ORCID Profile
0000-0002-0697-9657
Current Organisation
Shahjalal University of Science and Technology
Does something not look right? The information on this page has been harvested from data sources that may not be up to date. We continue to work with information providers to improve coverage and quality. To report an issue, use the Feedback Form.
Publisher: Springer Science and Business Media LLC
Date: 04-05-2023
Publisher: Wiley
Date: 07-2020
Publisher: Elsevier BV
Date: 12-2021
Publisher: Wiley
Date: 12-01-2023
DOI: 10.1111/EFP.12792
Abstract: The study was carried out to identify wood‐decay fungi, and quantify the ersity and host preferences of the fungi in major sawmill depots in north‐eastern Bangladesh. A total of 23 fungal species belonging to 15 genera in seven families were recorded and identified. The Polyporaceae was the most dominant family, while Schizophyllum commune was the most abundant species among all species recorded. Other commonly observed fungal species were Daldinia concentrica , Trametes versicolor, Trametes coccinea and Flavodon flavus . The Simpson ersity index (0.93) and Shannon–Wiener index (2.90) showed a wide distribution of the wood‐decay fungi in the study areas. The species ersity index (0.036), species evenness index (0.92) and species richness index (3.40) indicated a erse distribution of the fungal species. Two‐thirds of the identified fungal species showed significant preferences for their hosts. The host vulnerability was found to be significantly affected by storage facility, duration of storage, depot yard condition, treated or non‐treated wood and shade facility. The findings of this work may help sawmill owners to utilize a scientific approach to management of logs and timber stored in depots, to minimize fungal decay before incurring any economic loss.
Publisher: Wiley
Date: 13-05-2015
DOI: 10.1111/EFP.12198
Publisher: Scientific Societies
Date: 03-2014
DOI: 10.1094/PDIS-07-13-0784-PDN
Abstract: Phytophthora decline of riparian alder (Alnus spp.) has been reported in several European countries (2). Death of common alder (Alnus glutinosa) due to Phytophthora alni has also been reported in Spain (4). During several surveys of alder trees in September 2012, typical dieback symptoms, including sparse small yellowish foliage and the presence of rusty exudates on the bark at the collar and lower stem were observed in A. glutinosa growing on the banks of the river Tera (Langa de Duero, Soria, 41°36′34″ N, 3°25′10″ W, elevation 851 m) and the river Tormes (La Maya, Salamanca, 40°41′42″ N, 5°35′36″ W, elevation 833 m). Bark s les plus cambium were taken from the active lesions at collar region, cut into small pieces, dried on filter paper, and plated on V8-PARPH agar (2). The s les were incubated for 4 days at 20°C in the dark before obtaining the Phytophthora isolates. Colonies developed on V8 juice agar (V8A) had limited aerial mycelium at the center and displayed radiate and slightly chrysanthemum-like growth pattern. Mycelial growth was optimal at 25°C (radial growth rate, 8.2 mm d –1 ), whereas no growth was observed at 32°C. Isolates were homothallic with paragynous antheridia, smooth-walled spherical (very rarely elongated) oogonia (22.8 to 30.6 μm diam.) and both plerotic and aplerotic golden brown oospores (21.3 to 28.5 μm diam.). In non-sterile soil extracts, the isolates produced abundant sporangia (31.5 to 57.2 × 21.3 to 38.4 μm length:breadth ratio 1.2 to 1.6) borne terminally on unbranched or sympodial sporagiophores, occasionally attached laterally to the sporangiophores. Sporagia were non-caducous, semipapillate, mainly ovoid and obpyriform, obovoid to limoniform but sometimes distorted with two apices. On the basis of the morpho-physiological features, the isolates resembled P. plurivora (formerly identified as P. citricola) (3). To confirm this, genomic DNA was extracted and subjected to PCR. The internal transcribed spacer (ITS) region of the rDNA was lified using the ITS-6 (5′ GAAGGTGAAGTCGTAACAAGG 3′) and ITS-4 (5′ TCCTCCGCTTATTGATATGC 3′) primers before sequencing (Secugen, Madrid, Spain). The sequences were deposited in the EMBL/GenBank database (Accession Nos. KF413074 and KF413075). In order to perform the pathogenicity test, 10 A. glutinosa seedlings (2 years old) per isolate were inoculated by using the under-bark inoculation technique (1) and 10 control seedlings were inoculated with V8A. Seedlings were incubated in a growth chamber at 22.5°C with a 14-h photoperiod. Three months after inoculation, all inoculated plants wilted and died, whereas the control plants showed no disease symptoms. To fulfill Koch's postulates, the pathogen was re-isolated from the necrotic lesions developed around inoculation points, thus confirming its pathogenicity. P. plurivora has been found to be present in rhizosphere soil beneath Alnus spp. and to cause aerial canker and collar rot on alder trees in Austria, Germany, and Romania (2,3). Further studies and surveys are essential to determine the distribution, extent of damage, and potential interactions with other alder pathogens (e.g., P. alni). To our knowledge, this is the first record of P. plurivora affecting A. glutinosa in Spain. References: (1) T. Jung et al. Eur. J. For. Pathol. 26:253, 1996. (2) T. Jung and M. Blaschke. Plant Pathol. 53:197, 2004. (3) T. Jung and T. I. Burgess. Persoonia 22:95, 2009. (4) A. Solla et al. Plant Pathol. 59:798, 2010.
Publisher: Universidad de Valladolid
Date: 2014
DOI: 10.35376/10324/9818
Publisher: Wiley
Date: 22-07-2017
DOI: 10.1111/EFP.12299
Publisher: Wiley
Date: 07-2010
Publisher: Springer Science and Business Media LLC
Date: 04-04-2015
Publisher: Instituto Nacional de Investigacion y Tecnologia Agraria y Alimentaria (INIA)
Date: 20-07-2012
Publisher: Elsevier BV
Date: 11-2022
Publisher: Wiley
Date: 07-2021
DOI: 10.1002/NDR2.12021
Publisher: Commonwealth Forestry Association
Date: 03-2021
DOI: 10.1505/146554821832140330
Abstract: Co-management in the Rema-Kalenga Wildlife Sanctuary was evaluated to assess how fairly capital assets were considered in the beneficiary selection, and to what extent it affected vegetation cover. A semi-structured questionnaire survey was employed to collect necessary information along with satellite images. The study revealed that many variables of social capital and a few variables of natural and financial capital played a significant role in the participant selection process. Analysis of dependency showed that the participants did not rely significantly on the forest both in terms of resource collection and their monetary value implying that the most dependent people were not adequately represented in the co-management team. The dominance of local leaders suppressed the voices of others in the management venture. An increase in forest vegetation cover was observed during the project period, although shortly after the end of co-management projects a slight deterioration of forest cover was noted. The findings of the study can serve as a guide in the future application of community forestry programmes in protected areas of Bangladesh and elsewhere in the world within similar socio-physiographic settings.
Publisher: Springer Science and Business Media LLC
Date: 03-2006
Publisher: Scientific Societies
Date: 09-2023
Publisher: Elsevier BV
Date: 07-2023
Location: Bangladesh
No related grants have been discovered for Dr. Mohammed Masum Ul Haque.