 5.5 years). Participants (n = 98, 52% males) were recruited from the Childhood Overweight Biorepository of Australia study. At baseline and follow-up, BMI and the % >95th BMI-centile (percentage above the age-, and sex-specific 95th BMI-centile) indicate severity of obesity, and nuclear magnetic resonance spectroscopy profiling of 72 metabolites/ratios, log-transformed and scaled to standard deviations (SD), was performed in fasting serum. Fully adjusted linear regression analyses were performed. Mean (SD) age and % >95th BMI-centile were 10.3 (SD 3.5) years and 134.6% (19.0) at baseline, 15.8 (3.7) years and 130.7% (26.2) at follow-up. Change in BMI over time, but not baseline BMI, was associated with metabolites at follow-up. Each unit (kg/m In children and young adults with obesity, decreasing the severity of obesity was associated with changes in metabolomic profiles consistent with lower cardiovascular and metabolic disease risk in adults.
Application of high dimensional flow cytometry and unsupervised analysis to define the immune cell landscape of early childhood respiratory and blood compartments
Publisher: Cold Spring Harbor Laboratory
Date: 22-03-2021
DOI: 10.1101/2021.03.21.436363
Abstract: The cellular landscape of the paediatric respiratory system remains largely uncharacterised and as a result, the mechanisms of highly prevalent childhood respiratory diseases remain poorly understood. A major limitation in defining mechanisms of disease has been the availability of tissue s les collected in early life, as well as technologies that permit deep immune analysis from limited s le volumes. In this work, we developed new experimental methods and applied unsupervised analytical tools to profile the local (bronchoalveolar lavage) and systemic (whole blood) immune response in childhood respiratory disease. We quantified and comprehensively phenotyped immune cell populations across blood and lung compartments in young children (under 6 years of age), showed that inflammatory cells in the BAL express higher levels of activation and migration markers relative to their systemic counterparts, and applied new analytical tools to reveal novel tissue-resident macrophage and infiltrating monocyte populations in the paediatric lung. To our knowledge, this is the first description of the use of these methods for paediatric respiratory s les. Combined with matched analysis of the systemic immune cell profile, the application of these pipelines will increase our understanding of childhood lung disease with potential to identify clinically relevant disease biomarkers.
Causes of blood methylomic variation for middle-aged women measured by the HumanMethylation450 array.
Publisher: Informa UK Limited
Date: 02-11-2017
A functional neo-centromere formed through activation of a latent human centromere and consisting of non-alpha-satellite DNA
Publisher: Springer Science and Business Media LLC
Date: 06-1997
DOI: 10.1038/NG0697-144
Abstract: We recently described a human marker chromosome containing a functional neo-centromere that binds anti-centromere antibodies, but is devoid of centromeric alpha-satellite repeats and derived from a hitherto non-centromeric region of chromosome 10q25. Chromosome walking using cloned single-copy DNA from this region enabled us to identify the antibody-binding domain of this centromere. Extensive restriction mapping indicates that this domain has an identical genomic organization to the corresponding normal chromosomal region, suggesting a mechanism for the origin of this centromere through the activation of a latent centromere that exists within 10q25.
Ontogeny of plasma lipid metabolism in pregnancy and early childhood: a longitudinal population study
Publisher: Cold Spring Harbor Laboratory
Date: 22-09-2021
DOI: 10.1101/2021.09.15.21263636
Abstract: There is mounting evidence that in utero and early life exposures may predispose an in idual to metabolic disorders in later life and dysregulation of lipid metabolism is critical in such outcomes. However, there is limited knowledge about lipid metabolism and factors causing lipid dysregulation in early life that could result in adverse health outcomes in later life. In this study, we aim to understand the lipid metabolism in pregnancy, and from birth to four years. We performed comprehensive lipid profiling of 1074 mother-child dyads in the Barwon Infant Study (BIS), a population based pre-birth cohort and measured 776 distinct lipid species across 42 lipid classes using ultra high-performance liquid chromatography (UHPLC). We measured lipids in 1032 maternal serum s les at 28 weeks’ gestation, 893 cord serum s les at birth, 793, 735, and 511 plasma s les at six, twelve months, and four years, respectively. The lipidome differed between mother and newborn and changed markedly with increasing postnatal age. Cord serum was enriched with long chain poly-unsaturated fatty acids (LC-PUFAs), and corresponding cholesteryl esters relative to the maternal serum. Alkenyl-phosphatidylethanolamine species containing LC-PUFAs increased with postnatal age, whereas the corresponding lysophospholipids and triglycerides decreased. We performed regression analyses to investigate the associations of cord serum lipid species with birth factors: gestational age, birth weight, mode of birth and duration of labor. Majority of the cord serum lipids were strongly associated with gestational age and birth weight, with most lipids showing opposing associations. Each mode of birth showed an independent association with cord serum lipids. There were marked changes in the plasma lipidome over the first four years of life. This study sheds light on lipid metabolism in infancy and early childhood and provide a framework to define the relationship between lipid metabolism and health outcomes in early childhood. This work was supported by the A*STAR-NHMRC joint call funding (1711624031).
A 330 kb CENP-A binding domain and altered replication timing at a human neocentromere
Publisher: Wiley
Date: 18-04-2001
Prospects for epigenetic research within cohort studies of psychological disorder: A pilot investigation of a peripheral cell marker of epigenetic risk for depression
Publisher: Elsevier BV
Date: 02-2010
DOI: 10.1016/J.BIOPSYCHO.2009.12.003
Abstract: Cohort studies have considerable prima facie value for investigating epigenetic processes in psychological disorder however, the future prospects for such studies will depend on valid peripheral markers. The purpose of this pilot study was to investigate association between buccal cell methylation and risk for depression. Epigenotyping was limited to promoter methylation of the serotonin transporter gene (5HTT). A transcription limiting VNTR in the 5HTT promoter (5HTTLPR) was also genotyped. A nested s le of 25 depressed and 125 non-depressed adolescents was drawn from an established longitudinal study of adolescent health. There was no association between depressive symptoms and either buccal cell 5HTT methylation or 5HTTLPR. However, depressive symptoms were more common among those with elevated buccal cell 5HTT methylation who carried 5HTTLPR short-allele (OR 4.9, CI 1.9-13, p=0.001). Both complete and partial (as little as 10%) methylation of a 5HTT reporter gene in an expressing cell line reduced 5HTT activity. Replication is needed.
Expression discordance of monozygotic twins at birth: Effect of intrauterine environment and a possible mechanism for fetal programming
Publisher: Informa UK Limited
Date: 05-2011
Abstract: Within-pair comparison of monozygotic (MZ) twins provides an ideal model for studying factors that regulate epigenetic profile, by controlling for genetic variation. Previous reports have demonstrated epigenetic variability within MZ pairs, but the contribution of early life exposures to this variation remains unclear. As epigenetic marks govern gene expression, we have used gene expression discordance as a proxy measure of epigenetic discordance in MZ twins at birth in two cell types. We found strong evidence of expression discordance at birth in both cell types and some evidence for higher discordance in twin pairs with separate placentas. Genes previously defined as being involved in response to the external environment showed the most variable expression within pairs, independent of cell type, supporting the idea that even slight differences in intrauterine environment can influence expression profile. Focusing on birthweight, previously identified as a predisposing factor for cardiovascular, metabolic and other complex diseases, and using a statistical model that estimated association based on within-pair variation of expression and birthweight, we found some association between birthweight and expression of genes involved in metabolism and cardiovascular function. This study is the first to examine expression discordance in newborn twins. It provides evidence of a link between birthweight and activity of specific cellular pathways and, as evidence points to gene expression profiles being maintained through cell ision by epigenetic factors, provides a plausible biological mechanism for the previously described link between low birthweight and increased risk of later complex disease.
The association between higher maternal pre‐pregnancy body mass index and increased birth weight, adiposity and inflammation in the newborn
Publisher: Wiley
Date: 09-10-2016
DOI: 10.1111/IJPO.12187
Abstract: Excess adiposity and adiposity-related inflammation are known risk factors for cardiovascular disease in adults however, little is known regarding the determinants of adiposity-related inflammation at birth. The aim of this study was to investigate the association between maternal pre-pregnancy BMI and newborn adiposity and inflammation. Paired maternal (28-week gestation) and infant (umbilical cord) blood s les were collected from a population-derived birth cohort (Barwon Infant Study, n = 1074). Data on maternal comorbidities and infant birth anthropomorphic measures were compiled, and infant aortic intima-media thickness was measured by trans-abdominal ultrasound. In a selected subgroup of term infants (n = 161), matched maternal and cord lipids, high-sensitivity C-reactive protein (hsCRP) and maternal soluble CD14 were measured. Analysis was completed by using pairwise correlation and linear regression. Because of their non-normal distribution, pathology blood measures were log transformed prior to analysis. Maternal pre-pregnancy BMI was positively associated with increased birth weight (mean difference 17.8 g per kg m Higher maternal pre-pregnancy BMI is associated with increased newborn adiposity and inflammation. These associations may be partially mediated by maternal inflammation during pregnancy.
Human placental methylome in the interplay of adverse placental health, environmental exposure, and pregnancy outcome
Publisher: Public Library of Science (PLoS)
Date: 08-2019
Identification of an Insulin-responsive Element in the Rat Insulin-like Growth Factor-binding Protein-3 Gene
Publisher: Elsevier BV
Date: 02-1997
Genome-wide analyses of vocabulary size in infancy and toddlerhood: associations with Attention-Deficit/Hyperactivity Disorder and cognition-related traits
Publisher: Cold Spring Harbor Laboratory
Date: 06-2022
DOI: 10.1101/2022.06.01.494306
Abstract: The number of words children produce (expressive vocabulary) and understand (receptive vocabulary) changes rapidly during early development, partially due to genetic factors, although mechanisms are not well understood. Here, we performed a meta-genome-wide association study within the EAGLE consortium and investigated polygenic overlap with later-life traits, including Attention-Deficit/Hyperactivity Disorder (ADHD) and cognition. We studied 37,913 parent-reported vocabulary size measures (English, Dutch, Danish) for 17,298 children of European descent. Meta-analyses were performed for early-phase expressive (infancy, 15-18 months), late-phase expressive (toddlerhood, 24-38 months) and late-phase receptive (toddlerhood, 24-38 months) vocabulary. Subsequently, we estimated Single-Nucleotide Polymorphism heritability (SNP-h 2 ), genetic correlations (r g ) and modelled underlying genetic factor structures with multivariate models. Contributions of common genetic variation to early-life vocabulary were modest (SNP-h 2 : 0.08(SE=0.01) to 0.24(SE=0.03)) and multi-factorial. Genetic overlap between infant expressive and toddler receptive vocabulary was near zero (r g =0.07(SE=0.10)), although both measures were genetically related to toddler expressive vocabulary (r g =0.69(SE=0.14) and r g =0.67(SE=0.16), respectively). Consistently, polygenic association patterns with later-life traits differed: Genetic links with cognition emerged only in toddlerhood (e.g. toddler receptive vocabulary and intelligence: r g =0.36(SE=0.12)), despite comparable study power for infant measures. Furthermore, increased polygenic ADHD risk was associated with larger infant expressive vocabulary (r g =0.23(SE=0.08)), as confirmed by ADHD-symptom-based follow-up analyses in the Avon Longitudinal Study of Parents and Children (ALSPAC-r g =0.54(SE=0.26)). Genetic relationships with toddler receptive vocabulary were, however, opposite (ALSPAC-r g =-0.74(SE=0.23)), highlighting developmental changes in genetic architectures. Multiple genetic components contribute to early-life vocabulary development, shaping polygenic association patterns with later-life ADHD symptoms and cognition.
Optimized DNA extraction from neonatal dried blood spots: application in methylome profiling
Publisher: Springer Science and Business Media LLC
Date: 07-2014
Sex differences in infant blood metabolite profile in association with weight and adiposity measures
Publisher: Springer Science and Business Media LLC
Date: 17-01-2020
DOI: 10.1038/S41390-020-0762-4
Abstract: Nuclear magnetic resonance (NMR) metabolic profiling quantifies a large number of metabolites. From adolescence, specific metabolites are influenced by age, sex and body mass index data on early-life metabolic profiles are limited. We investigated associations between sex, birth weight, weight and adiposity with NMR metabolic profile at age 12 months. The plasma NMR metabolic profile was quantified in infants (n = 485) from the Barwon Infant Study. Associations between 74 metabolites and sex, birth weight z-score and 12-month measures (weight z-score, skinfold thickness, weight-for-length z-score) were examined using linear regression models. Several cholesterol and fatty acid measures were higher (0.2-0.3 SD) in girls than in boys we observed modest sex-specific associations of birth weight z-scores and 12-month sum of skinfold thicknesses with metabolites. The pattern of associations between weight z-score and weight-for-length z-score with metabolites at 12 months was more pronounced in girls, particularly for fatty acid ratios. We identified sex differences in the infant metabolic profile. Sex-specific patterns observed differ from those reported in older children and adults. We also identified modest cross-sectional associations between anthropometric and adiposity measures and metabolites, some of which were sex specific.
Analysis of epigenetic changes in survivors of preterm birth reveals the effect of gestational age and evidence for a long term legacy
Publisher: Springer Science and Business Media LLC
Date: 2013
DOI: 10.1186/GM500
Bat conservation and zoonotic disease risk: a research agenda to prevent misguided persecution in the aftermath of COVID‐19
Publisher: Wiley
Date: 31-08-2020
DOI: 10.1111/ACV.12636
Biallelic FANCD1/BRCA2 mutations predisposing to glioblastoma multiforme with multiple oncogenic amplifications.
Publisher: Elsevier BV
Date: 2015
DOI: 10.1016/J.CANCERGEN.2015.11.005
Abstract: Fanconi anaemia (FA) caused by biallelic mutation in FANCD1/BRCA2 is rare but carries a high risk of early onset cancer. Medulloblastoma is well described in this cohort but reports of other brain tumours are uncommon. The molecular profile of tumours from FA patients is not well reported. A glioblastoma multiforme (GBM) from a 3-year-old patient with FA and confirmed biallelic BRCA2 mutations was submitted for methylation analysis. This revealed strong clustering with the K27 mutation subgroup and copy number analysis showed gains of chromosomes 1q, 4q, part of 7q, part of 8q and 17q with resultant lifications of MDM4, CDK6, MET, MYC and PPM1D (WIP1). We also describe for the first time the germline mutation in BRCA2 c.8057T > C resulting in p.Leu2686Pro in our patient with confirmed FA. Biallelic BRCA2 mutations have predisposed to an aggressive and universally fatal subtype of childhood GBM in our patient. Copy number alterations and multiple oncogenic lifications may be secondary to inherent chromosomal instability and this raises the question of what role BRCA2 may play in the development of GBM in children without FA.
Impact of maternal gestational weight gain in twin pregnancies on early childhood obesity risk: A longitudinal birth cohort study
Publisher: Frontiers Media SA
Date: 02-08-2022
Abstract: To investigate the impact of gestational weight gain (GWG) on the body mass index-for-age z score (BAZ) and obesity risk among twin offspring. This study included 263 women who were pregnant with twins and their offspring. Maternal GWG was measured in each trimester, and infant weight and length were measured at 6, 12, and 24 months. Total GWG was positively correlated with offspring birthweight and BAZ at 6, 12 and 24 months [adjusted β 0.013 (95% CI: 0.008–0.019), 0.028 (95% CI: 0.005–0.050), 0.033 (95% CI: 0.010–0.056) and 0.025 (95% CI: 0.004–0.047), respectively]. Excessive total GWG was related to an increased relative risk (RR) of large for gestational age (LGA) and overweight at 6 and 12 months. Only the second trimester gestational weight gain rate (GWGR) was positively correlated with birthweight (adjusted β 0.380, 95% CI: 0.256–0.504), and RRs of 6.818 (95% CI: 1.568–29.642) and 2.852 (95% CI: 1.466–5.548) were found for LGA and overweight at 12 months, respectively. Total GWG and the second trimester GWGR were correlated with BAZ and overweight/obesity risk in twin offspring the impact was obvious in the first year of life and gradually disappeared over time. ChiCTR-OOC-16008203, Registered on 1 April 2016 at the Chinese Clinical Trial Registry.
Perinatal maternal alcohol consumption and methylation of the dopamine receptor DRD4 in the offspring: the Triple B study
Publisher: Oxford University Press (OUP)
Date: 12-2016
DOI: 10.1093/EEP/DVW023
Related Organisations
Related Funding Activities
Clinical Review Of A Cohort Aged 22-33 Years Conceived Using Assisted Reproductive Technologies
Start Date: 2016
End Date: 2018
Funder: National Health and Medical Research Council
View Funded ActivityStudies On The Expression Of Muscarinic Receptors: Implications For The Pathology Of Schizophrenia
Start Date: 2008
End Date: 2010
Funder: National Health and Medical Research Council
View Funded ActivityDevelopment Of Therapeutically Useful Human Artificial Chromosomes For Gene Delivery And Optimal Gene Expression
Start Date: 2002
End Date: 2004
Funder: National Health and Medical Research Council
View Funded ActivityMechanisms Of Glucocorticoid Resistance In Acute Lymphoblastic Leukaemia
Start Date: 2009
End Date: 2011
Funder: National Health and Medical Research Council
View Funded ActivityDefining Genetic And Epigenetic Variation During Early Development
Start Date: 2010
End Date: 2011
Funder: National Health and Medical Research Council
View Funded ActivityChromosome Analysis And Development Of Human Artificial Chromosomes With Therapeutic Potential
Start Date: 2004
End Date: 2008
Funder: National Health and Medical Research Council
View Funded ActivityBarwon Infant Study
Start Date: 2010
End Date: 2014
Funder: National Health and Medical Research Council
View Funded ActivityDefining The Cellular And Molecular Pathways Leading To Peanut Allergy In Children
Start Date: 2019
End Date: 2022
Funder: National Health and Medical Research Council
View Funded ActivityHealth And Fertility Of Young Men Conceived Using Intra-cytoplasmic Sperm Injection
Start Date: 2017
End Date: 2019
Funder: National Health and Medical Research Council
View Funded ActivityIdentifying Novel Lipid And Genetic Signatures Of Metabolic Disease In Early Childhood
Start Date: 2018
End Date: 2020
Funder: National Health and Medical Research Council
View Funded ActivityEstablishing A Child And Adolescent Twin Register For Research And Capacity Building On The Aetiology Of Mental Illness In Sri Lanka And Other LMIC
Start Date: 2018
End Date: 2019
Funder: Medical Research Council
View Funded ActivityPrenatal Exposure To Chemicals In Plastics Can Cause Epigenetic Variation In Genes Associated With Neurodevelopment In Girls And Boys
Start Date: 2020
End Date: 2024
Funder: Canadian Institutes of Health Research
View Funded ActivityEarly Nutrition, Epigenetics And Developmental Outcomes In Children.
Start Date: 2012
End Date: 2016
Funder: National Health and Medical Research Council
View Funded ActivityBlock Funded Grants
Start Date: 2000
End Date: 2000
Funder: National Health and Medical Research Council
View Funded ActivityTaming The Intruders: The Domestication Of Tigger Transposable Elements In Mammals
Start Date: 2008
End Date: 2010
Funder: Australian Research Council
View Funded ActivityHUMAN CHROMATIN ROADMAP AND FUNCTIONAL PLASTICITY
Start Date: 2006
End Date: 2008
Funder: National Health and Medical Research Council
View Funded ActivityMethylation Sensitive Genes And The Transition To Allergic Disease: A Twin Study
Start Date: 2014
End Date: 2015
Funder: National Health and Medical Research Council
View Funded ActivityEpigenetics Of Childhood Development And Disease
Start Date: 2013
End Date: 2017
Funder: National Health and Medical Research Council
View Funded ActivityThe Relationship Between Maternal And Infant Dietary Intake Of Fermentable Fibre, Gut Microbiota, Short Chain Fatty Acids And Allergic Disease And Asthma: A Population-derived Birth Cohort Study
Start Date: 2015
End Date: 2019
Funder: National Health and Medical Research Council
View Funded ActivityEnvironmental Influences In The Establishment Of The Epigenetic Landscape In Children
Start Date: 2007
End Date: 2010
Funder: National Health and Medical Research Council
View Funded ActivityMental Health Across Generations: Pre-and Post Conception Predicators Of Early Life Risks
Start Date: 2007
End Date: 2010
Funder: National Health and Medical Research Council
View Funded ActivityMethylation-sensitive T Cell Genes And Childhood Food Allergy.
Start Date: 2015
End Date: 2016
Funder: National Health and Medical Research Council
View Funded ActivityEpigenetic Programming Of Immune Development In Utero: Role Of The Maternal Environment In The Allergy Epidemic
Start Date: 2011
End Date: 2015
Funder: National Health and Medical Research Council
View Funded ActivityCentre Of Research Excellence In Eradicating Food Allergy: Prevention, Cure And Reducing Adverse Events
Start Date: 2017
End Date: 2022
Funder: National Health and Medical Research Council
View Funded ActivityDiscovery Projects - Grant ID: DP0773186
Start Date: 2008
End Date: 12-2010
Amount: $237,000.00
Funder: Australian Research Council
View Funded Activity