ORCID Profile
0000-0002-5331-0817
Current Organisation
University of Western Australia
Does something not look right? The information on this page has been harvested from data sources that may not be up to date. We continue to work with information providers to improve coverage and quality. To report an issue, use the Feedback Form.
In Research Link Australia (RLA), "Research Topics" refer to ANZSRC FOR and SEO codes. These topics are either sourced from ANZSRC FOR and SEO codes listed in researchers' related grants or generated by a large language model (LLM) based on their publications.
Plant Pathology | Plant Biology | Cellular Interactions (Incl. Adhesion, Matrix, Cell Wall) | Population And Ecological Genetics | Plant Pathology | Gene Expression | Horticultural Crop Improvement (Selection and Breeding) | Horticultural Crop Protection (Pests, Diseases and Weeds) | Microbiology | Virology | Plant Physiology | Mycology | Horticultural Production |
Horticultural crops | Field crops | Vegetables | Oilseeds | Wheat | Fodder crops | Vegetables | Sown legumes
Publisher: Springer Science and Business Media LLC
Date: 22-10-2016
Publisher: IEEE
Date: 11-2014
Publisher: Springer Science and Business Media LLC
Date: 2008
DOI: 10.1071/AP08002
Publisher: Springer Science and Business Media LLC
Date: 2008
DOI: 10.1071/AP08005
Publisher: Springer Science and Business Media LLC
Date: 2008
DOI: 10.1071/AP08008
Publisher: Scientific Societies
Date: 2020
DOI: 10.1094/PBIOMES-05-20-0036-R
Abstract: The definition of phytobiomes can be transposed to any agroecosystem and applies to any phase of crop cycles. Here, we study the crop establishment phase using a generic modeling framework to assess the potential role of phytobiomes on field crop establishment. We first developed a generic model called Crop Establishment SIMulator (CESIM) that takes into account cropping practices, seed and seedling characteristics, seedbed components (physical chemical and biological), and weather, as well as their interactions. All these variables were integrated in a qualitative aggregative hierarchical network to predict the quality of field crop establishment. CESIM has 38 basic (input variables) and 20 aggregated (19 state variables and 1 output variable) attributes for a total of 58 attributes. The prediction quality of the model was evaluated for a dataset of 231 field observations across four states of Australia and experimental results obtained in the last 40 years. Accuracy of predictions of the final attribute (i.e., crop establishment) was 91% and explained 29% of variability of the dataset, as described by the quadratic weighted Cohen’s κ. CESIM represents a unique and original generic model capable of taking into account a large number of variables and their interactions to predict the quality of field crop establishment. This model is flexible, transparent, and user friendly and, therefore, is suitable both for academic and nonacademic users. CESIM can be used across a wide range of situations to perform not only the ex-ante assessment of potential establishment quality of a given crop but also ex-post assessment.
Publisher: Springer Science and Business Media LLC
Date: 2006
Publisher: Scientific Societies
Date: 03-2021
DOI: 10.1094/PDIS-07-20-1470-RE
Abstract: Studies were undertaken across five field locations in Western Australia to determine the relative changes in disease severity and subsequent field pea yield from up to four foliar pathogens associated with a field pea foliar disease complex (viz. genera Didymella, Phoma, Peronospora, and Septoria) across four different pea varieties sown at three different times and at three different densities. Delaying sowing of field pea significantly (P 0.05) reduced the severity of Ascochyta blight (all five locations) and Septoria blight (one location), increased the severity of downy mildew (four locations), but had no effect on seed yield. In relation to Ascochyta blight severity at 80 days after sowing, at all locations the early time of sowing had significantly (P 0.05) more severe Ascochyta blight than the mid and late times of sowing. Increasing actual plant density from 20 to 25 plants m −2 to 58 to 78 plants m −2 significantly (P 0.05) increased the severity of the Ascochyta blight (four locations) and downy mildew (one location), and it increased seed yield at four locations irrespective of sowing date and three locations irrespective of variety. Compared with varieties Dundale, Wirrega, and Pennant, variety Alma showed significantly (P 0.05) less severe Ascochyta blight, downy mildew, and Septoria blight (one location each). Grain yield was highest for the early time of sowing at three locations. Varieties Alma, Dundale, and Wirrega significantly (P 0.05) outyielded Pennant at four locations. The percentage of isolations of in idual Ascochyta blight pathogens at 80 days after the first time of sowing varied greatly, with genus Didymella ranging from 25 to 93% and genus Phoma ranging from 6 to 23% across the five field locations. This fluctuating nature of in idual pathogen types and proportions within the Ascochyta blight complex, along with variation in the occurrence of pathogens Peronospora and Septoria, highlights the challenges to understand and manage the complexities of co-occurring different foliar pathogens of field pea. While the search for more effective host resistance continues, there is a need for and opportunities from further exploring and exploiting cultural management approaches focusing on crop sequence ersification, intercropping, manipulating time of sowing and stand density, and application of improved seed sanitation and residue/inoculum management practices. We discuss the constraints and opportunities toward overcoming the challenges associated with managing foliar disease complexes in field pea.
Publisher: Wiley
Date: 13-10-2022
DOI: 10.1111/PPA.13483
Abstract: Rapeseed ( Brassica napus ) production in Australia relies heavily on triazine‐or glyphosate‐tolerant cultivars. For 14 triazine‐tolerant cultivars, disease development of Neopseudocercosporella capsellae (white leaf spot), Alternaria brassicae and A . japonica (Alternaria leaf spot), and Hyaloperonospora brassicae (downy mildew) were all dependent upon herbicide application timing ( p 0.001), with significant differences between cultivars ( p 0.001) and a significant interaction ( p 0.001) between herbicide application timing and cultivars. Atrazine applied preinfection by N . capsellae , A . brassicae , or A . japonica enhanced disease incidence, severity, and leaf collapse, while atrazine application postinfection for these same pathogens reduced all three disease parameters. However, for H . brassicae , application of atrazine after, and especially prior to, infection resulted in lower disease incidence, severity, and leaf collapse. Application of glyphosate on five glyphosate‐tolerant cultivars for N . capsellae resulted in significant differences ( p 0.05) between glyphosate application treatments, and between host cultivars in terms of incidence and consequent leaf collapse. For A . brassicae , A . japonica , and H . brassicae , glyphosate resulted in significant differences ( p 0.001) across application timings between cultivars, and a significant interaction ( p 0.001) between herbicide application timings and cultivars. Glyphosate applied on glyphosate‐resistant rapeseed after, and especially prior to, attack by H . brassicae , reduced downy mildew. These are the first studies to highlight how the timing of application of triazine or glyphosate in relation to pathogen infection is critical to the susceptibility of rapeseed to white leaf spot, Alternaria leaf spot, and downy mildew. This new understanding offers fresh possibilities for improved management of these diseases in herbicide‐tolerant rapeseed crops.
Publisher: Springer Science and Business Media LLC
Date: 13-05-2011
Publisher: Springer Science and Business Media LLC
Date: 09-06-2018
DOI: 10.1007/S00572-018-0842-Z
Abstract: Mycorrhizal symbiosis requires several common symbiosis genes including CYCLOPS/IPD3. The reduced mycorrhizal colonisation (rmc) tomato mutant has a deletion of five genes including CYCLOPS/IPD3, and rmc is more susceptible to Fusarium wilt than its wild-type parental line. This study investigated the genetic defects leading to both fungal interaction phenotypes and whether these were separable. Complementation was performed in rmc to test the requirement for CYCLOPS/IPD3 in mycorrhiza formation and Fusarium wilt tolerance. Promoter analysis via GFP expression in roots was conducted to determine the role of native regulatory elements in the proper functioning of CYCLOPS/IPD3. CYCLOPS/IPD3 regulated by its native promoter, but not a 2×35S promoter, restores mycorrhizal association in rmc. GFP regulated by the 2×35S promoter is not expressed in epidermal cells of roots, indicating that expression of CYCLOPS/IPD3 in these cells is required for colonisation by the fungi utilised in this research. CYCLOPS/IPD3 did not restore Fusarium wilt tolerance, however, showing that the genetic requirements for mycorrhizal association and Fusarium wilt tolerance are different. Our results confirm the expected role of CYCLOPS/IPD3 in mycorrhizal symbiosis and suggest that Fusarium tolerance is conferred by one of the other four genes affected by the deletion.
Publisher: Scientific Societies
Date: 09-2005
Abstract: Leptosphaeria maculans, the causal agent of stem canker of oilseed rape, develops gene-for-gene interactions with its hosts. To date, eight L. maculans avirulence (Avr) genes, AvrLm1 to AvrLm8, have been genetically characterized. An additional Avr gene, AvrLm9, that interacts with the resistance gene Rlm9, was genetically characterized here following in vitro crosses of the pathogen. A worldwide collection of 63 isolates, including the International Blackleg of Crucifers Network collection, was genotyped at these nine Avr loci. In a first step, isolates were classified into pathogenicity groups (PGs) using two published differential sets. This analysis revealed geographical disparities as regards the proportion of each PG. Genotyping of isolates at all Avr loci confirmed the disparities between continents, in terms of Avr allele frequencies, particularly for AvrLm2, AvrLm3, AvrLm7, AvrLm8, and AvrLm9, or in terms of race structure, ersity, and complexity. Twenty-six distinct races were identified in the collection. A larger number of races (n = 18) was found in Australia than in Europe (n = 8). Mean number of virulence alleles per isolate was also higher in Australia (5.11 virulence alleles) than in Europe (4.33) and Canada (3.46). Due to the ersity of populations of L. maculans evidenced here at the race level, a new, open terminology is proposed for L. maculans race designation, indicating all Avr loci for which the isolate is avirulent.
Publisher: Wiley
Date: 02-11-2019
DOI: 10.1111/PPA.12955
Publisher: Springer Science and Business Media LLC
Date: 2006
DOI: 10.1071/AP05090
Publisher: Wiley
Date: 22-02-2018
DOI: 10.1111/PPA.12837
Publisher: Springer Science and Business Media LLC
Date: 02-02-2012
DOI: 10.1007/S12550-011-0122-7
Abstract: An isolated occurrence of Fusarium head blight (FHB) of wheat was detected in the south-west region of Western Australia during the 2003 harvest season. The molecular identity of 23 isolates of Fusarium spp. collected from this region during the FHB outbreak confirmed the associated pathogens to be F. graminearum, F. acuminatum or F. tricinctum. Moreover, the toxicity of their crude extracts from Czapek-Dox liquid broth and millet seed cultures to brine shrimp (Artemia franciscana) was associated with high mortality levels. The main mycotoxins detected were type B trichothecenes (deoxynivalenol and 3-acetyldeoxynivalenol), enniatins, chlamydosporol and zearalenone. This study is the first report on the mycotoxin profiles of Fusarium spp. associated with FHB of wheat in Western Australia. This study highlights the need for monitoring not just for the presence of the specific Fusarium spp. present in any affected grain but also for their potential mycotoxin and other toxic secondary metabolites.
Publisher: Springer Science and Business Media LLC
Date: 2006
Publisher: Springer Science and Business Media LLC
Date: 09-01-2017
Publisher: Frontiers Media SA
Date: 04-06-2021
DOI: 10.3389/FCIMB.2021.678231
Abstract: White leaf spot pathogen: Neopseudocercosporella capsellae causes significant damage to many economically important Brassicaceae crops, including oilseed rape through foliar, stem, and pod lesions under cool and wet conditions. A lack of information on critical aspects of the pathogen’s life cycle limits the development of effective control measures. The presence of single-celled spores along with multi-celled conidia on cotyledons inoculated with multi-celled conidia suggested that the multi-celled conidia were able to form single-celled spores on the host surface. This study was designed to demonstrate N. capsellae morphological plasticity, which allows the shift between a yeast-like single-celled phase and the multi-celled hyphal phase. Separate experiments were designed to illustrate the pathogen’s morphological transformation to single-celled yeast phase from multi-celled hyphae or multi-celled macroconidia in-vitro and in-planta . Results confirmed the ability of N. capsellae to switch between two morphologies (septate hyphae and single-celled yeast phase) on a range of artificial culture media ( in-vitro ) or in-planta on the host surface before infection occurs. The hyphae-to-yeast transformation occurred through the production of two morphologically distinguishable blastospore (blastoconidia) types (meso-blastospores and micro-blastospores), and arthrospores (arthroconidia).
Publisher: Springer Science and Business Media LLC
Date: 04-10-2012
DOI: 10.1007/S00248-011-9949-X
Abstract: Many of the fungal pathogens that threaten agricultural and natural systems undergo wind-assisted dispersal. During turbulent wind conditions, long-distance dispersal can occur, and airborne spores are carried over distances greater than the mean. The occurrence of long-distance dispersal is an important ecological process, as it can drastically increase the extent to which pathogen epidemics spread across a landscape, result in rapid transmission of disease to previously uninfected areas, and influence the spatial structure of pathogen populations in fragmented landscapes. Since the timing of spore release determines the wind conditions that prevail over a dispersal event, this timing is likely to affect the probability of long-distance dispersal occurring. Using a Lagrangian stochastic model, we test the effect of seasonal and diurnal variation in the release of spores on wind-assisted dispersal. Spores released during the hottest part of the day are shown to be more likely to undergo long-distance dispersal than those released at other times. Furthermore, interactions are shown to occur between seasonal and diurnal patterns of release. These results have important consequences for further modelling of wind-assisted dispersal and the use of models to predict the spread of fungal pathogens and resulting population and epidemic dynamics.
Publisher: Springer Science and Business Media LLC
Date: 2007
DOI: 10.1071/AP07027
Publisher: Elsevier BV
Date: 05-2011
Publisher: Springer Science and Business Media LLC
Date: 22-05-2017
Publisher: Elsevier BV
Date: 02-2008
Publisher: Springer Science and Business Media LLC
Date: 26-10-2018
Publisher: Wiley
Date: 02-01-2020
DOI: 10.1111/PPA.13135
Publisher: CSIRO Publishing
Date: 2016
DOI: 10.1071/CP16182
Abstract: Powdery mildew of brassicas, caused by Erysiphe cruciferarum, is an emerging threat to oilseed Brassica production in Australia. Resistance to powdery mildew was assessed in 112 current and historic Australian Brassica napus canola cultivars and five cultivars of B. juncea mustard cultivars under controlled environmental conditions. Only 18% of leaf area was infested by the end of the test on the most resistant cultivars, compared with means of up to 70% for the most susceptible cultivars as well as severe stem and pod infection. For B. napus, cultivars with the greatest potential for reducing the impact of powdery mildew in the field were Trooper, Bravo TT, Summit, Tumby, Narendra and Hyola 650TT, all ranked in the 10% of cultivars with the lowest leaf infestation (Area Under The Disease Progress Curve (AUDPC) ) and with % of stem area infested. For B. juncea, the level of leaf infestation was lowest for Sahara CL and Xceed X121 CL (AUDPC 303 and 380 respectively), but the high levels of stem infestation (42% and 28% respectively) in these cultivars may reduce their usefulness in the field. The most resistant cultivars identified can be immediately deployed into regions where powdery mildew is prevalent, providing the canola industry with an immediate and effective option for management of this increasingly troublesome disease.
Publisher: Scientific Societies
Date: 03-2014
DOI: 10.1094/PDIS-07-13-0737-PDN
Abstract: Blueberry (Vaccinium corymbosum) plants in a commercial plantation at Yanchep, Western Australia, in April and May 2013, showed a widespread leaf spotting condition. Leaf lesions were circular to irregular, light brown to gray, 1 to 5 mm in diameter, with distinct dark brownish red borders. A fungus was consistently recovered by plating surface-sterilized (1% NaOCl) sections of symptomatic leaf tissue onto water agar and sub-culturing onto potato dextrose agar (PDA). For conidial production, the fungus was grown on PDA under a 12-h/12-h dark/light photoperiod at 25°C. Fungal colonies had a dark olive color on both sides, with loose, cottony mycelium on the surface of cultures. Isolates showed morphological similarities to Alternaria tenuissima as described in other reports (1,3). Simple conidiophores ranged from 16.3 to 96.6 μm (mean 37.5 μm) and produced numerous conidia in long chains. Conidia ranged from 7.0 to 23.9 μm (mean 13.9 μm) in length and 3.9 to 7.5 μm (mean 5.7 μm) in width, contained two to five transverse septa, but only an occasional longitudinal septum was observed. Using a representative isolate, a PCR-based assay with the ITS1 and ITS4 primers was used to lify from the 3′ end of 16S rRNA, across ITS1, 5.8S rRNA, and ITS2 to the 5′ end of the 26S rRNA (4). The DNA products were sequenced and BLAST analyses were used to compare sequences with those in GenBank (2). The sequence had ≥99% nucleotide identity with the corresponding sequence in GenBank (Accession No. KC568287) for A. tenuissima. The relevant information for a representative isolate has been lodged in GenBank (KF408355). A conidial suspension of 2.5 × 10 5 conidia ml –1 from a single-spore culture was spot inoculated onto 20 leaves, ranging from recently emerged to oldest, of 6-month-old V. corymbosum Nellie Kelly plants maintained at 18/13°C 12-h/12-h day/night and % relative humidity for 72 h post inoculation. Symptoms were evident by 18 days post inoculation and by 24 days consisted of pale brown lesions that were mostly 2.1 to 2.5 μm in diameter and with distinct dark brownish red borders. A. tenuissima, showing morphological characteristics identical to those described above, was re-isolated from lesions to fulfill Koch's postulates. No lesions occurred on an equivalent number of leaves of control plants inoculated with only deionized water. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13639). A. tenuissima has been reported across Australia on a range of other hosts. However, on V. corymbosum, the pathogen has only previously been recorded in Tasmania (2009). It may also have been the cause of a leaf spotting condition on V. corymbosum recorded in Victoria (1976) and New South Wales (1984), but mistakenly listed with A. alternata as the cause. To the best of our knowledge, this is the first record of A. tenuissima on V. corymbosum in Western Australia. With 10 to 30% of leaves showing disease symptoms widely spread on many V. corymbosum plants in the commercial plantation, this pathogen could potentially adversely affect the future production of blueberries in Western Australia. References: (1) F. L. Caruso and R. C. Ramsdell, eds. Compendium of Blueberry and Cranberry Diseases. American Phytopathological Society, St. Paul, MN, 1995. (2) J. C. Kang et al. Mycol. Res. 106:1151, 2002. (3) E. G. Simmons. Mycotaxon 70:325, 1999. (4) T. J. White et al. Pages 315-322 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.
Publisher: Scientific Societies
Date: 08-2008
Abstract: The value of Katanning Early Maturing (KEM) breeding lines from Western Australia, derived from Brassica napus × B. juncea crosses, was assessed as a source of germplasm for resistance to blackleg disease (caused by Leptosphaeria maculans) in spring-type oilseed rape cultivars. The stability of blackleg resistance in these KEM lines was related to key cytological characteristics to determine why there are poor levels of introgression of this resistance into progeny. Promising recombinant KEM lines were crossed with the spring-type B. napus cv. Dunkeld, which has useful polygenic resistance to blackleg, and screened for resistance. The lines were analyzed cytologically for pairing of bivalents in each generation to aid in the selection of stable recombinant lines. KEM recombinant lines showing regular meiotic behavior and a high level of blackleg resistance were obtained for the first time. We also showed that the stable introgression of the B. juncea resistance from the KEM lines into a ‘Dunkeld’ background was possible. Inoculation of selfing and backcross populations with isolates of L. maculans having different AvrLm genes indicated that the B. juncea resistance gene, Rlm6, had been introgressed into a B. napus spring-type cultivar carrying polygenic resistance. The combination of both resistances would enhance the overall effectiveness of resistance against L. maculans. This is clearly needed in Australia and France where cultivars relying upon single dominant gene-based resistance for their effectiveness have proved not durable.
Publisher: Wiley
Date: 05-12-2019
DOI: 10.1111/PPA.12963
Publisher: CABI Publishing
Date: 18-07-2012
Abstract: This review is motivated by (i) the magnitude of the threat to world food security and ersity of natural vegetation posed by viral and bacterial pathogens of plants at a time of accelerating climate change and (ii) the inadequate attention given to this subject by earlier reviews on climate change and plant disease. It starts by providing background information on current climate change predictions, the increasing worldwide importance of viral and bacterial diseases, critical features of their pathosystems and the general influence of environmental factors upon them. It then develops comprehensive climatic and biological frameworks and uses them to determine the likely influences of direct and indirect climate change parameters on the many different host, vector and pathogen parameters that represent the ersity of viral and bacterial pathosystems. This approach proved a powerful way to identify the relevant international research data available and many information gaps where research is needed in the future. The analysis suggested that climate change is likely to modify many critical viral and bacterial epidemic components in different ways, often resulting in epidemic enhancement but sometimes having the opposite effect, depending on the type of pathosystem and circumstances. With vector-borne pathosystems and new encounter scenarios, the complication of having to consider the effects climate change parameters on erse types of vectors and the emergence of previously unknown pathogens added important additional variables. The increasing difficulties in controlling damaging plant viral and bacterial epidemics predicted to arise from future climate instability warrants considerable research effort to safeguard world food security and bio ersity.
Publisher: Springer Science and Business Media LLC
Date: 19-08-2020
DOI: 10.1038/S41396-020-00744-6
Abstract: Fungal pathogens are seriously threatening food security and natural ecosystems efficient and environmentally friendly control methods are essential to help safeguard such resources for increasing human populations on a global scale. Here, we find that Sclerotinia sclerotiorum , a widespread pathogen of dicotyledons, can grow endophytically in wheat, rice, barley, maize, and oat, providing protection against Fusarium head blight, stripe rust, and rice blast. Protection is also provided by disabled S. sclerotiorum strains harboring a hypovirulence virus. The disabled strain DT-8 promoted wheat yields by 4–18% in the field and consistently reduced Fusarium disease by 40–60% across multiple field trials. We term the host-dependent trophism of S. sclerotiorum , destructively pathogenic or mutualistically endophytic, as schizotrophism. As a biotroph, S. sclerotiorum modified the expression of wheat genes involved in disease resistance and photosynthesis and increased the level of IAA. Our study shows that a broad-spectrum pathogen of one group of plants may be employed as a biocontrol agent in a different group of plants where they can be utilized as beneficial microorganisms while avoiding the risk of in-field release of pathogens. Our study also raises provocative questions about the potential role of schizotrophic endophytes in natural ecosystems.
Publisher: Elsevier BV
Date: 08-2016
Publisher: Wiley
Date: 10-2008
Publisher: Elsevier BV
Date: 10-2007
Publisher: CSIRO Publishing
Date: 2000
DOI: 10.1071/AR99049
Abstract: Asurvey of 30 medic pastures for root-rots was undertaken in Western Australia and pathogenicity tests of representative fungal isolates from roots s led were conducted to determine the main factors contributing to medic decline and the association between those factors. In particular, the contribution of pathogenic fungi and nematodes to medic root-rot in Western Australia was studied. From a total of 30 000 pieces of root plated, 3836 fungal isolates were obtained and identified at least to genus level. Four hundred and seventy-two representative isolates were tested for in vitro pathogenicity in Medicago sphaerocarpos cv. Orion. Of these, 32 were further tested in the glasshouse. The pathogenicity tests indicated that 56% of isolates were capable of causing significant damage to the root system and it is likely that pathogenic fungi are largely responsible for medic root-rot in the field. In contrast, the number of Pratylenchus spp. in the roots was not found to relate to disease symptoms. It is concluded that soil-borne pathogenic fungi such as species of Pythium, Fusarium, and Phoma contribute significantly to medic pasture decline in Western Australia.
Publisher: No publisher found
Date: 2015
Publisher: Springer Science and Business Media LLC
Date: 28-08-2018
Publisher: Springer Science and Business Media LLC
Date: 23-03-2011
Publisher: Wiley
Date: 26-07-2007
DOI: 10.1111/J.1462-2920.2007.01408.X
Abstract: Leptosphaeria maculans, a dothideomycete fungus causing stem canker on oilseed rape, develops gene-for-gene interactions with its host plants. It has the ability to rapidly adapt to selection pressure exerted by cultivars harbouring novel resistance genes as exemplified recently by the 3-year evolution towards virulence at the AvrLm1 locus in French populations. The AvrLm1 avirulence gene was recently cloned and shown to be a solo gene within a 269 kb non-coding, heterochromatin-like region. Here we describe the sequencing of the AvrLm1 genomic region in one avirulent and two virulent isolates to investigate the molecular basis of evolution towards virulence at the AvrLm1 locus. For these virulent isolates, the gain of virulence was linked to a 260 kb deletion of a chromosomal segment spanning AvrLm1 and deletion breakpoints were identical or similar. Among the 460 isolates analysed from France, Australia and Mexico, a similar large deletion was apparent in > 90% of the virulent isolates. Deletion breakpoints were also strongly conserved in most of the virulent isolates, which led to the hypothesis that a unique deletion event leading to the avrLm1 virulence has diffused in pathogen populations. These data finally suggest that retrotransposons are key drivers in genome evolution and adaptation to novel selection pressure in L. maculans.
Publisher: Elsevier BV
Date: 07-2013
Publisher: Springer Science and Business Media LLC
Date: 29-06-2021
Publisher: Wiley
Date: 16-02-2020
DOI: 10.1111/PPA.13149
Publisher: CSIRO Publishing
Date: 2008
DOI: 10.1071/AR07262
Abstract: Twenty-eight cultivars and 106 F6-derived breeding lines of subterranean clover (Trifolium subterraneum) were screened in the field for their response to clover scorch disease caused by race 1 of Kabatiella caulivora. Eleven of the cultivars, including Denmark and Goulburn, were classified as resistant. Breeding lines with Denmark parentage had 55% of progeny with resistance, while those of Goulburn had only 19% of resistant progeny, suggesting different modes of inheritance. Selection for resistance to race 2 of K. caulivora in the F4 generation markedly increased the probability of selecting F6-derived lines with resistance to race 1, suggesting linkage between genes for resistance to both races.
Publisher: Scientific Societies
Date: 03-2020
DOI: 10.1094/PDIS-06-19-1157-FE
Abstract: The use of fungicide seed treatment (FST) is a very common practice worldwide. The purported effectiveness of many fungicides in providing broad-spectrum and systemic control of important diseases and the perception that FST reduces overall pesticide use, hence lowering environmental impacts, have greatly promoted the use of FST in the last five decades. Since there have been rapid advancements in the types, formulations, and application methods for seed treatments, there is a need to re-evaluate the benefits versus the risks of FST as a practice. While the use of seeds treated with neonicotinoid insecticides has come under scrutiny due to concern over potential nontarget effects, there are knowledge gaps on potential negative impacts of FST on operators’ (those who apply, handle, and use treated seeds) health and nontarget soil organisms (both macro- and microorganisms). Here we review existing knowledge on key fungicides used for seed treatments, benefits and risks related to FST, and propose recommendations to increase benefits and limit risks related to the use of FST. We found FST is applied to almost 100% of sown seeds for the most important arable crops worldwide. Fungicides belonging to 10 chemical families and with one or several types of mobility (contact, locally systemic, and xylem mobile) are used for seed treatment, although the majority are xylem mobile. Seed treatments are applied by the seed distributor, the seed company, and the farmer, although the proportion of seed lots treated by these three groups vary from one crop to another. The average quantity of fungicide active ingredient (a.i.) applied via seed treatment depends on the crop species, environment(s) into which seed is planted, and regional or local regulations. Cost-effectiveness, protection of the seed and seedlings from pathogens up to 4–5 weeks from sowing, user friendliness, and lower impact on human health and nontarget soil organisms compared with foliar spray and broadcast application techniques, are among the most claimed benefits attributed to FST. In contrast, inconsistent economic benefits, development of resistance by soilborne pathogens to many fungicides, exposure risks to operators, and negative impacts on nontarget soil organisms are the key identified risks related to FST. We propose eight recommendations to reduce risks related to FST and to increase their benefits.
Publisher: Public Library of Science (PLoS)
Date: 27-03-2015
Publisher: Springer Science and Business Media LLC
Date: 16-07-2010
DOI: 10.1007/S00705-010-0740-Y
Abstract: The complete coat protein nucleotide encoding sequences of 13 Mirafiori lettuce big-vein virus isolates from Australia were compared to those of 23 other isolates, including one from Australia. On phylogenetic analysis, sub-clade A1 contained isolates from Australia (13), Europe and Japan, A2 contained isolates from Australia (1), Europe and South America, and B1 and B2 contained only European isolates. In the amino acid sequences deduced, the N-terminus and central regions varied considerably between clades A and B. Mean Dn/Ds ratios were 0.112, 0.076, 0.187 and 0.063 for all isolates, Australian isolates, clade A isolates and clade B isolates, respectively.
Publisher: American Society for Microbiology
Date: 27-10-2016
Abstract: We present the first complete Sweet potato virus G (SPVG) genome from sweet potato in East Timor and compare it with seven complete SPVG genomes from South Korea (three), Taiwan (two), Argentina (one), and the United States (one). It most resembles the genomes from the United States and South Korea.
Publisher: Elsevier BV
Date: 02-2006
Publisher: Springer Science and Business Media LLC
Date: 19-03-2016
Publisher: CSIRO Publishing
Date: 2015
DOI: 10.1071/CP15064
Abstract: Sclerotinia stem rot (SSR), caused by Sclerotinia sclerotiorum, is an important disease of oilseed brassicas, yet the susceptibility of Australian varieties is unknown. Fifty-five historic, current and potential new Australian canola and mustard varieties were field-screened to determine their relative levels of resistance to SSR. Mean lesion length following stem inoculation with a highly virulent isolate (MBRS1) of the prevailing S. sclerotiorum pathotype (76) ranged from 3.0 mm in the B. napus cultivar Mystic to 202.6 mm (P 0.001). Three recently developed B. juncea varieties or breeding lines, Sahara, JB0T-908982 and Xceed X121 CL, were extremely susceptible to S. sclerotiorum (mean lesion lengths 90.6, 132.3 and 202.6 mm, respectively). Histological study showed that the high level of resistance in Mystic was associated with strong deposition of lignin in stem cortical cell walls to form a barrier between the invading pathogen and the vascular tissues. Lack of association between mean lesion length and the year of varietal release (R2 = 0.005) shows that there has been no improvement in level of resistance to SSR in Australian canola and mustard varieties over the last two decades. Although the very high susceptibility of a few B. juncea varieties demonstrated the value of SSR resistance present in B. napus varieties, this level of resistance is inadequate to prevent ongoing, severe yield losses from SSR under conditions conducive for disease development. Breeding programs can immediately utilise the SSR resistance in Mystic, and other recently identified resistances. This will enable a shift from the current dependence on fungicidal control to reliance on cost-effective, sustainable host resistance as the basis for better management of SSR.
Publisher: Springer Science and Business Media LLC
Date: 17-09-2011
Publisher: Frontiers Media SA
Date: 11-01-2018
Publisher: Springer Science and Business Media LLC
Date: 2005
DOI: 10.1071/AP04092
Publisher: Frontiers Media SA
Date: 04-04-2017
Publisher: Scientific Societies
Date: 04-2008
Abstract: In Australia, Brassica juncea (L.) Czern & Coss (Indian mustard) has the potential as a more drought-tolerant oilseed crop than the B. napus L., with the first canola-quality B. juncea varieties released in Australia in 2006 and first sown for commercial production in 2007. Increased production of B. juncea is expected to result in the appearance of diseases previously unreported in Australia. In the spring of 2007 at the University of Western Australia field plots at Crawley (31.99°S, 115.82°E), Western Australia, plants of B. juncea genotypes from Australia and China had extensive stem colonization by powdery mildew at the end of the flowering period, with whitish patches ranging in size from 3 mm to 3 cm long. These patches coalesced to form a dense, white, powdery layer as they expanded. Pathogenicity was demonstrated by gently pressing infected stems containing abundant sporulation onto leaves of potted B. juncea seedlings of variety JM-18, incubating the plants in a moist chamber for 48 h, and then maintaining the plants in a controlled-environment room at 18/13°C for day/night. Signs of powdery mildew appeared at 7 days after inoculation, and by 10 days, it was well developed. Uninoculated control plants did not have powdery mildew. When symptomatic plants were examined, abundant conidia were typical of Erysiphe cruciferarum Opiz ex Junell, with cylindrical conidia borne singly or in short chains as described previously (2). Mycelia were higenous, in patches, and often spreading to become effused. Conidiophores were straight, foot cells were cylindrical, and conidia were mostly produced singly and measured 21.2 to 35.4 (mean 26.7 μm) × 8.8 to 15.9 μm (mean 11.9 μm) from measurements of 100 conidia. The spore size that we measured approximated what was found for E. cruciferarum (2) (30 to 40 × 12 to 16 μm), since we found 35 and 50% of spores falling within this range in terms of length and width, respectively. Conidia were, however, generally smaller in size than that reported on broccoli raab in California (1) (35 to 50 × 12 to 21 μm). We confirmed a length-to-width ratio greater than 2 as was found previously (1,2). Infected leaves showed signs of early senescence. While powdery mildew caused by E. cruciferarum is an important disease of B. juncea in India where yield losses as much as 17% have been reported (4), its potential impact in Australia is yet to be determined. To our knowledge, this is the first record of E. cruciferarum on B. juncea in Australia. In Western Australia, E. cruciferarum has been recorded on B. napus (oilseed rape) since 1986 and on B. napus L. var. napobrassica (L.) Reichenb. (swede) since 1971 (3). In other regions of Australia, it has been recorded on B. rapa in Queensland since 1913 and on B. napus (oilseed rape) in South Australia since 1973. References: (1) S. T. Koike and G. S. Saenz. Plant Dis. 81:1093, 1997. (2) T. J. Purnell and A. Sivanesan. No 251 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, UK, 1970. (3) R. G. Shivas. J. R. Soc. West. Aust. 72:1, 1989. (4) A. K. Shukla et al. Manual on Management of Rapeseed-Mustard Diseases. National Research Centre on Rapeseed-Mustard, Bharatpur, India, 2003.
Publisher: Scientific Societies
Date: 10-2021
DOI: 10.1094/PDIS-03-21-0606-RE
Abstract: Phoma black stem and leaf spot disease of annual Medicago spp., caused by Phoma medicaginis, not only can devastate forage and seed yield but can reduce herbage quality by inducing production of phytoestrogens (particularly coumestrol and 4′-O-methylcoumestrol), which can also reduce the ovulation rates of animals grazing infected forage. We determined the consequent phytoestrogen levels on three different annual Medicago species/cultivars (Medicago truncatula cultivar Cyprus, Medicago polymorpha var. brevispina cultivar Serena, and Medicago murex cultivar Zodiac) after inoculation with 35 isolates of P. medicaginis. Across the isolate × cultivar combinations, leaf disease incidence, petiole/stem disease incidence, leaf disease severity, petiole disease severity, and leaf yellowing severity ranged up to 100, 89.4, 100, 58.1, and 61.2%, respectively. Cultivars Cyprus and Serena were the most susceptible and cultivar Zodiac was the most resistant to P. medicaginis. Isolates WAC3653, WAC3658, and WAC4252 produced the most severe disease. Levels of phytoestrogens in stems ranged from 25 to 1,995 mg/kg for coumestrol and from 0 to 418 mg/kg for 4′-O-methylcoumestrol. There was a significant positive relationship of disease incidence and severity parameters with both coumestrol and 4′-O-methylcoumestrol contents, as noted across in idual cultivars and across the three cultivars overall, where r = 0.39 and 0.37 for coumestrol and 4′-O-methylcoumestrol, respectively (P 0.05). Although cultivar Serena was most susceptible to P. medicaginis and produced the highest levels of phytoestrogens in the presence of P. medicaginis, cultivar Zodiac contained the highest levels of phytoestrogens in comparison with other cultivars in the absence of P. medicaginis. There was a 15-fold increase in coumestrol in cultivar Serena but only a 7-fold increase in cultivar Zodiac from infection of P. medicaginis. The study highlights that the intrinsic ability of a particular cultivar to produce phytoestrogens in the absence of the pathogen, and its comparative ability to produce phytoestrogens in the presence of the P. medicaginis, are both important and highly relevant to developing new annual Medicago spp. cultivars that offer improved disease resistance and better animal reproductive outcomes.
Publisher: CSIRO Publishing
Date: 2006
DOI: 10.1071/AR06066
Abstract: Sclerotinia stem rot, caused by Sclerotinia sclerotiorum, has become one of the most serious disease problems in oilseed rape-growing areas in Australia. Sources of resistance to this disease have been sought worldwide. In this study, germplasm comprising 42 Brassica napus and 12 Brassica juncea accessions from China and Australia, was screened for resistance to Sclerotinia stem rot under Western Australian field conditions. Resistance was confirmed in some germplasm from China and new sources of resistance were identified in germplasm from Australia. Furthermore, our study found that the severity of stem lesions was related to stem diameter and percentage of the host plants that were dead. It was evident that both stem lesion length and percentage of plant death were at the lowest level when the stem diameter was approximately 10 mm. Smaller or greater stem diameter resulted both in increased stem lesion length and plant death. Stem diameter may be a useful parameter in breeding cultivars of oilseed Brassicas with Sclerotinia resistance.
Publisher: Scientific Societies
Date: 06-2015
DOI: 10.1094/PDIS-09-14-0929-RE
Abstract: The length of time Potato spindle tuber viroid (PSTVd) remained infective in extracted tomato leaf sap on common surfaces and the effectiveness of disinfectants against it were investigated. When sap from PSTVd-infected tomato leaves was applied to eight common surfaces (cotton, wood, rubber tire, leather, metal, plastic, human skin, and string) and left for various periods of time (5 min to 24 h) before rehydrating the surface and rubbing onto healthy tomato plants, PSTVd remained infective for 24 h on all surfaces except human skin. It survived best on leather, plastic, and string. It survived less well after 6 h on wood, cotton, and rubber and after 60 min on metal. On human skin, PSTVd remained infective for only 30 min. In general, rubbing surfaces contaminated with dried infective sap directly onto leaves caused less infection than when the sap was rehydrated with distilled water but overall results were similar. The effectiveness of five disinfectant agents at inactivating PSTVd in sap extracts was investigated by adding them to sap from PSTVd-infected leaves before rubbing the treated sap onto leaves of healthy tomato plants. Of the disinfectants tested, 20% nonfat dried skim milk and a 1:4 dilution of household bleach (active ingredient sodium hypochlorite) were the most effective at inactivating PSTVd infectivity in infective sap. When reverse-transcription polymerase chain reaction was used to test the activity of the five disinfectants against PSTVd in infective sap, it detected PSTVd in all instances except in sap treated with 20% nonfat dried skim milk. This study highlights the stability of PSTVd in infective sap and the critical importance of utilizing hygiene practices such as decontamination of clothing, tools, and machinery, along with other control measures, to ensure effective management of PSTVd and, wherever possible, its elimination in solanaceous crops.
Publisher: CSIRO Publishing
Date: 2012
DOI: 10.1071/CP12239
Abstract: Subterranean clover (Trifolium subterraneum) is a key pasture legume across southern Australia and elsewhere. Decline in subterranean clover pastures was first recognised in Australia during the 1960s and manifests as an increase in weeds and a decrease in desirable legume species. While both root disease and poor nutrition contribute to subterranean clover pasture decline, the relationships between root disease and nutrition have not been determined. The objective of this study was to define these relationships. Field experiments were undertaken to determine the nutritional and pathogen status of soils and subterranean clover from three Western Australian field sites. Subsequently, controlled environment experiments were undertaken to determine the relative severities of tap and lateral root disease and growth of plants when soil cores taken from these three field sites were amended with a complete nutrient solution or a range of in idual macro- or micronutrient treatments. Application of a ‘Hoaglands’ complete nutrient solution decreased the severity of tap root disease by an average of 45% and lateral root disease by 32%. Amendment with K alone reduced the severity of tap root disease an average of 32% while the application of N alone reduced the severity of tap root disease by 33% and lateral root disease by 27%. Application of Hoaglands, K, N or Zn increased shoot and root dry weight, while Mo only increased shoot dry weight. This is the first report to show that mineral nutrients can substantially ameliorate root disease in subterranean clover. The results demonstrate that while root disease limits plant growth, improvement in the nutritional status of nutrient-impoverished soils can significantly reduce root disease. There is significant potential to incorporate nutrient amendments into an integrated and more sustainable approach to better manage root disease and to increase productivity of pasture legumes where soils are inherently nutrient deficient in one or more nutrients.
Publisher: Springer Science and Business Media LLC
Date: 28-06-2017
Publisher: Springer Science and Business Media LLC
Date: 16-03-2010
DOI: 10.1007/S00705-010-0641-0
Abstract: The complete coat protein (CP) nucleotide sequences of seven Lettuce big-vein associated virus (LBVaV) isolates from Australia were compared to those of 22 other LBVaV and five tobacco stunt virus (TStV) isolates. On phylogenetic analysis, clade I contained only LBVaV isolates from Europe, sub-clade IIa only Australian LBVaV isolates, IIb only Japanese LBVaV isolates, and IIc only TStV isolates from Japan. In the amino acid sequences deduced, the central region of the gene was most ergent. Mean Dn/Ds ratios were 0.283 and 0.124 for clades I and II, respectively. The suggestion that TStV is a strain of LBVaV was supported.
Publisher: Wiley
Date: 30-09-2021
DOI: 10.1111/PPA.13277
Publisher: CSIRO Publishing
Date: 2006
DOI: 10.1071/EA05083
Abstract: Urana is a hardseeded, moderately early flowering F5-derived crossbred subterranean clover of var. subterraneum [(Katz. et Morley) Zohary and Heller] developed by the collaborating organisations of the National Annual Pasture Legume Improvement Program. It has been selected for release as a new cultivar on the basis of its high winter and spring herbage production and overall field performance relative to other subterranean clovers of similar maturity. Urana is recommended for sowing in Western Australia, New South Wales, Victoria, South Australia and Queensland. It is best suited to well-drained, moderately acidic soils in areas with a growing season of 5–7 months, which extends into mid-October. Urana is suited to phase farming and crop rotations. It has been granted Plant Breeders Rights in Australia.
Publisher: Elsevier BV
Date: 12-2018
Publisher: Scientific Societies
Date: 03-2020
DOI: 10.1094/PDIS-06-19-1252-RE
Abstract: Annual forage legumes across southern Australia continue to be devastated by soilborne diseases. Nine fungicide seed treatments (thiram, metalaxyl, iprodione, phosphonic acid, propamocarb, fluquinconazole, difenoconazole + metalaxyl, ipconazole + metalaxyl, sedaxane + difenoconazole + metalaxyl) and four foliar fungicide treatments (phosphonic acid, metalaxyl, propamocarb, iprodione) were tested on four subterranean clover cultivars against in idual oomycete soilborne pathogens Pythium irregulare, Aphanomyces trifolii, and Phytophthora clandestina and the fungal pathogen Rhizoctonia solani. Best treatments were then further tested across southern Australia in 2 years of field experiments. Under controlled conditions, seed treatment with thiram was best against d ing-off caused by P. irregulare across the four cultivars (Woogenellup, Riverina, Seaton Park, Meteora), while metalaxyl was the most effective for maximizing root and shoot weights. Against A. trifolii, metalaxyl, iprodione, difenoconazole + metalaxyl, ipconazole + metalaxyl, and sedaxane + difenoconazole + metalaxyl, all reduced d ing-off sedaxane + difenoconazole + metalaxyl, fluquinconazole, and ipconazole + metalaxyl all reduced lateral root disease across two or more cultivars while iprodione, thiram, and sedaxane + difenoconazole + metalaxyl increased shoot dry weight. Against P. clandestina, metalaxyl was the most effective in reducing tap and lateral root rot followed by ipconazole + metalaxyl or phosphonic acid for tap and lateral rot, respectively. Against R. solani, there were no effects of fungicides. For P. irregulare and P. clandestina, there were strong seed fungicide × cultivar interactions (P 0.001). Under controlled conditions for foliar fungicide spray treatments, phosphonic acid was best at preventing productivity losses from A. trifolii, but was ineffective against P. clandestina, P. irregulare, or R. solani. Overall, controlled environment studies highlighted strong potential for utilizing seed treatments against in idual pathogens to ensure seedling emergence and early survival, with seed and foliar sprays enhancing productivity by reducing seedling d ing-off and root disease from in idual pathogens. However, in field experiments over 2 years across southern Australia against naturally occurring soilborne pathogen complexes involving these same pathogens, only rarely did fungicide seed treatments or foliar sprays tested show any benefit. It is evident that currently available fungicide seed and/or foliar spray treatment options do not offer effective field mitigation of d ing-off and root disease on annual forage legumes that underpin livestock production across southern Australia. The main reason for this failure relates to the unpredictable and ever-changing soilborne pathogen complexes involved, highlighting a need to now refocus away from fungicide options, particularly toward developing and deploying new host tolerances, but also in deploying appropriate cultural control options.
Publisher: CSIRO Publishing
Date: 2006
DOI: 10.1071/EA05084
Abstract: Napier is a late flowering F6-derived crossbred subterranean clover of var. yanninicum [(Katz. et Morley) Zohary and Heller] developed by the collaborating organisations of the National Annual Pasture Legume Improvement Program. It is a replacement for both Larisa and Meteora and has been selected for release on the basis of its greater herbage and seed production and disease resistance to both known races of clover scorch and 2 of the common races of Phytophthora root rot. Napier is recommended for sowing in Victoria, Western Australia, New South Wales, and South Australia. It is best suited to moderately acidic soils prone to water-logging and to loamy and clay soils with good water-holding capacity in areas with a minimum growing season length of 7.5 months, which extends into late November. Napier is well adapted to the permanent pasture systems found in the areas in which it will be grown. Its upright, vigorous growth makes it well suited to grazing by cattle or sheep and to fodder conservation. Napier has been granted Plant Breeders Rights in Australia.
Publisher: Wiley
Date: 17-04-2018
DOI: 10.1111/PPA.12861
Publisher: Wiley
Date: 14-08-2018
DOI: 10.1111/PPA.12740
Publisher: CSIRO Publishing
Date: 1999
DOI: 10.1071/AR98175
Abstract: Surveys were conducted for annual Medicago spp. (medic) pastures in the grain belt of south-west Western Australia during spring 1996 and winter–spring 1997 to determine the relationship of rainfall, cultural practices, soil and plant nutrients, and seedling survival with severity of root disease and numbers of parasitic nematodes. Medic pasture was s led on 116 farms. Most pastures consisted of a single medic variety, viz. Serena, Santiago, Cyprus, or Caliph, whereas about 33% of sites had mixed varieties. Regression analyses showed that high rainfall and application of phosphorus fertilisers were correlated with increased severity of rot in medic tap roots. Crop history and medic variety were not related to the level of root rot. Numbers of Pratylenchusin medic roots were not correlated with the level of tap or lateral root rot, medic variety, rainfall, or with the application of insecticide, fertilisers, or herbicides. Soil with relatively high levels of P, NO3-, or Fe was associated with an increased level of tap root rot. Soils with high pH were associated with reduced tap root rot. Soils with relatively high K were related to severe lateral root rot, whereas relatively high levels of P in soil were associated with reduced lateral root rot. Plants with high levels of tap root rot showed low levels of Mg, whilst low levels of Ca and NO3– in tissues were related to high levels of lateral root rot. High levels of tap root rot were associated with relatively high levels of total N, K, and S, Cu, Zn, Mn, and NO3- in plant tissues. Plants with relatively high levels of lateral root rot had relatively high levels of Cu in shoots. Of the 116 annual Medicago pastures s led, only 1% had adequate Mg content and only 19% had adequate Ca content. However, 83% had higher than adequate levels of Cu, 70% had higher than adequate levels of Mn, and all s les showed more than adequate levels of chloride. Experimental sites of M. polymorpha cv. Serena at 6 farms showed that the percentage survival rate of seedlings was negatively correlated with the severity of tap and lateral root rot in the previous year. These results indicate that in the farms surveyed there is a serious threat to annual medic pastures from root rot fungi. The severity of the disease was partly determined by soil conditions and cultural practices.
Publisher: Springer Science and Business Media LLC
Date: 05-01-2008
Publisher: Springer Science and Business Media LLC
Date: 14-06-2009
Publisher: CSIRO Publishing
Date: 2003
DOI: 10.1071/AR02071
Abstract: Kabatiella caulivora is the causal agent of clover scorch, a fungal disease of clover (Trifolium) species. Variability within and between K. caulivora Race 1 and Race 2 was determined by cultural characteristics, isozymes, and lified fragment length polymorphisms (AFLP). Cultural studies indicated isolates from both races were highly variable. No differences were identified within or between races by isozyme analysis. Similarity coefficients, determined from AFLP analysis, indicated that isolates from different races were often more similar than isolates from the same race. Comparison of single representative isolates from Race 1 and Race 2, collected at a Denmark (Western Australia) disease site, with isolates collected from another site of clover scorch outbreak at Esperance, 300 km east of Denmark, indicated most of the isolates causing the second outbreak were similar to Race�2, confirming previously conducted pathogenicity tests. It is hypothesised that Race 2 may have evolved from Race 1, and that the level of variability in the pathogen indicates the potential for development of further new races of K. caulivora. The requirement for improved selection strategies, including the screening of new cultivars and breeding lines with multiple isolates of the pathogen, is discussed in relation to these findings.
Publisher: Scientific Societies
Date: 03-2014
DOI: 10.1094/PDIS-08-13-0809-PDN
Abstract: The ascochyta blight complex on field pea (Pisum sativum) in Australia causes severe yield loss of up to 60% (1). This blight complex includes a range of different symptoms, including ascochyta blight, foot rot, and black stem and leaf and pod spot (together more commonly known as “black spot disease” in Australia). In Australia, disease is generally caused by one or more of the four fungi: Didymella pinodes, Phoma pinodella, Ascochyta pisi, and P. koolunga (1,2). However, in September 2012, from a field pea disease screening nursery at Medina, Western Australia, approximately 1% of isolates were a Phoma sp. morphologically different to any Phoma sp. previously reported on field pea in Australia. The remaining isolates were either D. pinodes or P. pinodella. Single spore isolations of two isolates of this Phoma sp. were made onto Coon's Agar and DNA extracted. Two PCR primers TW81 (5′GTTTCCGTAGGTGAACCTGC 3′) and AB28 (5′ATATGCTTAAGTTCAGCGGGT 3′) were used to lify extracted DNA from the 3′ end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5′ end of the 28S rDNA. The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GeneBank for P. glomerata. Isolates also showed morphological similarities to P. glomerata as described in other reports (3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. KF424434). The same primers were used by Davidson et al. (2) to identify P. koolunga, but neither of our two isolates were P. koolunga. A conidial suspension of 10 6 conidia ml –1 from a single spore culture was spot-inoculated onto foliage of 20-day-old plants of P. sativum variety WAPEA2211 maintained under % RH conditions for 72 h post-inoculation. Symptoms on foliage first became evident by 8 days post-inoculation, consisting of dark brown lesions 1 to 2.5 mm in diameter. P. glomerata was readily re-isolated from infected foliage to fulfill Koch's postulates. No lesions occurred on foliage of control plants inoculated with only deionized water. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13652). While not reported previously on P. sativum in Australia, P. glomerata has been reported on other legume crop and pasture species in eastern Australia, including Cicer arietinum (1973), Lupinus angustifolius (1982), Medicago littoralis (1983), M. truncatula (1985), and Glycine max (1986) (Australian Plant Pest Database). Molecular analysis of historical isolates collected from P. sativum in Western Australia, mostly in the late 1980s and 1990s, did not show any incidence of P. glomerata, despite this fungus being previously reported on Citrus, Cocos, Rosa, Santalum, and Washingtonia in Western Australia (4). We believe this to be the first report of P. glomerata as a pathogen on field pea in Australia. The previous reports of P. glomerata on other crop legumes in eastern Australia and its wide host range together suggest potential for this fungus to be a pathogen on a range of leguminous genera/species. References: (1) T. W. Bretag et al. Aust. J. Agric. Res. 57:883, 2006. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. Morgan-Jones. CMI Descriptions of Pathogenic Fungi and Bacteria No.134 Phoma glomerata, 1967. (4) R. G. Shivas. J. Roy. Soc. West. Aust. 72:1, 1989.
Publisher: CSIRO Publishing
Date: 2009
DOI: 10.1071/CP08187
Abstract: Pasture decline is considered to be a serious challenge to agricultural productivity of subterranean clover across southern Australia. Root disease is a significant contributing factor to pasture decline. However, root disease assessments are generally carried out in the early part of the growing season and in areas predominantly sown to permanent pastures. For this reason, in spring 2004, a survey was undertaken to determine the severity of root disease in mature subterranean clover plants in pastures located in the wheatbelt of Western Australia. DNA-based soil assays were used to estimate population density in the soil of a variety of soil-borne pathogens known to commonly occur in the Mediterranean-type environments of southern Australia. The relationships between severity of disease on tap and lateral roots and root diameter, root length, nodulation, and total rainfall were determined. The survey showed, for the first time, that severe root disease is widespread in spring across the wheatbelt of Western Australia. There was a positive correlation between rainfall and tap root disease, and between tap root disease and average root diameter of the entire root system. Despite the high levels of root disease present across the sites, the DNA of most root disease pathogens assayed was detected in trace concentrations. Only Pythium Clade F showed high DNA concentrations in the soil. DNA concentrations in the soil, in particular for Phytophthora clandestina and Rhizoctonia solani AG 2.1 and AG 2.2, were higher in the smaller autumn s ling in 2006. This study suggests that the productivity of subterranean clover-based pastures is severely compromised by root rot diseases throughout the growing season in the wheatbelt of Western Australia.
Publisher: Scientific Societies
Date: 05-2021
DOI: 10.1094/PDIS-09-20-2036-RE
Abstract: White leaf spot (Neopseudocercosporella capsellae) is a persistent and increasingly important foliar disease for canola (Brassica napus) across southern Australia. To define the role of plant growth stage in the development of disease epidemics, we first investigated the response of different canola cultivars (Scoop and Charlton) at five Sylvester-Bradley growth stages against N. capsellae. White leaf spot disease incidence and severity was dependent on plant growth stage and cultivar (both P 0.001), with plants being most susceptible at plant growth stage 1.00 (cotyledon stage) followed by plant growth stage 1.04 (fourth leaf stage). Then, to quantify the impact of this disease on canola yield, we investigated the in-field relationship of white leaf spot disease incidence and severity with seed yield loss following artificial inoculation commencing at growth stage 1.04 (fourth leaf stage). White leaf spot significantly (P 0.001) reduced seed yield by 24% in N. capsellae inoculated field plots compared with noninoculated field plots. To our knowledge, this is the first time that serious seed yield losses from this disease have been quantified in the field. The current study demonstrates that N. capsellae disease incidence and severity on canola is determined by host growth stage at which pathogen infestation occurs. Emerging seedling cotyledons were highly susceptible, followed by less susceptibility in first true leaves to emerge, but then increasing susceptibility as plants subsequently aged toward the fourth leaf stage. This explains field observances where white leaf spot readily establishes on emerging seedlings and subsequently becomes more prevalent and severe as plants age.
Publisher: Scientific Societies
Date: 02-2006
DOI: 10.1094/PD-90-0229
Abstract: Field experiments were conducted in three consecutive years to determine the effect of Dilophospora alopecuri inoculation on the incidence of galls with Rathayibacter toxicus in annual ryegrass (Lolium rigidum). R. toxicus is carried into the grass by the seed gall nematode, Anguina funesta, and colonizes the ovules, displacing the nematodes, and producing the toxin responsible for annual ryegrass toxicity. Treatments included three types of D. alopecuri inoculum (naturally colonized ryegrass, cultures grown on sterilized wheat grain, and spore suspension) applied at different application rates and times. In the first year, naturally colonized ryegrass (30 kg ha -1 ), applied 1 week after the break of season, colonized wheat grain (150 kg ha -1 ) applied once at 1, 4, or 8 weeks or applied three times at 1, 4, and 8 weeks after the break of season, and spore suspension at heading, all significantly reduced the numbers of bacterially colonized galls (by 85 to 96%). In the second and third years, inoculum was applied at various rates and times. There were no significant treatment effects in the second year. In the third year, colonized wheat (450 kg ha -1 ) reduced the number of bacterially colonized galls by 73% and there was a significant negative relationship between inoculation rate of colonized wheat (5.5 to 450 kg ha -1 ) and the number of bacterially colonized galls (r = 0.86, P 0.01). D. alopecuri has potential as a biopesticide for the management of annual ryegrass toxicity, but efficacy could be highly variable depending upon season or site, and uneconomic application rates might be needed.
Publisher: CSIRO Publishing
Date: 2005
DOI: 10.1071/AR05103
Abstract: One hundred subterranean clover genotypes including 72 advanced breeding lines from Trifolium subterraneum ssp. subterraneum and Trifolium subterraneum ssp. yanninicum and 28 Trifolium subterraneum commercial cultivars were screened in the field for resistance to race 2 of Kabatiella caulivora, and the resistances found were related to known resistance to major root pathogens in the region. Race 2 of K. caulivora causes severe damage on subterranean clover in the south-eastern coastal region of Western Australia and 72 of the 100 genotypes tested were resistant to this race, with levels similar to those shown by the cultivar Denmark. The unique importance of this study was that, for 12 genotypes of subterranean clover, these resistances were related to those shown to major root pathogens, viz. one or more of Phytophthora clandestina, Pythium irregulare, and Fusarium avenaceum. Availability of genotypes with such resistances to multiple pathogens is expected to be particularly valuable for the breeding/selection of subterranean clover in relation to the development of new cultivars with effective resistance to a range of pathogens that commonly occur in southern Australian annual legume pastures.
Publisher: Wiley
Date: 02-2001
Publisher: Springer Science and Business Media LLC
Date: 11-03-2020
Publisher: Scientific Societies
Date: 09-2012
DOI: 10.1094/PDIS-04-12-0415-PDN
Abstract: Rice (Oryza sativa L.) has been grown in the Ord River Irrigation Area (ORIA) in northern Western Australia since 1960. In 2011, a sheath rot of rice was observed in the ORIA. Symptoms were variable, appearing as either (i) oblong pale to dark brown lesions up to 3 cm length, (ii) lesions with pale grey/brown centers and with dark brown margins, or (iii) diffuse dark or reddish brown streaks along the sheath. Lesions enlarged and coalesced, often covering the majority of the leaf sheath, disrupting panicle emergence. Isolations from small pieces of infested tissues from plants showing sheath rot symptoms were made onto water agar, subcultured onto potato dextrose agar, cultures maintained at 20°C, and a representative culture lodged both in the Western Australian Culture Collection maintained at the Department of Agriculture and Food Western Australia (as WAC 13481) and in the culture collection located at the DAFF Plant Pathology Herbarium (as BRIP 54763). Amplification of the internal transcribed spacer (ITS)1 and (ITS)2 regions flanking the 5.8S rRNA gene were carried out with universal primers ITS1 and ITS4 according to the published protocol (4). The DNA PCR products from a single isolate were sequenced and BLAST analyses used to compare sequences with those in GenBank. The sequence had 99% nucleotide identity with the corresponding sequence in GenBank for Sarocladium oryzae (Sawada) W. Gams & D. Hawksworth. Isolates showed morphological (e.g., conidiophore and conidia characteristics) (2) and molecular (1) similarities with S. oryzae as described in other reports. The relevant sequence information for a representative isolate was lodged in GenBank (GenBank Accession No. JQ965668). Spores of S. oryzae were produced on rice agar under “black light” at 22°C to induce sporulation over 4 weeks. Under conditions of 30/28°C (day/night), 14/12 h (light/dark), rice cv. Quest, grown for 11 weeks until plants reached the tillering stage, was inoculated by spraying a suspension 5 × 10 7 spores/ml of the same single isolate onto foliage until runoff occurred. Inoculated plants were placed under a dark plastic cover for 72 h to maximize humidity levels around leaves and subsequently maintained under % relative humidity conditions. Symptoms of sheath rot as described in (i) and (ii) above appeared by 14 days after inoculation, with lesions up to 23 cm long by 15 days post-inoculation. Severe disease prevented young panicles from emerging. Infection studies were successfully repeated and S. oryzae was reisolated from leaf lesions 1 week after lesion appearance. No disease was observed on water-inoculated control rice plants. There have been records of S. oryzae on rice in New South Wales in the early 1980s (3) and in 2006 to 2007 (Australian Plant Pest Database), but to our knowledge, this is the first report of this pathogen in Western Australia. References: (1) N. Ayyadurai et al. Cur. Microbiol. Mycologia 50:319, 2005. (2) B. L. K. Brady. No. 673 in: IMI Descriptions of Fungi and Bacteria, 1980. (3) D. Phillips et al. FAO Plant Prot. Bull. 40:4, 1992. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.
Publisher: Wiley
Date: 13-11-2016
DOI: 10.1111/PPA.12475
Publisher: Canadian Science Publishing
Date: 2007
DOI: 10.1139/B06-159
Abstract: Six spring-type Brassica napus L. cultivars, either susceptible or with polygenic or monogenic resistance, were inoculated with Leptosphaeria maculans (Desmaz.) Ces. & De Not. (organism causing phoma stem canker in crucifers) to investigate differences in the responses of host stem tissues to the pathogen. At growth stage 1.06, plants were inoculated with pycnidiospores at the junction of the petiole and stem. The pre-penetration and penetration phases were examined along with the histological, ultrastructural, and histochemical responses. The processes of pycnidiospore attachment, germination, and penetration through the stomata of petioles and stems were found to be similar in all cultivars. Specific post-penetration defense reactions identified were lignification, suberisation, and additional cambium formation in the resistant cultivars. In ‘Surpass 400’, which has monogenic resistance, these responses occurred 4–5 d earlier than in polygenically resistant cultivars, and were more intense (preventing hyphal penetration of the additional cambium layer), and resulted in a hypersensitive reaction without pycnidia formation. Our study clearly emphasizes the variatiability in location, timing, and histochemistry of stem responses between compatible and incompatible interactions and will improve our overall understanding of the role and importance of the mechanisms of resistance in spring-type B. napus to L. maculans.
Publisher: Springer Science and Business Media LLC
Date: 2005
DOI: 10.1071/AP04088
Publisher: Springer Science and Business Media LLC
Date: 25-04-2020
Publisher: Wiley
Date: 13-12-2019
Publisher: Springer Science and Business Media LLC
Date: 28-12-2013
DOI: 10.1007/S00248-012-0165-0
Abstract: Diurnal patterns of spore release have been observed in a number of fungal pathogens that undergo wind-assisted dispersal. The mechanisms that drive these patterns, while not well understood, are thought to relate to the ability of dispersing spores to survive their journey and infect new hosts. In this paper, we characterise the diurnal pattern of ascospore release by a Western Australian population of Leptosphaeria maculans. Although L. maculans has been previously shown to exhibit diurnal patterns of ascospore release, these patterns appear to vary from region to region. In order to characterise the pattern of release in the Mediterranean climate of Western Australia, we analysed historical data describing the bi-hourly count of airborne ascospores at Mt Barker, Western Australia. Results of this analysis showed diurnal patterns that differ from those previously observed in other countries, with ascospore release in our study most likely to occur in the afternoon. Furthermore, we found that the time of peak release can shift from month to month within any one season, and from year to year. In explaining the hourly pattern of spore release over an entire season, time since rainfall, time since last release, temperature, hour and month were all shown to be significant variables.
Publisher: Springer Science and Business Media LLC
Date: 24-08-2019
Publisher: Elsevier BV
Date: 02-2012
Publisher: Elsevier BV
Date: 02-2012
Publisher: Elsevier BV
Date: 04-2011
DOI: 10.1016/J.TOXICON.2011.02.019
Abstract: The high prevalence (14 of 24 isolates) of enniatin-producing isolates from Western Australian Fusarium species isolated from pasture legumes associated with sheep feed refusal and rat deaths, and the high toxicity of their crude extracts to brine shrimp (Artemia franciscana) from a previous study warranted further investigation of this class of mycotoxin. Crude extracts from Fusarium acuminatum, Fusarium avenaceum, Fusarium tricinctum and Fusarium sambucinum, along with enniatins A, A1, B and B1 purified from a Western Australian strain of F. acuminatum using semi-preparative HPLC, were bioassayed using brine shrimp. All Fusarium isolates produced both enniatins B and B1, except for F. tricinctum WAC 8019, and 11 of the 17 isolates produced enniatin A1. Overall, all of the F. avenaceum isolates produced high amounts of enniatins, in particular enniatin B. One isolate of F. acuminatum (WAC 5715) and of F. tricinctum (WAC 11486) also produced high amounts of both enniatins B and B1. Only F. acuminatum WAC 5715 produced enniatin A among the tested isolates. All four purified enniatins A, A1, B, B1, in idually and in combination, caused brine shrimp toxicity after 6 h of exposure, implicating that this emerging class of mycotoxin as a cause of the acute toxicity to brine shrimp observed. The mixture of all four enniatins was the most toxic to brine shrimp compared to purified in idual enniatins, where the relative toxicity order was B > B1 > A1 > A. Enniatin B was the in idual most toxic enniatin with some bioactivity at 5 μg/mL and almost 100% brine shrimp death at 50 μg/mL after 24 h of exposure. This study is the first report to confirm the acute toxicity of enniatins A, A1, B and B1 to brine shrimp, and also highlights the need for further investigation of the potential toxicity of these cyclic hexadepsipeptides to animals and humans.
Publisher: Scientific Societies
Date: 04-2019
DOI: 10.1094/PHYTO-04-18-0145-R
Abstract: Rust (Mel sora apocyni) on Apocynum venetum is the major constraint to the commercial development of this medicinal herb. To determine the factors influencing rust intensity (maximum disease index [DI max ]), rust was investigated from 2011 to 2015 in both cultivated and wild A. venetum plants. Partial least squares path modeling (PLS-PM) was used to analyze the paths and extent of the factors related to pathogen, environment, and host that affect rust intensity. DI max exhibited considerable variations across years and study sites, with variations linked to various factors fostering disease development. PLS-PM explained 80.0 and 70.1% of variations in DI max in cultivated and wild plants, respectively. Precipitation was the key factor determining DI max in both cultivated and wild plants (path coefficient [PC] = 0.313 and 0.544, respectively). In addition, the topsoil water content in cultivated plants and the total vegetation coverage in wild plants were also critical determinants of DI max via their effects on the microclimatic factor (contribution coefficients [CC] = 0.681 and 0.989, respectively PC = 0.831 and 0.231, respectively). In both cultivated and wild plants, host factors were mainly dominated by A. venetum density (CC = 0.989 and 0.894, respectively), and their effect on DI max via the microclimatic factor (PC = 0.841 and 0.862, respectively) exceeded that via the inoculum factor (PC = 0.705 and 0.130, respectively). However, the indirect effects led to DI max variation, while the dilution effect on host (CC = 0.154) from weed in wild plants led to the indirect effect size in wild plants of 0.200, which was lower than −0.699 in cultivated plants.
Publisher: CSIRO Publishing
Date: 2003
DOI: 10.1071/AR03056
Abstract: A study was carried out to establish key developmental stages of Leptosphaeria maculans on canola residues leading up to ascospore discharge and how these stages could be affected by chemicals. The residues were dipped in a range of chemicals, including fungicides, herbicides, and surfactants, to determine possible manipulative effects of the chemicals on the development of the fungus including ascospore discharge. Treated residues were placed in the field during the growing season. Ascospore discharge was found to be closely related to pseudothecial maturity and density. There was no significant difference between pseudothecial maturation on the crown component compared with the stem component. A high correlation between rainfall and pseudothecial density suggested that rainfall was a good complimentary indicator for timing of ascospore discharge. These results may provide the canola industry with a potential method of monitoring pseudothecial development for estimating disease hazards. This would allow manipulation of sowing times so as to minimise or avoid heavy ascospore showers coinciding with the early seedling phase. Twenty chemical treatments showed significant efficacy in decreasing ascospore numbers early in the season, most often by delaying the development of the pseudothecia on the residues. Two scenarios were formulated giving growers the potential to manipulate pseudothecial development and/or ascospore discharge. Firstly, a number of chemicals, such as fluquinconazole, technical grade flutriafol, and gluphosinate-ammonium, were able to delay pseudothecial development and subsequent ascospore discharge was decreased by 100%, 99%, and 96%, respectively. This scenario gives growers the potential to minimise synchronisation of ascospore discharge with early crop establishment. Secondly, a situation where pseudothecial development is not delayed, but number of ascospores discharged is reduced (e.g. ziram by 45%) would only be effective if the reduction resulted in a less severe disease epidemic. There is significant potential for development of commercial chemical treatments of residues to reduce disease pressure on seedlings.
Publisher: Oxford University Press (OUP)
Date: 07-2005
DOI: 10.1093/AOB/MCI194
Publisher: CSIRO Publishing
Date: 2010
DOI: 10.1071/CP10040
Abstract: Subterranean clover (Trifolium subterraneum) is grown extensively as a pasture legume in agronomic regions with Mediterranean-type climates in parts of Africa, Asia, Australia, Europe, North America and South America. Root diseases of subterranean clover, especially those caused by oomycete pathogens including Aphanomyces, Phytophthora and Pythium, greatly reduce productivity by significantly decreasing germination, seedling establishment, plant survival and seed set. For this reason, experiments were conducted to determine the species of Aphanomyces causing root disease on subterranean clover in the high-rainfall areas of south-west Western Australia. The effects of flooding, temperature and inoculum concentration on the development of root disease on subterranean clover caused by this Aphanomyces sp. were also investigated as was its host range. Morphological and molecular characteristics were used to identify the pathogen as a new species Aphanomyces trifolii sp. nov. (O’Rourke et al.), which forms a distinct clade with its nearest relative being A. cladogamus. A. trifolii caused significant lateral root pruning as well as hypocotyl collapse and tap root disease of subterranean clover. The level of disease was greater in treatments where soil was flooded for 24 h rather than for 6 h or in unflooded treatments. The pathogen caused more disease at 18/13oC than at lower (10/5oC) or higher (25/20oC) temperatures. The pathogen caused more disease at 1% inoculum than at 0.5 or 0.2% (% inoculum : dry weight of soil). In greenhouse trials, A. trifolii also caused root disease on annual medic (M. polymorpha and M. truncatula), dwarf beans (Phaseolus vulgaris) and tomatoes (Solanum lycopersicum). However, the pathogen did not cause disease on peas (Pisum sativum), chickpea (Cicer arietinum), wheat (Triticum aestivum), annual ryegrass (Lolium rigidium) or capsicum (Capsicum annuum). A. trifolii is a serious pathogen in the high-rainfall areas of south-west Western Australia and is likely a significant cause of root disease and subsequent decline in subterranean clover pastures across southern Australia.
Publisher: Wiley
Date: 21-12-2016
DOI: 10.1111/PPA.12484
Publisher: Elsevier BV
Date: 02-2007
Publisher: Elsevier BV
Date: 12-2013
Publisher: CSIRO Publishing
Date: 2007
DOI: 10.1071/AR07094
Abstract: Sclerotinia stem rot (SSR) is a significant agricultural problem worldwide. Finding sources of resistance is crucial to the ongoing search for better management of this disease. Brassica germplasm from Australia, China and India was screened for resistance to SSR under Western Australian field conditions following stem inoculation, application of a spray of mycelial suspension, or as a consequence of myceliogenic germination originating from sclerotia resident in soil. Significant differences in response were observed among 53 genotypes using each of the three screening methods. There was a variable impact of the time of inoculation on the disease level depending upon time of assessment post-stem inoculation. However, this impact could be reduced to an insignificant level provided the assessment after stem inoculation was delayed until 3 weeks post-inoculation. The results of these studies indicate that the use of appropriate inoculation and assessment methods could significantly reduce variability in the responses commonly observed in screening for resistance in crop plants against Sclerotinia sclerotiorum.
Publisher: Scientific Societies
Date: 06-2021
DOI: 10.1094/PDIS-09-20-1985-RE
Abstract: Glasshouse and field investigations of the phenotypic expressions of resistance of a 97-member World Core Collection of subterranean clover (Trifolium subterraneum) collected from its native Mediterranean habitat and representing approximately 80% of the total genetic ersity within the known 10,000 accessions of the species against the most important d ing-off and root rot (Phytophthora clandestina, and Pythium irregulare) and foliar (Kabatiella caulivora, Uromyces trifolii-repentis, and Erysiphe trifoliorum) pathogens were performed. An additional 28 erse cultivars were also included. Associations of these genotypes among 18 disease parameters and 17 morphological traits, and among these disease parameters and 24 climatic and eco-geographic variables from their collection sites, were examined. Many genotypes showed strong phenotypic expression of novel host disease resistance against one or more pathogens, enabling their potential deployment as disease-resistant parents in subterranean clover breeding programs. These new sources of resistance enable future “pyramiding” of different resistance genes to improve resistance against these pathogens. Of particular value were genotypes with multiple disease-resistance across soilborne and/or foliar diseases, because many of these pathogens co-occur. All diseases had some parameters significantly correlated with one or more morphological traits and with one or more sites of origin variables. In particular, there were significant negative correlations between d ing-off (i.e., germination) and 8 of the 17 morphological characters. The outcomes of these studies provide crucial information to subterranean clover breeding programs, enabling them to simultaneously select genotypes with multiple resistance to co-occurring soilborne and foliar diseases and desirable traits to offer renewed hope for re-establishing a more productive subterranean clover livestock feedbase despite multiple diseases prevailing widely.
Publisher: Frontiers Media SA
Date: 06-08-2019
Publisher: MDPI AG
Date: 18-09-2021
DOI: 10.3390/MICROORGANISMS9091988
Abstract: A vast microbial community inhabits in the rhizosphere, among which, specialized bacteria known as Plant Growth-Promoting Rhizobacteria (PGPR) confer benefits to host plants including growth promotion and disease suppression. PGPR taxa vary in the ways whereby they curtail the negative effects of invading plant pathogens. However, a cumulative or synergistic effect does not always ensue when a bacterial consortium is used. In this review, we reassess the disease-suppressive mechanisms of PGPR and present explanations and illustrations for functional ersity and/or stability among PGPR taxa regarding these mechanisms. We also provide evidence of benefits when PGPR mixtures, rather than in iduals, are used for protecting crops from various diseases, and underscore the critical determinant factors for successful use of PGPR mixtures. Then, we evaluate the challenges of and limitations to achieving the desired outcomes from strain/species-rich bacterial assemblages, particularly in relation to their role for plant disease management. In addition, towards locating additive or synergistic outcomes, we highlight why and how the benefits conferred need to be categorized and quantified when different strains/species of PGPR are used in combinations. Finally, we highlight the critical approaches needed for developing PGPR mixtures with improved efficacy and stability as biocontrols for utilization in agricultural fields.
Publisher: Scientific Societies
Date: 03-2007
Abstract: Foliar and stem diseases of annual Medicago spp. caused by Phoma medicaginis and Leptosphaerulina trifolii can not only reduce yield, but also affect herbage quality by inducing the production of the phytoestrogen coumestrol. To determine differences in host reaction to these pathogens, 33 cultivars and lines in 1993 and 10 cultivars in 1995 were evaluated in inoculated field tests. In the 1993 test, a number of genotypes with high levels of resistance to leaf and stem disease caused by P. medicaginis and to leaf disease caused by L. trifolii were identified. Genotypes with very high levels of resistance to stem disease caused by P. medicaginis were M. sphaerocarpos GRC5659.4.1 and SAD10069, M. murex GRC87.1, GRC707, and GRC708, M. truncatula Z771, and M. solerolii DZA3180.1, all of which had stem disease scores of ≤1.0 (scale 0 to 10) by the end of the growing season. The levels of coumestrol produced ranged from 114 to 1,230 ppm dry weight in stems across the genotypes, and the score for stem disease caused by P. medicaginis in the corresponding cultivars ranged from ≤0.8 to 8.9, respectively. The 1995 test confirmed the relative responses of nine cultivars (Caliph, Circle Valley, Cyprus, Harbinger AR, Zodiac, Paraggio, Santiago, Serena, and Orion) of annual Medicago spp. to leaf and stem disease caused by P. medicaginis and to stem disease caused by L. trifolii. Those with the lowest levels of coumestrol in the stems were M. solerolii DZA3180.1, M. truncatula Paraggio, and M. sphaerocarpos SAD10069, all with levels ≤130 ppm. The highest level was found in M. polymorpha SA4178 (1,230 ppm). M. littoralis Harbinger AR, Z286, Z298, and Z912, M. murex 89F16.1.1, M. orbicularis SA8460, and M. polymorpha SA4188, all had coumestrol levels of ppm. For stem disease caused by P. medicaginis in particular, there was significant correlation of the level of disease with the level of coumestrol in stems at the end of the growing season. In contrast, for L. trifolii, there was significant negative correlation (leaf disease) or only a weak positive correlation (stem disease) with coumestrol in stems at the end of the growing season. Incorporation of these identified disease resistances into commercial cultivars offers a promising avenue not only as a long-term strategy for management of foliar diseases in annual Medicago spp., but also as a means of reducing phytoestrogen levels in commercial annual Medicago spp. pastures in order to minimize the adverse effects of phytoestrogens on fertility levels in sheep.
Publisher: Informa UK Limited
Date: 02-11-2021
Publisher: Springer Science and Business Media LLC
Date: 26-10-2017
Publisher: Scientific Societies
Date: 02-2013
DOI: 10.1094/PDIS-06-13-0612-RE
Abstract: Sclerotinia stem rot, caused by Sclerotinia sclerotiorum, is a serious disease of many cruciferous crops and frequently poses a threat to the sustainable and profitable production of these crops worldwide. Differences in seedling resistance to S. sclerotiorum across 46 erse cruciferous genotypes from 12 different species were assessed by comparing the extent of pathogenesis on inoculated cotyledons under controlled conditions. Selections of Brassica carinata, B. incana, B. juncea, B. napus, and B. napus introgressed with B. carinata, B. nigra, B. oleracea, B. rapa var. rosularis, B. rapa var. chinensis, B. tournefortii, Raphanus raphanistrum, R. sativus, and Sinapis arvensis were tested. The average size of lesions on cotyledons 48 h post inoculation varied from 0.8 to 7.3 mm. The three most resistant genotypes with the smallest lesions were all from B. oleracea (viz., B. oleracea var. italica ‘Prophet’ and B. oleracea var. capitata ‘Burton’ and ‘Beverly Hills’). Representatives of R. raphanistrum, S. arvensis, B. juncea, and B. carinata were the most susceptible to S. sclerotiorum, with the largest lesions. To our knowledge, this is the first report of high levels of resistance to S. sclerotiorum in B. oleracea at the cotyledon stage and also the first report of the host cotyledon reactions against S. sclerotiorum for all tested species except B. napus and B. juncea. The mean lesion size for B. napus introgressed with B. carinata was 5.6 mm, which is midway between the lesion size for the two parent species B. napus (5.1 mm) and B. carinata (5.8 mm). Separate genetic control for cotyledon versus mature plant resistance was demonstrated by the lack of correlation between lesion size from S. sclerotiorum on the cotyledon with the severity of disease initiated by stem inoculation or natural processes in a previous field test. On the most resistant genotypes, B. oleracea var. italica Prophet and var. capitata Burton, growth of S. sclerotiorum on the cotyledon surface prior to penetration was severely impeded, production of appressoria inhibited, and both cytoplasm shrinkage and protoplast extrusion in S. sclerotiorum hyphae prevalent. This is the first report of such resistant mechanisms in B. oleracea. Genotypes with cotyledon resistance identified in this study will be of great value not only in furthering our understanding of resistance mechanisms across different cruciferous species but also could be exploited for developing commercial crucifer cultivars with high-level resistance against S. sclerotiorum.
Publisher: Scientific Societies
Date: 12-2019
DOI: 10.1094/PDIS-02-19-0312-RE
Abstract: The Chittering strain of potato spindle tuber viroid (PSTVd) infects solanaceous crops and wild plants in the subtropical Gascoyne Horticultural District of Western Australia. Classical PSTVd indicator hosts tomato cultivar Rutgers (R) and potato cultivar Russet Burbank (RB) and currently widely grown tomato cultivars Petula (P) and Swanson (S) and potato cultivars Nadine (N) and Atlantic (A) were inoculated with this strain to study its pathogenicity, quantify fruit or tuber yield losses, and establish whether tomato strains might threaten potato production. In potato foliage, infection caused spindly stems, an upright growth habit, leaves with ruffled margins and reduced size, and upward rolling and twisting of terminal leaflets (RB, A, and N) axillary shoot proliferation (A) severe plant stunting (N and RB) and necrotic spotting of petioles and stems (RB). Tubers from infected plants were tiny (N) or small and “spindle shaped” with (A) or without (RB) cracking. Potato foliage dry weight biomass was decreased by 30 to 44% in A and RB and 37% in N, whereas tuber yield was diminished by 50 to 89% in A, 69 to 71% in RB, and 90% in N. In tomato foliage, infection caused epinasty and rugosity in apical leaves, leaf chlorosis, and plant stunting (S, P, and N) cupped leaves (S and P) and reduced leaf size, flower abortion, and necrosis of midribs, petioles, and stems (R). Mean tomato fruit size was greatly decreased in all three cultivars. Tomato foliage dry weight biomass was diminished by 40 to 53% (P), 42% (S), and 37 to 51% (R). Tomato fruit yield was decreased by 60 to 76% (P), 52% (S), and 64 to 89% (R), respectively. Thus, the tomato strain studied was highly pathogenic to classical indicator and representative current tomato and potato cultivars, causing major losses in fruit and tuber yields. Tomato PSTVd strains, therefore, pose a threat to tomato and potato industries worldwide.
Publisher: MDPI AG
Date: 07-08-2022
Abstract: Studies were undertaken to determine the impact of environmental variables temperature (12.5/9.5, 20/17, 27/24 °C day/night) and soil moisture (100, 50% WHC), and their interaction with Phoma medicaginis infection, on production of the phytoestrogen coumestrol in annual Medicago rugosa cv. Paraponto and M. scutellata cv. Sava. Disease factors measured included leaf disease incidence/severity, petiole/stem disease incidence/severity, and leaf yellowing severity. Coumestrol levels were determined using gas chromatography–mass spectrometry (GC–MS). Increasing temperature from 12.5/9.5 °C to 27/24 °C in inoculated plants significantly (p 0.05) increased coumestrol from 193 mg kg−1 to 390 mg kg−1, but there were no differences in coumestrol production across all three temperatures in uninoculated plants. Reducing soil moisture from 100% to 50% WHC at the highest temperature (27/24 °C) caused the greatest increase in coumestrol production from 156 to 269 mg kg−1 in inoculated plants. The greatest coumestrol production (600 mg kg−1) was under 27/24 °C/50% WHC for Sava infected with P. medicaginis and least coumestrol (1.6 mg kg−1) was Sava under 20/17 °C/50% WHC in the absence of P. medicaginis. Clearly, situations of higher temperatures in conjunction with lower soil moisture levels cause greatest elevation in coumestrol in the presence of P. medicaginis, levels far exceeding the animal risk threshold of 25 mg kg−1.
Publisher: Scientific Societies
Date: 10-2018
DOI: 10.1094/PDIS-12-17-1972-RE
Abstract: Sweet potato feathery mottle virus (SPFMV) and Sweet potato virus C (SPVC) isolates were obtained from sweetpotato shoot or tuberous root s les from three widely separated locations in Australia’s tropical north (Cairns, Darwin, and Kununurra). The s les were planted in the glasshouse and scions obtained from the plants were graft inoculated to Ipomoea setosa plants. Virus symptoms were recorded in the field in Kununurra and in glasshouse-grown sweetpotato and I. setosa plants. RNA extracts from I. setosa leaf s les were subjected to high-throughput sequencing. New complete SPFMV (n = 17) and SPVC (n = 6) genomic sequences were obtained and compared with 47 sequences from GenBank. Phylogenetic analysis revealed that the 17 new SPFMV genomes all fitted within either major phylogroup A, minor phylogroup II, formerly O or major phylogroup B, formerly RC. Major phylogroup A’s minor phylogroup I, formerly EA, only appeared when recombinants were included. Numbers of SPVC genomes were insufficient to sub ide it into phylogroups. Within phylogroup A’s minor phylogroup II, the closest genetic match between an Australian and a Southeast Asian SPFMV sequence was the 97.4% nucleotide identity with an East Timorese sequence. Recombination analysis of the 43 SPFMV and 27 SPVC sequences revealed evidence of 44 recombination events, 16 of which involved interspecies sequence transfers between SPFMV and SPVC and 28 intraspecies transfers, 17 in SPFMV and 11 in SPVC. Within SPFMV, 11 intraspecies recombination events were between different major phylogroups and 6 were between members of the same major phylogroup. Phylogenetic analysis accounting for the detected recombination events within SPFMV sequences yielded evidence of minor phylogroup II and phylogroup B but the five sequences from minor phylogroup I were distributed in two separate groups among the sequences of minor phylogroup II. For the SPVC sequences, phylogenetic analysis accounting for the detected recombination events revealed three major phylogroups (A, B, and C), with major phylogroup A being further sub ided into two minor phylogroups. Within the recombinant genomes of both viruses, their PI, NIa-Pro, NIb, and CP genes contained the highest numbers of recombination breakpoints. The high frequency of interspecies and interphylogroup recombination events reflects the widespread occurrence of mixed SPVC and SPFMV infections within sweetpotato plants. The prevalence of infection in northern Australian sweetpotato s les reinforces the need for improved virus testing in healthy sweetpotato stock programs. Furthermore, evidence of genetic connectivity between Australian and East Timorese SPFMV genomes emphasizes the need for improved biosecurity measures to protect against potentially damaging international virus movements.
Publisher: Elsevier BV
Date: 09-2023
Publisher: Springer Science and Business Media LLC
Date: 19-07-2017
DOI: 10.1038/S41598-017-05992-9
Abstract: Sclerotinia stem rot ( Sclerotinia sclerotiorum ) is a major disease of Brassica oilseeds. As suitable donors to develop resistant cultivars are not available in crop Brassicas, we introgressed resistance from a wild Brassicaceae species, B . fruticulosa . We produced 206 B . juncea - B . fruticulosa introgression lines (ILs). These were assessed for pollen grain fertility, genome size variations and resistance responses to Sclerotinia following stem inoculations under disease-conducive conditions. Of these, 115 ILs showing normal fertility and genome size were selected for cytogenetic characterization using florescent genomic in situ hybridization (Fl-GISH). B . fruticulosa segment substitutions were indicated in 28 ILs. These were predominantly terminal and located on B-genome chromosomes. A final set of 93 highly fertile and euploid (2n = 36) ILs were repeat-evaluated for their resistance responses during 2014–15. They were also genotyped with 202 transferable and 60 candidate gene SSRs. Association mapping allowed detection of ten significant marker trait associations (MTAs) after Bonferroni correction. These were: CNU-m157-2, RA2G05, CNU-m353-3, CNU-m442-5, ACMP00454-2, ACMP00454-3, EIN2-3-1, M641-1, Na10D09-1 and Na10D11-1. This is the first time such a molecular mapping technique has been deployed with introgression lines carrying genomic segments from B . fruticulosa , and the first to show that they possess high levels of resistance against S . sclerotiorum .
Publisher: Scientific Societies
Date: 09-2014
DOI: 10.1094/PDIS-12-13-1231-RE
Abstract: The occurrence and distribution of Pythium spp. were determined by collecting isolates of Pythium from common bean (Phaseolus vulgaris) plants showing root or hypocotyl disease symptoms from different areas of Western Australia in 2012. Eight different Pythium species (Pythium conidiophorum, P. diclinum, P. intermedium, P. irregulare, P. lutarium, P. mamillatum, P. pachycaule, and P. perplexum) were isolated and identified according to molecular sequences. P. irregulare was the most widespread Pythium sp. All species, except P. perplexum, were pathogenic to the hypocotyl and root of common bean. We believe this is the first report of P. intermedium as a pathogen on common bean worldwide. This is also the first report of P. conidiophorum, P. intermedium, P. lutarium, P. mamillatum, P. pachycaule, and P. diclinum as pathogens on common bean in Australia and the first report of P. irregulare as a pathogen on common bean in Western Australia. P. intermedium was the most pathogenic species, causing the most severe disease on ‘Gourmet Delight’ (percent root disease index [%RDI] 75 ± 2.9 and percent hypocotyl disease index [%HDI] 59.2 ± 3.2) and ‘Pioneer’ (%RDI 75 ± 2.9 and %HDI 65.8 ± 3.2). That the relative susceptibility or resistance (the ability of a plant to reduce the extent of invasion by the pathogen) of a given bean variety to one Pythium sp. was, in general, similar across the other Pythium spp. was an important finding, because this opens up opportunities to utilize a single virulent isolate of one Pythium sp. to identify general resistance to a wider spectrum of Pythium spp.
Publisher: CSIRO Publishing
Date: 2008
DOI: 10.1071/AR08032
Abstract: Downy mildew, caused by the pathogen Hyaloperonospora parasitica, is a severe disease of oilseed rape (Brassica napus) seedlings in some regions of Australia. Sixty-three cultivars of Australian spring-type oilseed rape were evaluated for their levels of resistance to five isolates of the downy mildew pathogen, using a cotyledon infection test under controlled-environment conditions. A high level of resistance, characterised by the absence of disease symptoms or only the appearance of very sparse sporulation on inoculated cotyledons, was expressed in cvv. Pioneer 45Y77 and Pioneer 46Y78. This is the first study to identify Australian genotypes of oilseed rape highly resistant to H. parasitica. The resistance to H. parasitica identified in this study will not only enable Australian oilseed rape breeders to incorporate resistance to H. parasitica into new cultivars for enhanced resistance to this disease, but will also allow direct deployment of the most highly resistant genotypes identified directly in situations and regions most conducive to the development of severe downy mildew disease.
Publisher: Springer Science and Business Media LLC
Date: 08-05-2019
Publisher: Wiley
Date: 14-09-2009
Publisher: Wiley
Date: 09-05-2018
DOI: 10.1111/PPA.12709
Abstract: The differential expression of 13 defence‐related genes during Phoma koolunga infection of stems and leaves of susceptible versus resistant field pea ( Pisum sativum ) was determined using qRT ‐ PCR . Expression, in terms of relative mRNA level ratios, of genes encoding ferredoxin NADP oxidoreductase, 6a‐hydroxymaackiain methyltransferase ( hmm6 ), chalcone synthase ( PSCHS 3 ) and ascorbate peroxidase in leaves and stems differed during 6–72 hours post‐inoculation (hpi) and reflected known host resistance levels in leaves versus stems. In comparison to the susceptible genotype, at 24, 48 and 72 hpi, two genes, hmm6 (122.43‐, 206.99‐ and 32.25‐fold, respectively) and PSCHS 3 (175.00‐, 250.13‐ and 216.24‐fold, respectively), were strongly up‐regulated in leaves of the resistant genotype, highlighting that resistance against P. koolunga in field pea is governed by the early synthesis of pisatin. At 24 hpi, leaves infected by P. koolunga showed clear differences in expression of target genes. For ex le, the gene encoding a precursor of the defensin ‘disease resistance response protein 39’ was substantially down‐regulated in leaves of both the susceptible and the resistant genotypes inoculated with P. koolunga . This contrasts with other studies on another pea black spot pathogen, Didymella pinodes , where this same gene is strongly up‐regulated in leaves of resistant and susceptible genotypes. The current study provides the first understanding of defence‐related genes involved in the resistance against P. koolunga , opening novel avenues to engineer new field pea cultivars with improved leaf and stem black spot disease resistance as the basis for developing more effective and sustainable management strategies.
Publisher: MDPI AG
Date: 10-10-2020
Abstract: Brassica napus (canola/oilseed rape/rapeseed) is an economically important crop, mostly found in temperate and sub-tropical regions, that is cultivated widely for its edible oil. Major diseases of Brassica crops such as Blackleg, Clubroot, Sclerotinia Stem Rot, Downy Mildew, Alternaria Leaf Spot and White Rust have caused significant yield and economic losses in rapeseed-producing countries worldwide, exacerbated by global climate change, and, if not remedied effectively, will threaten global food security. To gain further insights into the host–pathogen interactions in relation to Brassica diseases, it is critical that we review current knowledge in this area and discuss how omics technologies can offer promising results and help to push boundaries in our understanding of the resistance mechanisms. Omics technologies, such as genomics, proteomics, transcriptomics and metabolomics approaches, allow us to understand the host and pathogen, as well as the interaction between the two species at a deeper level. With these integrated data in multi-omics and systems biology, we are able to breed high-quality disease-resistant Brassica crops in a more holistic, targeted and accurate way.
Publisher: Elsevier BV
Date: 04-2006
Publisher: Springer Science and Business Media LLC
Date: 23-02-2022
Publisher: CSIRO Publishing
Date: 2023
DOI: 10.1071/CP23211
Publisher: Springer Science and Business Media LLC
Date: 08-2005
Publisher: Springer Science and Business Media LLC
Date: 12-01-2011
DOI: 10.1007/S12550-010-0085-0
Abstract: Sheep grazing in Western Australia can partially or completely refuse to consume annual Medicago pods contaminated with a number of different Fusarium species. Many Fusarium species are known to produce trichothecenes as part of their array of toxigenic secondary metabolites, which are known to cause feed refusal in animals. This study reports the identity of Fusarium species using species-specific PCR primers and a characterization of the toxigenic secondary metabolites produced by 24 Fusarium isolates associated with annual legume-based pastures and particularly those associated with sheep feed refusal disorders in Western Australia. Purification of the fungal extracts was facilitated by a bioassay-guided fractionation using brine shrimp. A number of trichothecenes (3-acetyldeoxynivalenol, deoxynivalenol, fusarenon-X, monoacetoxyscirpenols, diacetoxyscirpenol, scirpentriol, HT-2 toxin and T-2 toxin), enniatins (A, A1, B, and B1), chlamydosporol and zearalenone were identified using GC/MS and/or NMR spectroscopy. Some of the crude extracts and fractions showed significant activity against brine shrimp at concentrations as low as 5 μg ml(-1), and are likely to be involved in the sheep feed refusal disorders. This is the first report of chlamydosporol production by confirmed Fusarium spp. of the incidence of F. brachygibbosum and F. venenatum in Australia and of F. tricinctum in Western Australia and of mycotoxin production by Fusarium species from Western Australia.
Publisher: American Chemical Society (ACS)
Date: 28-03-2013
DOI: 10.1021/PR301117A
Abstract: Fusarium wilt on strawberry caused by Fusarium oxysporum f. sp. fragariae (Fof) is a serious threat to commercial strawberry production worldwide. However, resistance mechanisms of strawberry against Fof remain unknown. To reveal the defense responses of strawberry against Fof, comparative proteome analyses were conducted to determine temporal changes in root proteomes of the resistant cv. Festival and susceptible cv. Camarosa from 4 to 72 h post inoculation with Fof. Analysis of proteins separated by two-dimensional gel electrophoresis revealed 79 Fof-responsive proteins with significant differences in abundance (P < 0.05 and greater than 2-fold) in the resistant and/or susceptible cultivar. The 79 proteins were identified through MALDI-TOF/TOF MS/MS analysis, and were mainly involved in primary, secondary and protein metabolism, stress and defense responses, antioxidant and detoxification mechanisms, and hormone biosynthesis. Among these, pathogenesis-related proteins and proteins involved in reactive oxygen species detoxification, ethylene/jasmonic acid signaling pathways, secondary metabolite biosynthesis, glycolysis and/or ubiquitin/26S proteasome-mediated protein degradation have great potential in mediating strawberry resistance against Fof. Protein modification may also have an important contribution. This study provides the first insights into strawberry resistance mechanisms against Fof, opening novel avenues to engineer new strawberry cultivars with improved disease resistance and to develop more effective and sustainable disease management strategies.
Publisher: CSIRO Publishing
Date: 2010
DOI: 10.1071/CP09161
Abstract: Visual ratings of disease reaction to a mixture of races 1 and 2 of clover scorch (Kabatiella caulivora) were conducted on inoculated field plots of 206 accessions of Trifolium purpureum (191 var. purpureum and 15 var. p hyllicum) collected from the Mediterranean basin and surrounding regions. Disease severity scores of the resistant check, cv. Denmark subterranean clover (T. subterraneum), were clearly differentiated from the susceptible check, cv. Paratta purple clover. Nearly 33% of the accessions were resistant to both races. Resistant plants tended to flower later and originate from higher latitudes, where K. caulivora is more widespread. The results of this investigation led to development of ELECTRA™, the first cultivar of purple clover with resistance to both races of K. caulivora.
Publisher: Scientific Societies
Date: 08-2016
DOI: 10.1094/PDIS-10-15-1192-RE
Abstract: Pseudocercosporella capsellae, the causative agent of white leaf spot disease in Brassicaceae, can produce a purple-pink pigment on artificial media resembling, but not previously confirmed as, the toxin cercosporin. Chemical extraction with ethyl acetate from growing hyphae followed by quantitative (thin-layer chromatography [TLC] and high-performance liquid chromatography [HPLC]) and qualitative methods showed an identical absorption spectrum, with similar retardation factor (Rf) values on TLC papers and an identical peak with the same retention time in HPLC as for a standard for cercosporin. We believe this is the first report to confirm that the purple-pink pigment produced by P. capsellae is cercosporin. Confocal microscopy detected green autofluorescence of cercosporin-producing hyphae, confirming the presence of cercosporin inside hyphae. The highly virulent UWA Wlra-7 isolate of P. capsellae produced the greatest quantity of cercosporin (10.69 mg g −1 ). The phytotoxicity and role of cercosporin in disease initiation across each of three Brassicaceae host species (Brassica juncea, B. napus, and Raphanus raphanistrum) was also studied. Culture filtrates containing cercosporin were phytotoxic to all three host plant species, producing large, white lesions on highly sensitive B. juncea, only water-soaked areas on least sensitive R. raphanistrum, and intermediate lesions on B. napus. It is noteworthy that sensitivity to cercosporin of these three host species was analogous to their susceptibility to the pathogen, viz., B. juncea the most susceptible, R. raphanistrum the least susceptible, and B. napus intermediate. The presence of cercosporin in the inoculum significantly increased disease severity on the highly cercosporin-sensitive B. juncea. We believe that this is the first study to demonstrate that P. capsellae produces cercosporin in liquid culture rather than agar media. Finally, this study highlights an important role of cercosporin as a pathogenicity factor in white leaf spot disease on Brassicaceae as evidenced by the ability of the cercosporin-rich culture filtrate to reproduce white leaf spot lesions on host plants and by the enhanced virulence of P. capsellae in the presence of cercosporin.
Publisher: Springer Science and Business Media LLC
Date: 11-11-2020
Publisher: CSIRO Publishing
Date: 2007
DOI: 10.1071/EA05282
Abstract: Coolamon is a mid-season to late-season flowering F4-derived crossbred subterranean clover of var. subterraneum, developed by the collaborating organisations of the National Annual Pasture Legume Improvement Program. It is a replacement for Junee and has been selected for release on the basis of its greater herbage production and persistence, and its resistance to both known races of clover scorch. Coolamon is recommended for sowing in Western Australia, New South Wales, Victoria, South Australia and Queensland. It is best suited to well-drained, moderately acidic soils in areas with a growing season of 6.5–8 months that extends into November. Coolamon is best suited to phase farming and permanent pasture systems. It can also be used in cropping rotations, but at least 2 years of pasture are required between crops. Coolamon has been granted Plant Breeders Rights in Australia.
Publisher: CSIRO Publishing
Date: 2007
DOI: 10.1071/EA05283
Abstract: Izmir is a hardseeded, early flowering, subterranean clover of var. subterraneum (Katz. et Morley) Zohary and Heller collected from Turkey and developed by the collaborating organisations of the National Annual Pasture Legume Improvement Program. It is a more hardseeded replacement for Nungarin and best suited to well-drained, moderately acidic soils in areas with a growing season of less than 4.5 months. Izmir seed production and regeneration densities in 3-year pasture phases were similar to Nungarin in 21 trials across southern Australia, but markedly greater in years following a crop or no seed set. Over all measurements, Izmir produced 10% more winter herbage and 7% more spring herbage than Nungarin. Its greater hardseededness and good seed production, makes it better suited to cropping rotations than Nungarin. Softening of Izmir hard seeds occurs later in the summer–autumn period than Nungarin, giving it slightly greater protection from seed losses following false breaks to the season. Izmir is recommended for sowing in Western Australia, New South Wales, Victoria, South Australia and Queensland. Izmir has been granted Plant Breeders Rights in Australia.
Publisher: Scientific Societies
Date: 02-2023
DOI: 10.1094/PDIS-05-22-1153-RE
Abstract: Alternaria leaf spot (Alternaria brassicae) can be a devastating disease in canola (Brassica napus) and mustard (B. juncea), but there are no highly effective host resistances available. Screening of 150 erse Brassicaceae varieties under glasshouse conditions highlighted important novel resistances. In particular, Camelina sativa ‘4076’ and Diplotaxis erucoides ‘Wasabi Rocket’ had complete resistance across disease assessment parameters (leaf incidence [%LDI] severity [%LAD] consequent defoliation [%LCI]). The next most resistant varieties were C. sativa ‘CSA’ (%LDI 0.6 %LAD 0.4), ‘4144’ (%LDI 1.2 %LAD 0.5), ‘405’ (%LDI 1.7 %LAD 0.7), C. sativa ‘3274’ (%LDI 2.5 %LAD 0.8), Carrichtera annua ‘CAN3’ (%LDI 7.7 %LAD 4.0), and Sisymbrium irio ‘London Rocket’ (%LDI 2.1 %LAD 0.8), all with %LCI values of 0. Other genotypes showing high-level resistance included S. erysimoides ‘SER 4’ (%LDI 11.8 %LAD 5.6 %LCI 0) and D. cardaminoides ‘Wild Rocket’ (%LDI 15.5 %LAD 7.2 %LCI 0), and those showing moderate resistance were Brassica carinata ‘ML-EM-1’ (Rungwe), B. insularis ‘Moris’, B. napus ‘ZY006’, B. oxyrrhina ‘BOX1’, B. oleracea var. capitata ‘Sugarloaf’, B. tournefortii ‘CN01-104-2’, and Sinapis alba ‘Concerta’ with %LDI 21.6 to 29.8, %LAD 12.8 to 21.0, and %LCI 0 to 5.7. In particular, B. napus ‘ZY006’ for canola and B. oleracea var. capitata ‘Sugarloaf’ can now be directly utilized (i.e., without crossing impairment) for Brassica species and vegetable breeding programs, respectively. While all B. juncea genotypes were susceptible, there were some less susceptible varieties from India in comparison with genotypes from Australia or China. The most susceptible test genotype was Rapistrum sativus (%LDI 89.4 %LAD 83.9 %LCI 71.0), highlighting the value of the resistances identified. These findings not only highlight a range of novel resistances against A. brassicae for canola, mustard, and other erse Brassicaceae breeding programs to develop resistant commercial varieties, but also emphasize highly susceptible varieties to avoid in both breeding programs and commercial situations conducive to Alternaria leaf spot.
Publisher: Springer Science and Business Media LLC
Date: 19-01-2011
Publisher: Wiley
Date: 06-03-2021
DOI: 10.1111/PPA.13359
Abstract: Faba bean gall (FBG) is a devastating disease of faba bean ( Vicia faba ) in Ethiopia. Studies were undertaken first to compare and contrast similarities between FBG disease symptoms and morphology in Ethiopia with those reported earlier in China and, secondly, to identify definitively the FBG causal agent, previously considered as Olpidium viciae , through molecular studies. Morphological studies confirmed an epibiotic phase of zoosporangia for dispersing zoospores, characteristic of Physoderma but not Olpidium , and did not show critical diagnostic characteristics of Olpidium such as presence of numerous short zoosporangial discharging tubes, or binucleate resting sporangia. Recognizing this epibiotic phase is a foundation for comprehending FBG epidemiology and will allow forecasting of zoospore release to highlight best timings for applications of chemical sprays to reduce reinfection cycles. Sequences of partial ITS1‐5.8S‐partial ITS2, the 18S‐ITS1‐5.8S‐ITS2‐part of 28S rRNA, and LSU (28S rRNA) derived from tissue with symptoms confirmed Physoderma , and not Olpidium , as the causal agent. S le sequences were either close to Physoderma or the contaminant ascochyta pathogen Didymella . From symptom, morphological, and molecular data, the causal agent of FBG disease in Ethiopia is Physoderma . From observations of symptoms that Physoderma can cause, it was determined that this Physoderma crosses over between different legume host genera (e.g., Vicia , Pisum , Trifolium ), highlighting the significant biosecurity risk for countries currently free of FBG.
Publisher: CSIRO Publishing
Date: 2017
DOI: 10.1071/CP16363
Abstract: Downy mildew (Hyaloperonospora parasitica) is a problem for canola production worldwide, including in Australia where it has remained a persistent threat since 1998. Testing of 131 Brassicaceae varieties, including 109 Australian canola varieties (Brassica napus and B. juncea) and 22 erse Brassicaceae (including B. napus, B. carinata, B. juncea, B. nigra, B. rapa, Crambe abyssinica and Raphanus sativus) highlighted excellent resistance to downy mildew. Using a mixture of 10 H. parasitica isolates, R. sativus Colonel and Boss showed highest resistance to H. parasitica, with per cent disease index (%DI) values of 3.7% and 10.2%, respectively. These were followed by (%DI values): B. carinata ATC 94011 (11.1%), B. napus CB™ Tanami (14.1%) and Komet-741 A (14.3%), B. juncea 397.23.2.3.3 (14.8%), B. napus ATR-Banjo (16.9%), Hyola 575 CL (16.9%), Komet-744 A (18.1%), Cresor-770 B (18.5%), Wamus (18.5%), Surpass 400 (19.2%), Hyola 432 (19.4%) and Hyola 76 (19.4%), and C. abyssinica (19.9%). These varieties were also considered highly resistant. Another five B. juncea genotypes and B. nigra P.23845 were considered highly resistant with %DI of 22.2%. Those considered resistant (but not highly resistant) included hybrid B. napus Hyola 444 TT, Hyola 500 RR, Hyola 504 RR, Pioneer 46Y78, Pioneer 45Y77 and Hyola 650 TT, and the non-hybrid variety ATR-Eyre, all with %DI values 23.1–28.2%. By contrast, B. napus Thunder TT, Hyola 450 TT and ATR-Grace were highly susceptible with %DI values of 90.3%, 88.2% and 81.7%, respectively. Cluster analysis revealed six distinct clusters (highly resistant, resistant, moderately resistant, moderately susceptible, susceptible, very susceptible) for the tested Brassicaceae genotypes that, on average, showed similar responses within each cluster against H. parasitica based on their %DI values. From 2000 onwards (with the exception of Surpass 400), 10 B. napus varieties and one B. juncea released were classified as highly resistant however, there was no overall correlation between year of variety release and level of resistance expressed against H. parasitica. This is the first study to demonstrate the existence of very high levels of pathotype-independent resistance in Australian canola varieties to H. parasitica. The most resistant varieties identified can be used in canola breeding programs and also directly deployed into regions where downy mildew is prevalent, providing the canola industry with an immediate and effective option for management of this important disease.
Publisher: Wiley
Date: 14-02-2017
DOI: 10.1111/GFS.12282
Publisher: Wiley
Date: 05-04-2017
DOI: 10.1111/PPA.12704
Publisher: Springer Science and Business Media LLC
Date: 2009
DOI: 10.1071/AP08087
Publisher: CSIRO Publishing
Date: 2002
DOI: 10.1071/EA01112
Abstract: A range of Brassica species was screened for resistance to Leptosphaeria maculans, the causal agent of blackleg. The lines were assessed in 8 disease nurseries in 4 canola growing regions of Australia and in 1�glasshouse trial, with a view to identifying alternative sources of resistance to L. maculans for Australian breeding programs. Lines were screened for degree of internal and external blackleg symptoms during both the seedling and adult plant growth stages. Correlation for resistance with ranking between disease nurseries was very strong (0.41-0.98). Brassica carinata and B. nigra were the most resistant species in the disease nurseries, being even more resistant than B. juncea. The 7 European winter B. napus lines tested were significantly more resistant than the 7�Australian spring B. napus lines, with another crucifer, Sinapis alba, being intermediate in resistance between the European and Australian B. napus lines. The same ranking of lines from most to least resistant was also seen when cotyledons and stems were inoculated in the glasshouse with 2 well-characterised Australian isolates. With the exception of the B. napus susceptible control Westar, all lines had similar frequencies of seedling survival in the nurseries. However, mature plants of these lines varied significantly in their degree of resistance. This indicates that screening for seedling survival is not useful in selecting L. maculans resistant lines in Australia. The Brassica lines with the B genome, especially B. carinata, and the winter B. napus types are now being used as sources of resistance in Australian breeding programs.
Publisher: CSIRO Publishing
Date: 2007
DOI: 10.1071/AR06237
Abstract: White rust (Albugo candida) is a highly destructive disease of oilseed Brassicas such as Brassica juncea and B. rapa. Most commercial B. juncea or B. rapa varieties are highly susceptible and yield losses from combined infection of leaves and inflorescences can be up to 20% or 60% in Australia and India, respectively. In Australia, canola-quality B. juncea has been developed to extend oilseed Brassica production into lower rainfall areas, with the first commercial B. juncea canola-quality variety planned for release in 2006. It is essential to identify useful sources of host resistance in B. juncea as breeding and/or selection of material for resistance is the most cost-effective method of delivering control for farmers. Three experiments were undertaken under controlled-environmental conditions to identify the best methods of characterising host resistance and to identify sources of resistance in B. juncea germplasm from Australia, China, and India. Forty-four B. juncea genotypes, viz. 22 from India, 12 from Australia, and 10 from China, were tested. Four Chinese genotypes (CBJ-001, CBJ-002, CBJ-003, CBJ-004) and one Australian genotype (JR049) consistently showed high resistance to A. candida across the different plant growth stages against a pathotype prevailing in Australia. Similarly, the most susceptible genotypes (viz. Indian genotypes RH781, RL1359, RH819) were extremely susceptible irrespective of the plant growth stage. Overall, although disease severity on cotyledons and leaves at the different growth stages was significantly and positively correlated, there was, however, no significant correlation between the number of stagheads and any of the other disease parameters measured. Our study demonstrates that controlled-environmental conditions are suitable for rapid identification of resistant genotypes and that genotypes with high levels of resistance can be reliably identified at the cotyledonary, seedling, or flowering stages.
Publisher: Elsevier BV
Date: 02-2005
Publisher: Springer Science and Business Media LLC
Date: 16-11-2016
Publisher: Springer Science and Business Media LLC
Date: 25-10-2010
Publisher: Springer Science and Business Media LLC
Date: 04-03-0005
Publisher: CSIRO Publishing
Date: 2005
DOI: 10.1071/AR04172
Abstract: A study was made on the incidence of Fusarium spp. associated with pods of annual Medicago species, in particular M. polymorpha var. brevispina, in Western Australia, including sites where either feed refusal or reduced feed intake by sheep had previously been reported. From a first series of 7 sites where M. polymorpha var. brevispina in particular, but also M. truncatula, were s led, there was an extremely high incidence of F. acuminatum (83%) on pods at the Cunderdin site where feed refusal by sheep had been previously reported. There were high incidences of F. avenaceum on pods at Katanning (48–65%), but much lower incidences at Shackleton (7%), Merredin (5%), Kellerberrin (3%), and Cunderdin (1%). There was a high incidence of F. equiseti isolated from pods at Cunderdin (30%), but much lower incidences at Katanning (4–6%) and Shackleton (2%). F. chlamydosporum and F. graminearum were only isolated from pods at Cunderdin (14% and 9%, respectively). There were low incidences of F. oxysporum on pods at Katanning (2–4%) and Cunderdin (2%). In a second series of 15 randomly picked additional sites where only M. polymorpha var. brevispina pods were s led, F. acuminatum was found at all 15 sites, with incidences ranging from 26 to 80% of pods carrying this fungus. F. avenaceum incidences were much lower (0–10%), but it was still recovered from 11 of the 15 sites. The incidences of other Fusarium spp. were generally low (0–6%, except for one case of 20%), and these were only isolated from 7 of the 15 sites. Our study is the first published report of Fusarium species associated with annual Medicago pods in Western Australia. F. acuminatum, F. avenaceum, F. equiseti, F. chlamydosporum, and F. graminearum have all previously been reported elsewhere to be toxigenic and one or more of these species may be associated with the sheep feed refusal and/or reduced feed intake situations observed in Western Australia.
Publisher: CSIRO Publishing
Date: 2005
DOI: 10.1071/AR04293
Abstract: Eighty-four genotypes, comprising 71 ssp. subterraneum and ssp. yanninicum breeding lines of Trifolium subterraneum and 13 cultivars commonly used at the time of commencement of the experiment, were screened in the glasshouse for resistance to root rot caused by 2 races of Phytophthora clandestina that occur most widely in Australia. Resistance to race coded 001 was identified in 7 mid-season genotypes of ssp. subterraneum, including the new cultivar, Coolamon, and one genotype also showed resistance to race coded 373. Of the late flowering ssp. subterraneum genotypes tested, 13 showed resistance to race coded 001 and 4 of them also showed resistance to race coded 373. In the late flowering ssp. yanninicum group, 12 of 13 genotypes tested, including the new cultivar, Napier, showed resistance to both races. Of the mid-season ssp. yanninicum genotypes, all but 2 of 19 tested showed resistance to both races. The resistance observed in the majority of ssp. yanninicum and in some ssp. suberraneum genotypes, indicates that these are useful sources of resistance that can be exploited, either directly as new cultivars to minimise damage from this disease, or as parents in breeding programs to develop cultivars with improved resistance to P. clandestina. This study established the availability of 51 advanced lines and 11 cultivars as sources of resistance against P. clandestina race coded 001 and 36 lines and 4 cultivars for race coded 373, among which 36 lines and 4 cultivars were resistant against both races.
Publisher: Springer Science and Business Media LLC
Date: 02-02-2018
Publisher: Springer Science and Business Media LLC
Date: 2005
DOI: 10.1071/AP05017
Publisher: Scientific Societies
Date: 07-2016
DOI: 10.1094/PDIS-12-15-1459-RE
Abstract: Systemic hypersensitive resistance (SHR) caused by Turnip mosaic virus (TuMV) was studied by light microscopy and histochemical analysis in stem cross sections of Brassica juncea (Indian mustard) plants. Ten TuMV isolates were inoculated to leaves of susceptible line JM 06006, cv. Oasis CI, which carries TuMV systemic hypersensitivity gene TuRBJU 01, and F3 progeny plants obtained from a cross between them. Systemic mosaic (SM) symptoms were induced by all 10 isolates in plants of JM 06006, and by resistance-breaking isolate NSW-3 in all cv. Oasis CI and F3 plants. With the other nine isolates, cv. Oasis CI plants developed SHR while F3 progeny plants segregated for both phenotypes mock-inoculated control plants never became infected. Presence of SHR did not delay systemic invasion as this commenced within 2 hours after inoculation (hai) and was almost complete by 72 hai regardless of whether plants subsequently developed SHR or SM. When stem cross sections s led 9 to 12 days after inoculation were examined for the plant defense responses, phloem necrosis, hydrogen peroxide accumulation, and additional lignin deposition, sections from plants with SHR demonstrated all of these characteristics, but sections from plants with SM or mock-inoculation did not. Based on consolidated data from all isolates except NSW-3, stems developing SHR had significantly more occluded xylem vessels (P 0.001) compared with stems from plants developing SM or mock-inoculated plants. Both light microscopy and histochemical tests with phloroglucinol-HCl and toluidine blue O indicated that the xylem occlusions could be gels. Thus, phloem necrosis, xylem occlusion, lignification, and hydrogen peroxide accumulation were all associated with the SHR in B. juncea plants carrying TuMV hypersensitivity gene TuRBJU 01. In addition, virus inclusion bodies were fewer in sections from plants with SHR. Phloem necrosis was apparently acting as the primary cause of SHR and xylem occlusion as an important secondary cause.
Publisher: Springer Science and Business Media LLC
Date: 07-2015
Publisher: Springer Science and Business Media LLC
Date: 14-07-2014
Publisher: Springer Science and Business Media LLC
Date: 13-03-2020
Publisher: Elsevier BV
Date: 09-2021
Publisher: Springer Science and Business Media LLC
Date: 19-02-2019
Publisher: CSIRO Publishing
Date: 2020
DOI: 10.1071/CP20024
Abstract: Both Alternaria japonica and A. brassicae cause severe Alternaria leaf spot on canola (Brassica napus) and mustard (B. juncea). We tested 103 Brassicaceae varieties including 93 Australian canola, nine Indian mustard, and a single variety of Ethiopian mustard (B. carinata) under greenhouse conditions to identify host resistance to Alternaria leaf spot caused by A. japonica and A. brassicae in terms of disease incidence (percentage leaf disease incidence, %LDI), disease severity (percentage leaf area diseased, %LAD) and defoliation (percentage leaf collapse index, %LCI). Against A. japonica, across the three parameters, B. napus Surpass 404 CL was the most resistant (%LDI 7.5, %LAD 5.0, %LCI 0). Varieties Hyola 635 CC, Oscar, AG-Outback and Rottnest, with %LDI 15.6–19.4 and %LAD 12.5–15.6, also showed strong resistance, and with %LCI 10. Varieties 47C02, ATR-Signal and Clancy of B. napus showed a moderate level of resistance across %LDI (21.2–25.6) and %LAD (15.0–20.6), along with a low level of defoliation (%LCI 10). Varieties 46C03, 46C72, ATR-Cobbler and Granite TT of B. napus also showed a moderate level of resistance, with %LDI 23.1–28.7, %LAD 18.1–20.6 and %LCI 11.2–14.4. The significance of this resistance against A. japonica is highlighted by the severe disease on B. napus Thunder TT (%LDI 78.8, %LAD 72.5, %LCI 47.5). Against A. brassicae, all varieties showed susceptibility however, B. napus ATR-Grace was the least susceptible in relation to disease incidence (%LDI 41.2) and severity (%LAD 36.2), and B. napus Hyola 450 TT the most susceptible (%LDI 90.0, %LAD 82.5). Variety Hurricane of B. napus was the least susceptible in terms of consequent defoliation (%LCI 11.2) and B. napus CBTM Tribune the most susceptible (%LCI 81.2). The B. carinata variety BCA 1 (ATC 95065) and all test B. juncea varieties showed susceptibility to both pathogens. These findings demonstrate high levels of resistance across Australian canola varieties against A. japonica that can be directly deployed where A. japonica is important and can be utilised by breeders for improving resistance in future varieties. By contrast, susceptibility across Australian canola and mustard varieties to A. brassicae is concerning, highlighting a need to locate suitable resistances and, until effective host resistance can be located, to develop and deploy cultural and chemical options.
Publisher: Wiley
Date: 18-12-2018
DOI: 10.1111/PPA.12794
Publisher: Springer Science and Business Media LLC
Date: 28-03-2012
Publisher: Springer Science and Business Media LLC
Date: 28-08-2007
Publisher: CSIRO Publishing
Date: 2014
DOI: 10.1071/CP14031
Abstract: Subterranean clover (Trifolium subterraneum L.) is the most widely sown pasture legume in southern Australia and resistance to important diseases and pests has been a major plant-breeding objective. Kabatiella caulivora, the cause of clover scorch, is the most important foliar fungal pathogen, and several cultivars have been developed with resistance to both known races. Screening of advanced breeding lines has been conducted to prevent release of cultivars with high susceptibility to other important fungal foliar disease pathogens, including rust (Uromyces trifolii-repentis), powdery mildew (Oidium sp.), cercospora (Cercospora zebrina) and common leaf spot (Pseudopeziza trifolii). Several oomycete and fungal species cause root rots of subterranean clover, including Phytophthora clandestina, Pythium irregulare, Aphanomyces trifolii, Fusarium avenaceum and Rhizoctonia solani. Most breeding efforts have been devoted to resistance to P. clandestina, but the existence of different races has confounded selection. The most economically important virus diseases in subterranean clover pastures are Subterranean clover mottle virus and Bean yellow mosaic virus, while Subterranean clover stunt virus, Subterranean clover red leaf virus (local synonym for Soybean dwarf virus), Cucumber mosaic virus, Alfalfa mosaic virus, Clover yellow vein virus, Beet western yellows virus and Bean leaf roll virus also cause losses. Genotypic differences for resistance have been found to several of these fungal, oomycete and viral pathogens, highlighting the potential to develop cultivars with improved resistance. The most important pests of subterranean clover are redlegged earth mite (RLEM) (Halotydeus destructor), blue oat mite (Penthaleus major), blue-green aphid (Acyrthosiphon kondoi) and lucerne flea (Sminthurus viridis). New cultivars have been bred with increased RLEM cotyledon resistance, but limited selection has been conducted for resistance to other pests. Screening for disease and pest resistance has largely ceased, but recent molecular biology advances in subterranean clover provide a new platform for development of future cultivars with multiple resistances to important diseases and pests. However, this can only be realised if skills in pasture plant pathology, entomology, pre-breeding and plant breeding are maintained and adequately resourced. In particular, supporting phenotypic disease and pest resistance studies and understanding their significance is critical to enable molecular technology investments achieve practical outcomes and deliver subterranean clover cultivars with sufficient pathogen and pest resistance to ensure productive pastures across southern Australia.
Publisher: Scientific Societies
Date: 08-2012
DOI: 10.1094/PDIS-05-12-0420-PDN
Abstract: Commercial rice crops (Oryza sativa L.) have been recently reintroduced to the Ord River Irrigation Area in northern Western Australia. In early August 2011, unusual leaf spot symptoms were observed by a local rice grower on rice cultivar Quest. A leaf spot symptom initially appeared as grey-green and/or water soaked with a darker green border and then expanded rapidly to several centimeters in length and became light tan in color with a distinct necrotic border. Isolations from typical leaf lesions were made onto water agar, subcultured onto potato dextrose agar, and maintained at 20°C. A representative culture was lodged in the Western Australian Culture Collection Herbarium, Department of Agriculture and Food Western Australia (WAC 13466) and as a herbarium specimen in the Plant Pathology Herbarium, Plant Biosecurity Science (BRIP 54721). Amplification of the internal transcribed spacer (ITS)1 and (ITS)2 regions flanking the 5.8S rRNA gene were carried out with universal primers ITS1 and ITS4 (4). The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. The sequence had 99% nucleotide identity with the corresponding sequence in GenBank for Magnaporthe oryzae B.C. Couch, the causal agent of rice blast, the most important fungal disease of rice worldwide (1). Additional sequencing with the primers Bt1a/Bt1b for the β-tubulin gene, primers ACT-512F/ACT-783R for the actin gene, and primers CAL-228F/CAL-737R for the calmodulin gene showed 100% identity in each case with M. oryzae sequences in GenBank, confirming molecular similarity with other reports, e.g., (1). The relevant sequence information for a representative isolate has been lodged in GenBank (GenBank Accession Nos. JQ911754 for (ITS) 1 and 2 JX014265 for β-tubulin JX035809 for actin and JX035808 for calmodulin). Isolates also showed morphological similarity with M. oryzae as described in other reports, e.g., (3). Spores of M. oryzae were produced on rice agar under “black light” at 21°C for 4 weeks. Under 30/28°C (day/night), 14/12 h (light/dark), rice cv. Quest was grown for 7 weeks, and inoculated by spraying a suspension 5 × 10 5 spores/ml onto foliage until runoff occurred. Inoculated plants were placed under a dark plastic covering for 72 h to maximize humidity levels around leaves, and subsequently maintained under % RH conditions. Typical symptoms of rice blast appeared within 14 days of inoculation and were as described above. Infection studies were successfully repeated and M. oryzae was readily reisolated from leaf lesions. No disease symptoms were observed nor was M. oryzae isolated from water-inoculated control rice plants. There have been previous records of rice blast in the Northern Territory (2) and Queensland, Australia (Australian Plant Pest Database), but this is the first report of M. oryzae in Western Australia, where it could potentially be destructive if conditions prove conducive. References: (1) B. C. Couch and L. M. Kohn. Mycologia 94:683, 2002 (2) J. B. Heaton. The Aust. J. Sci. 27:81, 1964 (3) C. V. Subramanian. IMI Descriptions of Fungi and Bacteria No 169, Pyricularia oryzae, 1968 (4) T. J. White et al. PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, New York, 1990.
Publisher: Springer Science and Business Media LLC
Date: 2009
DOI: 10.1071/AP08078
Publisher: Springer Science and Business Media LLC
Date: 11-2005
Publisher: Springer Science and Business Media LLC
Date: 2009
DOI: 10.1071/AP09047
Publisher: Springer Science and Business Media LLC
Date: 2006
Publisher: Oxford University Press (OUP)
Date: 2011
DOI: 10.1093/JXB/ERQ365
Publisher: Springer Science and Business Media LLC
Date: 10-2004
Publisher: Scientific Societies
Date: 06-2019
DOI: 10.1094/PDIS-09-18-1666-RE
Abstract: Zucchini yellow mosaic virus (ZYMV) isolates were obtained in Papua New Guinea (PNG) from cucumber (Cucumis sativus) or pumpkin (Cucurbita spp.) plants showing mosaic symptoms growing at Kongop in the Mount Hagen District, Western Highlands Province, or Zage in the Goroka District, Eastern Highlands Province. The s les were blotted onto FTA cards, which were sent to Australia, where they were subjected to high-throughput sequencing. When the coding regions of the nine new ZYMV genomic sequences found were compared with those of 64 other ZYMV sequences from elsewhere, they grouped together, forming new minor phylogroup VII within ZYMV’s major phylogroup A. Genetic connectivity was lacking between ZYMV genomic sequences from PNG and its neighboring countries, Australia and East Timor the closest match between a PNG and any other genomic sequence was a 92.8% nucleotide identity with a sequence in major phylogroup A’s minor phylogroup VI from Japan. When the RDP5.2 recombination analysis program was used to compare 66 ZYMV sequences, evidence was obtained of 30 firm recombination events involving 41 sequences, and all isolates from PNG were recombinants. There were 21 sequences without recombination events in major phylogroup A, whereas there were only 4 such sequences within major phylogroup B. ZYMV’s P1, Cl, N1a-Pro, P3, CP, and NIb regions contained the highest evidence of recombination breakpoints. Following removal of recombinant sequences, seven minor phylogroups were absent (I, III, IV, V, VI, VII, and VIII), leaving only minor phylogroups II and IX. By contrast, when a phylogenetic tree was constructed using recombinant sequences with their recombinationally derived tracts removed before analysis, five previous minor phylogroups remained unchanged within major phylogroup A (II, III, IV, V, and VII) while four formed two new merged phylogroups (I/VI and VIII/IX). Absence of genetic connectivity between PNG, Australian, and East Timorese ZYMV sequences, and the 92.8% nucleotide identity between a PNG sequence and the closest sequence from elsewhere, suggest that a single introduction may have occurred followed by subsequent evolution to adapt to the PNG environment. The need for enhanced biosecurity measures to protect against potentially damaging virus movements crossing the seas separating neighboring countries in this region of the world is discussed.
Publisher: Wiley
Date: 07-2017
DOI: 10.1111/PPA.12562
Publisher: Wiley
Date: 26-06-2023
DOI: 10.1111/PPA.13770
Abstract: Phoma black stem and leaf spot disease ( Phoma medicaginis ) not only destroys annual Medicago spp. forage and seed yield but also reduces herbage quality by consequent phytoestrogen production that reduces ovulation of grazing animals. Two controlled environment studies evaluated the effects of plant developmental stage in annual Medicago rugosa ‘Paraponto’ and M . scutellata ‘Sava’ and different inoculum concentrations of P . medicaginis in M . littoralis ‘Harbinger’ and M . polymorpha ‘Serena’ on disease development and coumestrol production. Disease incidence and severity and coumestrol production were dependent on plant developmental stage, cultivar and inoculum level (all p ≤ 0.001). Disease was least in 4‐week‐old plants highest coumestrol was in inoculated 10‐week‐old Sava (1353 mg/kg) and least coumestrol in uninoculated 4‐week‐old Paraponto (87 mg/kg) and there was a positive correlation of disease incidence/severity factors with coumestrol across cultivars and plant growth stages ( p 0.001). Disease levels and coumestrol production were determined by inoculum concentration and cultivar (both p ≤ 0.001). Highest coumestrol was in Serena inoculated with 10 7 conidia/mL (265 mg/kg) lowest coumestrol was in uninoculated Harbinger (6 mg/kg) and there was a significant positive correlation of disease incidence/severity factors with coumestrol across cultivars and inoculum concentrations ( p 0.001). These studies emphasize both the opportunity for farmers to better use annual Medicago spp. stands for grazing reproducing animals early in the growing season when both disease and coumestrol levels are lowest, and the need for heightened farmer vigilance at later growth stages with greater disease and consequent phytoestrogen risk for grazing animals.
Publisher: Wiley
Date: 09-02-2022
DOI: 10.1111/PPA.13533
Abstract: Phoma black stem and leaf spot disease (caused by Phoma medicaginis ) not only diminishes forage and seed yield but stimulates production of detrimental phytoestrogens in annual Medicago spp. This study aimed to evaluate relationships between disease development from five isolates of P . medicaginis on 16 cultivars with production of coumestrol and 4′‐ O ‐methylcoumestrol. In the presence of P . medicaginis , Sava had the highest coumestrol and 4′‐ O ‐methylcoumestrol (640 and 85 mg/kg, respectively) followed by Caliph (253 and 15 mg/kg, respectively). In the absence of P . medicaginis , Jemalong and Paragosa showed highest and lowest coumestrol (137 and 0 mg/kg, respectively). 4′‐ O ‐methylcoumestrol was not produced in disease‐free plants, but coumestrol was. Disease incidence and severity on leaves and on petiole/stems, and consequent leaf yellowing severity ranged from 5%–98.7%, 0%–100%, 4.4%–98.7%, 1.7%–100%, and 0%–85%. Sava, Paraponto, Harbinger, and Serena were most susceptible, while Tornafield and Caliph were least susceptible. There was significant overall positive correlation of disease incidence/severity factors across cultivars ( p 0.01) with both coumestrol and 4′‐ O ‐methylcoumestrol. Jemalong was least responsive and Paragosa and Sava most responsive to coumestrol production following P . medicaginis inoculation. Coumestrol in inoculated Paragosa increased to 373 mg/kg in comparison with 0 mg/kg in controls. These findings are of critical importance towards developing less disease‐susceptible annual Medicago spp. producing less detrimental phytoestrogens. Least susceptible cultivars like Tornafield and Caliph can be used to manage yield loss, whilst least responsive cultivars to phytoestrogen production like Caliph also can help to reduce phytoestrogen production.
Publisher: Wiley
Date: 24-06-2017
DOI: 10.1111/PPA.12563
Publisher: Scientific Societies
Date: 12-2011
Abstract: Black spot disease on field pea (Pisum sativum) in Australia is generally caused by one or more of the four fungi: Mycosphaerella pinodes (anamorph Ascochyta pinodes), Phoma medicaginis var. pinodella (synonym Phoma pinodella), Ascochyta pisi, and Phoma koolunga (1,2,4). However, in 2010 from a field pea blackspot disease screening nursery at Medina, Western Australia, approximately 25% of isolates were a Phoma sp. that was morphologically different to Phoma spp. previously reported on field pea in Western Australia, while the remaining 75% of isolates were either M. pinodes or P. medicaginis var. pinodella. Single-spore isolations of 23 isolates of this Phoma sp. were made onto potato dextrose agar. A PCR-based assay with the TW81 and AB28 primers was used to lify from the 3′ end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5′ end of the 28S rDNA. The DNA products were sequenced and BLAST analyses were used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GenBank for P. herbarum. Isolates also showed morphological similarities to P. herbarum as described in other reports (e.g., 3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. JN247437). The same primers were used by Davidson et al. (2) to identify P. koolunga, but none of our 23 isolates were P. koolunga. A conidial suspension of 10 7 conidia ml –1 from a single-spore culture was spray inoculated onto foliage of 10-day-old Pisum sativum cv. Dundale plants maintained under % relative humidity conditions for 72 h postinoculation. Symptoms evident by 11 days postinoculation consisted of pale brown lesions that were mostly 1.5 to 2 mm long and 1 to 1.5 mm wide. Approximately 50% of lesions showed a distinct chlorotic halo extending 1 to 2 mm outside the boundary of the lesion. P. herbarum was readily reisolated from infected foliage. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13499). Outside of Australia, P. herbarum, while generally considered a soilborne opportunistic pathogen, has been reported on a wide range of species, including field pea (3). Molecular analysis of historical isolates collected from field pea in Western Australia, mostly in the late 1980s, did not show any incidence of P. herbarum, despite this fungus being reported on alfalfa (Medicago sativa) and soybean (Glycine max) in Western Australia in 1985 (Australian Plant Pest Database). In Western Australia, this fungus has also been recorded on a Protea sp. in 1991 and on Arabian pea (Bituminaria bituminosa) in 2010 (Australian Plant Pest Database). To our knowledge, this is the first report of P. herbarum as a pathogen on field pea in Australia. These previous reports of P. herbarum on other hosts in Western Australia and the wide host range of P. herbarum together suggest the potential for this fungus to be a pathogen on a wider range of genera/species than field pea. References: (1) T. W. Bretag and M. Ramsey. Page 24 in: Compendium of Pea Diseases and Pests. 2nd ed. The American Phytopathologic Society, St Paul, MN, 2001. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. L. Kinsey. Phoma herbarum. No 1501. IMI Descriptions of Fungi and Bacteria, 2002. (4) T. L. Peever et al. Mycologia 99:59, 2007.
Publisher: CSIRO Publishing
Date: 2011
DOI: 10.1071/FP11137
Abstract: Productivity of Phaseolus vulgaris L. (common bean) is often limited by diseases such as seedling blight and root and stem rot caused by the fungus Macrophomina phaseolina and by abiotic stresses such as salinity. This paper reports controlled environment studies examining the interaction of biotic (M. phaseolina) and abiotic (NaCl) stresses. Studies were conducted at 32°C. On potato dextrose agar, the growth of two isolates of M. phaseolina (M1, M2) was differentially stimulated by 40 mM NaCl with 1 mM CaSO4. M. phaseolina was applied as either soil-borne inoculum or directly injected into P. vulgaris hypocotyls. For direct hypocotyl inoculation experiments, there was no difference in disease severity resulting from the two isolates. However, when soil inoculation was undertaken, isolate M2 caused more disease than M1. Addition of 40 mM NaCl to the soil increased disease development and severity (evident 4 days after inoculation), particularly as demonstrated in the hypocotyl inoculation tests, suggesting that salinity stress predisposes plants to infection by this pathogen. Plants infested by M. phaseolina showed increased tissue concentrations of Na+ and Cl– but decreased K+ concentration. Hypocotyls generally contained higher Na+ concentrations than shoots. Inoculated plants had higher Na+ and lower K+ concentrations than uninoculated plants. Our studies indicate that M. phaseolina will be a more severe disease threat where P. vulgaris is cultivated in areas affected by soil salinity.
Publisher: Springer Science and Business Media LLC
Date: 19-12-2013
Publisher: Springer Science and Business Media LLC
Date: 28-11-2008
Publisher: Scientific Societies
Date: 06-2011
Abstract: White rust, caused by Albugo candida, is a serious pathogen of Brassica juncea (Indian mustard) worldwide and poses a potential hazard to the presently developing canola-quality B. juncea industry in Australia. Nine isolates of A. candida, representing strains collected from B. juncea, B. rapa, B. oleracea, B. tournefortii, Raphanus raphanistrum, R. sativa, Eruca vesicaria subsp. sativa, Capsella bursa-pastoris and Sisymbrium irio, from different locations in Western Australia (W.A.), were tested on cruciferous host differentials to characterize their pathogenicity. In particular, these studies were aimed to determine the hazard to the newly emerging B. juncea industry in Australia from races or pathotypes of A. candida present. Pathogenicity tests with appropriate differentials demonstrated the presence in W.A. of a unique strain from B. rapa that did not show characteristics of either race 7A or 7V and clearly is a distinct new pathogenic strain within race 7. Different strains collected from W.A. differed in their host range, with the strains from B. tournefortii and S. irio being highly host specific, failing to be pathogenic on any other differentials. B. tournefortii was host to a strain attacking B. juncea and E. vesicaria subsp. sativa. The strain from R. raphanistrum showed a relatively wide host range among the differentials tested. B. tournefortii, C. bursa-pastoris, R. raphanistrum, and S. irio are common weeds within grain belt and horticultural regions in Australia. The B. oleracea isolate (race 9) was pathogenic to B. juncea ‘Vulcan’ whereas the isolate from B. juncea (race 2V) was not pathogenic on B. oleracea. Similarly, the strain from C. bursa pastoris (race 4) was pathogenic on B. juncea Vulcan but the B. juncea strain was not pathogenic on C. bursa pastoris. In contrast, the strain from R. sativus (race 1) was pathogenic on B. juncea and the B. juncea strain was also pathogenic on R. sativus. Field isolates from B. rapa, B. tournefortii, E. vesicaria subsp. sativa, and S. irio were all nonpathogenic on B. juncea. Isolates from B. juncea and R. raphanistrum were pathogenic on B. napus (FAN 189). For the nine A. candida isolates from W.A., complete rDNA internal transcribed spacer region nucleotide sequence analysis showed a nucleotide identity range of 72.4 to 100% in comparison with previous Australian collections of A. candida and those previously reported in Europe and Asia. The B. tournefortii isolate of A. candida from W.A. formed a distinct clade on its own, with an identity range of 77.4 to 80.5% compared with the other isolates. Isolates from R. raphanistrum and R. sativus from W.A. were least similar to the other isolates, with a nucleotide identity similarity of only 72.4%. Characterization of the races of A. candida in Western Australia adds to the current knowledge regarding the ersity of this pathogen, allows choice of Brassica spp. or cultivars with resistance to races across different regions, and highlights the particular cruciferous weeds involved in pathogen inoculum carryover between successive cruciferous crops, particularly B. juncea crops.
Publisher: Elsevier BV
Date: 08-2014
DOI: 10.1016/J.JPROT.2014.05.023
Abstract: This study was conducted to define differences in Fusarium oxysporum f. sp. fragariae (Fof) isolates with different virulence efficiency to strawberry at the proteome level, in combination with their differences in mycelial growth, conidial production and germination. Comparative proteome analyses revealed substantial differences in mycelial proteomes between Fof isolates, where the 54 differentially accumulated protein spots were consistently over-accumulated or exclusively in the highly virulent isolate. These protein spots were identified through MALDI-TOF/TOF mass spectrometry analyses, and the identified proteins were mainly related to primary and protein metabolism, antioxidation, electron transport, cell cycle and transcription based on their putative functions. Proteins of great potential as Fof virulence factors were those involved in ubiquitin roteasome-mediated protein degradation and reactive oxygen species detoxification the hydrolysis-related protein haloacid dehalogenase superfamily hydrolase 3,4-dihydroxy-2-butanone 4-phosphate synthase associated with riboflavin biosynthesis and those exclusive to the highly virulent isolate. In addition, post-translational modifications may also make an important contribution to Fof virulence. F. oxysporum f. sp. fragariae (Fof), the causal agent of Fusarium wilt in strawberry, is a serious threat to commercial strawberry production worldwide. However, factors and mechanisms contributing to Fof virulence remained unknown. This study provides knowledge of the molecular basis for the differential expression of virulence in Fof, allowing new possibilities towards developing alternative and more effective strategies to manage Fusarium wilt.
Publisher: Frontiers Media SA
Date: 08-06-2018
Publisher: Springer Science and Business Media LLC
Date: 03-11-2020
Publisher: Scientific Societies
Date: 08-2010
Abstract: Ascospores of Sclerotinia sclerotiorum are the primary source of inoculum for disease epidemics in many economically important crops. Mass production of ascospores under laboratory conditions is required to prepare inoculum for use in selection of genotypes with resistance against Sclerotinia diseases. A study was undertaken, first, to investigate the effect on carpogenic germination of scarifying sclerotia from two S. sclerotiorum isolates taken from canola (Brassica napus) and, second, to identify environmental factors that enhance carpogenic germination. Seven different environmental treatments were applied to scarified and unscarified sclerotia: (i) sterilized distilled water for 4 months at 15°C, (ii) aerated water for 4 months at 4°C, (iii) constant rinsing with tap water for 8 weeks at 4°C, (iv) cold-conditioning for 4 weeks at 4°C and subsequent transfer into moist unsterilized compost at 15°C, (v) incubation in sterilized river sand at 15°C, (vi) air drying for 2 weeks followed by subsequent transfer into sterilized moist river sand at 15°C, or (vii) placed into 0.5% water agar and incubated at 15°C. Carpogenic germination of scarified sclerotia was significantly greater (P 0.05) than for unscarified sclerotia. There was significant interaction (P 0.001) between scarification and the different environmental treatments in relation to the carpogenic germination. Carpogenic germination of scarified sclerotia was enhanced by incubation of sclerotia in compost or in sterilized river sand. Further, overall carpogenic germination of both scarified and unscarified sclerotia occurred to the greatest extent when sclerotia of either of the two isolates were subjected to constant rinsing with tap water. We believe this to be the first report of both the enhanced carpogenic germination by scarification in S. sclerotiorum and the environmental factors we report that enhance carpogenic germination of scarified sclerotia. The progression of carpogenic germination in all the environmental treatments was also monitored as a part of this study across the two consecutive years for the same two isolates. The majority of sclerotia of both isolates germinated between the months of June and September in both years, a period which coincides with the main part of the cropping season when Sclerotinia stem rot is normally observed in rainfed canola in Western Australia. These data suggested the existence of a seasonal rhythm-like pattern in relation to the carpogenic germination of this pathogen.
Publisher: Elsevier BV
Date: 11-2011
Publisher: Oxford University Press (OUP)
Date: 27-06-2006
DOI: 10.1093/AOB/MCL132
Publisher: Scientific Societies
Date: 04-2019
DOI: 10.1094/PDIS-07-18-1136-RE
Abstract: Isolates of papaya ringspot virus (PRSV) were obtained from plants of pumpkin (Cucurbita spp.) or cucumber (Cucumis sativus) showing mosaic symptoms growing at Zage in Goroka District in the Eastern Highland Province of Papua New Guinea (PNG) or Bagl in the Mount Hagen District, Western Highlands Province. The s les were sent to Australia on FTA cards where they were subjected to High Throughput Sequencing (HTS). When the coding regions of the six new PRSV genomic sequences obtained via HTS were compared with those of 54 other complete PRSV sequences from other parts of the world, all six grouped together with the 12 northern Australian sequences within major phylogroup B minor phylogroup I, the Australian sequences coming from three widely dispersed locations spanning the north of the continent. Notably, none of the PNG isolates grouped with genomic sequences from the nearby country of East Timor in phylogroup A. The closest genetic match between Australian and PNG sequences was a nucleotide (nt) sequence identity of 96.9%, whereas between PNG and East Timorese isolates it was only 83.1%. These phylogenetic and nt identity findings demonstrate genetic connectivity between PRSV populations from PNG and Australia. Recombination analysis of the 60 PRSV sequences available revealed evidence of 26 recombination events within 18 isolates, only four of which were within major phylogroup B and none of which were from PNG or Australia. Within the recombinant genomes, the P1, Cl, NIa-Pro, NIb, 6K2, and 5′UTR regions contained the highest numbers of recombination breakpoints. After removal of nonrecombinant sequences, four minor phylogroups were lost (IV, VII, VIII, XV), only one of which was in phylogroup B. When genome regions from which recombinationally derived tracts of sequence were removed from recombinants prior to alignment with nonrecombinant genomes, seven previous minor phylogroups within major phylogroup A, and two within major phylogroup B, merged either partially or entirely forming four merged minor phylogroups. The genetic connectivity between PNG and northern Australian isolates and absence of detectable recombination within either group suggests that PRSV isolates from East Timor, rather than PNG, might pose a biosecurity threat to northern Australian agriculture should they prove more virulent than those already present.
Publisher: Scientific Societies
Date: 08-2007
Abstract: The timing of maturation of pseudothecia and discharge of ascospores of the blackleg fungus (Leptosphaeria maculans) is critical in relation to infection early in the cropping season of canola. During 1998 to 2000, development of pseudothecia was investigated on residues of the previous year's canola crop collected from four agroclimatically different locations: Mount Barker (southern high rainfall), Wongan Hills (central medium rainfall), Merredin (central low rainfall), and East Chapman (northern low rainfall) in Western Australia. The pseudothecia matured on residues at different times after harvest in various regions. In general, pseudothecia maturity occurred earlier in the high-rainfall areas than in medium- and low-rainfall areas. An ascospore discharge pattern was investigated from residues of crop from the previous year (6-month-old residues) at three locations—Mount Barker, Wongan Hills, and East Chapman in Western Australia—and from 18-month-old residues that were burnt and raked in the previous year at Mount Barker and East Chapman. Ascospore discharge commenced earlier in high-rainfall ( mm) areas (Mount Barker) and late in northern low-rainfall ( mm) areas (East Chapman). The major ascospore showers took place during May (late autumn) and June (early winter) at Mount Barker and during July and August (mid- to late winter) at East Chapman. The number of ascospores discharged was extremely low at East Chapman compared with Mount Barker. At both locations, the number of ascospores discharged from 18-month-old residues that were raked and burnt in the previous year were only ≈10% of those discharged from previous year's residues left undisturbed. The discharge of ascospores on any given day was negatively correlated with accumulated temperatures, maximum temperature, evaporation, minimum and maximum soil temperatures, and solar radiation and was positively correlated with the minimum temperature, rain, and minimum relative humidity. This is the first report describing how pseudothecia mature on residues in different rainfall areas in Western Australia, and it potentially can be used in developing a forecasting system to avoid the synchronization of major ascospore showers with the maximum susceptibility period of canola seedlings.
Publisher: Scientific Societies
Date: 05-2010
Abstract: Lettuce plants showing symptoms of lettuce big-vein disease were collected from fields in the Perth Metropolitan region of southwest Australia. When root extracts from each plant were tested by polymerase chain reaction (PCR) using primers specific to the rDNA internal transcribed spacer (ITS) region of Olpidium brassicae and O. virulentus, only O. virulentus was detected in each of them. The nucleotide sequences of the complete rDNA ITS regions of isolates from five of the root s les and 10 isolates of O. virulentus from Europe and Japan showed 97.9 to 100% identities. However, with the six O. brassicae isolates, their identities were only 76.9 to 79.4%. On phylogenetic analysis of the complete rDNA-ITS region sequences of the five Australian isolates and 10 others, the Australian isolates fitted within two clades of O. virulentus (I and II), and within clade I into two of its four subclades (Ia and Id). Japanese isolates had greatest sequence ersity fitting into both clades and into all of clade I subclades except Ib, while European isolates were restricted to subclades Ib and Id. When the partial rDNA-ITS region sequences of two additional southwest Australian isolates, four from Europe, and four from the Americas were included in the analyses, the Australian isolates were within O. virulentus subclades Ia and Id, the European isolates within subclade Ic, and the American isolates within subclades Ia and Ib. These findings suggest that there may have been at least three separate introductions of O. virulentus into the isolated Australian continent since plant cultivation was introduced following its colonization by Europeans. They also have implications regarding numbers of different introductions to other isolated regions. Lettuce big-vein associated virus and Mirafiori lettuce big-vein virus were both detected when symptomatic lettuce leaf tissue s les corresponding to the root s les from southwest Australia were tested using virus-specific primers in reverse transcription–PCR, so presence of both viruses was associated with O. virulentus occurrence.
Publisher: Springer Science and Business Media LLC
Date: 20-04-2014
Publisher: Wiley
Date: 08-01-2015
DOI: 10.1111/PPA.12338
Publisher: CSIRO Publishing
Date: 2019
DOI: 10.1071/CP19262
Abstract: Studies were undertaken under controlled conditions into the effects of different foliage components (cotyledon, first, second and third leaf) at three plant ages (3, 5 and 7 weeks old) on development of Alternaria leaf spot disease, caused by Alternaria japonica or A. brassicae, in canola (Brassica napus cv. Thunder TT) and mustard (B. juncea cv. Dune). Alternaria japonica generally showed percentage disease index (%DI) values similar to A. brassicae across the two Brassica species, different foliage components and plant ages. %DI from either pathogen was greater in older plants than younger plants for the same foliage components in both cultivars. Field studies were then undertaken with canola to compare disease development from A. japonica and A. brassicae across different plant components (leaf, pod and stem) and the consequent adverse impact on seed yield. Alternaria japonica was more severe in terms of leaf area diseased (%LAD 62.6) and stem area diseased (%SAD 69.8) than pod area diseased (%PAD 25.5), whereas A. brassicae was more severe on leaves (%LAD 61.9) than on pods (%PAD 47.4) or stems (%SAD 41.0). Stem disease incidence was greater for A. japonica (%SDI 94.0) than for A. brassicae (%SDI 56.5), but pod disease incidence was greater for A. brassicae (%PDI 93.5) than for A. japonica (%PDI 86.1). For A. japonica, AUDPC values of leaf disease incidence (LDI, 283.5), leaf area diseased (LAD, 253.3) and leaf collapse (LCI, 149.5) resulted in a yield loss of 58.1%, similar to A. brassicae, where AUDPC values of LDI (277.8), LAD (247.2) and LCI (111.0) caused a yield loss of 59.4%. These findings explain observed acceleration of Alternaria leaf spot severity from A. japonica, as from A. brassicae, through the growing season as plants become more susceptible with increasing age, and as more susceptible, later developing leaves become abundant. For the first time, we demonstrate that under conducive field conditions for disease development, A. japonica can cause serious seed-yield losses of a magnitude similar to those occurring with A. brassicae.
Publisher: Oxford University Press (OUP)
Date: 29-09-2016
DOI: 10.1093/AOB/MCV150
Publisher: Springer Science and Business Media LLC
Date: 2008
DOI: 10.1071/AP07086
Publisher: Elsevier BV
Date: 05-2010
Publisher: Springer Science and Business Media LLC
Date: 19-11-2019
DOI: 10.1038/S41598-019-53444-3
Abstract: Sclerotinia stem rot caused by Sclerotinia sclerotiorum is a major disease of crop brassicas, with inadequate variation for resistance in primary gene pools. We utilized a wild Brassicaceae species with excellent resistance against stem rot to develop a set of B. juncea - B. fruticulosa introgression lines (ILs). These were assessed for resistance using a highly reproducible stem inoculation technique against a virulent pathogen isolate. Over 40% of ILs showed higher levels of resistance. IL-43, IL-175, IL-215, IL-223 and IL-277 were most resistant ILs over three crop seasons. Sequence reads (21x) from the three most erse ILs were then used to create B. juncea pseudomolecules, by replacing SNPs of reference B. juncea with those of re-sequenced ILs. Genotyping by sequencing (GBS) was also carried out for 88 ILs. Resultant sequence tags were then mapped on to the B. juncea pseudomolecules, and SNP genotypes prepared for each IL. Genome wide association studies helped to map resistance responses to stem rot. A total of 13 significant loci were identified on seven B. juncea chromosomes (A01, A03, A04, A05, A08, A09 and B05). Annotation of the genomic region around identified SNPs allowed identification of 20 candidate genes belonging to major disease resistance protein families, including TIR-NBS-LRR class, Chitinase, Malectin/receptor-like protein kinase, defensin-like ( DEFL ), desulfoglucosinolate sulfotransferase protein and lipoxygenase. A majority of the significant SNPs could be validated using whole genome sequences (21x) from five advanced generation lines being bred for Sclerotinia resistance as compared to three susceptible B. juncea germplasm lines. Our findings not only provide critical new understanding of the defensive pathway of B. fruticulosa resistance, but will also enable development of marker candidates for assisted transfer of introgressed resistant loci in to agronomically superior cultivars of crop Brassica .
Publisher: Scientific Societies
Date: 2012
Abstract: Black spot is a major disease of field pea (Pisum sativum L.) production across southern Australia. Known causal agents in Australia include one or more of Mycosphaerella pinodes (Berk. & Bloxam) Vestergr., Phoma medicaginis var. pinodella (L.K. Jones), Ascochyta pisi Lib., or P. koolunga (Davidson, Hartley, Priest, Krysinska-Kaczmarek, Herdina, McKay & Scott) (2), but other pathogens may also be associated with black spot symptoms. Black spot generally occurs on most plants and in most pea fields in Western Australia (W.A.), and during earlier winter/spring surveys of blackspot pathogens, some isolates were tentatively allocated to P. medicaginis var. pinodella despite different cultural characteristics on potato dextrose agar (PDA). Recently, single-spore isolations of a single culture each from an infested pea crop at Medina, Moora, and Mt. Barker in W.A. were made onto PDA. A PCR-based assay with TW81 and AB28 primers was used to lify from the ITS-5.8S rDNA region. Purified DNA products were sequenced for the three isolates and then BLASTn was used to compare sequences with those in GenBank. Our sequences (GenBank Accession Nos. JN37743, JN377439, and JN377438) had 100% nucleotide identity with P. exigua Desm. var. exigua accessions (GI13385450, GI169894028, and GI189163921), an earlier synonym of what is now known as Boeremia exigua var. exigua ([Desm.] Avesk , Gruyter & Verkley) (1). Davidson et al. (2) used the same primers to identify P. koolunga, but none of our isolates were P. koolunga. A suspension of 10 7 conidia ml –1 of each representative isolate was inoculated onto foliage of 15-day-old field pea cv. Dundale plants and maintained at % relative humidity for 72 h postinoculation. Control plants inoculated with just water remained symptomless. Brown lesions were evident by 8 to 10 days postinoculation and mostly 1 to 3 mm in diameter. B. exigua var. exigua was readily reisolated from infected leaves. Isolates have been lodged in the W.A. Culture Collection Herbarium maintained at the Department of Agriculture and Food W.A. (Accession Nos. WAC13500, WAC13502, and WAC13501 from Medina, Moora, and Mt. Barker, respectively). Outside Australia, its synonym P. exigua var. exigua is a known pathogen of field pea (4), other legumes including common bean (Phaseolus vulgaris L.) (4) and soybean (Glycine max [L.] Merr.) (3), and is known to produce phytotoxic cytochalasins. In eastern Australia, P. exigua var. exigua has been reported on common bean (1930s and 1950s), phasey bean (Macroptilium lathyroides [L.] Urb.) and siratro (M. atropurpureum (DC.) Urb.) (1950s and 1960s), mung bean (Vigna radiata [L.] Wilczek.) (1960s), ramie (Boehmeria nivea [L.] Gaudich.) (1939), potato (Solanum tuberosum L.) (1980s), and pyrethrum (Tanacetum cinerariifolium [Trevir.] Schultz Bip.) (2004 and 2007) (Australian Plant Pest Database). To our knowledge, this the first report of B. exigua var. exigua on field pea in Australia, and because of its potential to be a significant pathogen on field pea, warrants further evaluation. References: (1) M. M. Avesk et al. Stud. Mycol. 65:1, 2010. (2) J. A. Davidson et al. Mycologia 101:120, 2009. (3) L. Irinyi et al. Mycol. Res. 113:249, 2009. (4) J. Marcinkowska. Biul. Inst. Hod. Aklim. Rosl. 190:169, 1994.
Publisher: Scientific Societies
Date: 05-2015
DOI: 10.1094/PDIS-06-14-0655-RE
Abstract: Black spot, also known as Ascochyta blight, is the most important disease on field pea (Pisum sativum). It is caused by a complex of pathogens, the most important of which in Australia include Didymella pinodes, Phoma pinodella, and P. koolunga. The relative proportions of these and other component pathogens of the complex fluctuate widely across time and geographic locations in Australia, limiting the ability of breeders to develop varieties with effective resistance to black spot. To address this, 40 field pea genotypes were tested under controlled environment conditions for their in idual stem and leaf responses against these three pathogens. Disease severity was calculated as area under disease progress curve (AUDPC), and subsequently converted to mean rank (MR). The overall rank (OR) for each pathogen was used to compare response of genotypes under inoculation with each pathogen. The expressions of host resistance across the field pea genotypes were largely dependent upon the in idual test pathogen and whether the test was on stem or leaf. Overall, P. koolunga caused most severe stem disease significantly more severe than either D. pinodes or P. pinodella. This is the first report of the host resistance identified in field pea to P. koolunga the five genotypes showing highest resistance on stem, viz. 05P778-BSR-701, ATC 5338, ATC 5345, Dundale, and ATC 866, had AUDPC MR values .4, while the AUDPC MR values of the 19 genotypes showing the best resistance on leaf was less than 296.8. Two genotypes, ATC 866 and Dundale, showed resistance against P. koolunga on both stem and leaf. Against D. pinodes, the four and 16 most resistant genotypes on stem and leaf had AUDPC MR values .2 and .6, respectively, with four genotypes showing resistance on both stem and leaf including 05P770-BSR-705, Austrian Winter Pea, 06P822-(F5)-BSR-6, and 98107-62E. Against P. pinodella, four and eight genotypes showing the best resistance on stem and leaf had AUDPC MR values .3 and .9, respectively three genotypes, viz. 98107-62E, Dundale, and Austrian Winter Pea showed combined resistance on stem and leaf. A few genotypes identified with resistance against two major pathogens of the complex will be of particular significance to breeding programs. These findings explain why field pea varieties arising from breeding programs in Australia fail to display the level or consistency of resistance required against black spot and why there needs to be a wider focus than D. pinodes in breeding programs.
Publisher: Wiley
Date: 20-06-2016
DOI: 10.1111/JPH.12425
Publisher: Scientific Societies
Date: 05-2017
DOI: 10.1094/PDIS-08-16-1129-RE
Abstract: A new resistance-breaking strain of Turnip mosaic virus (TuMV) overcomes TuMV resistance genes that currently suppress spread of this virus in Brassica napus crops in the Liverpool Plains region of eastern Australia. Isolates 12.1 and 12.5 of this strain and three other isolates in TuMV pathotypes 1 (NSW-2), 7 (NSW-1), and 8 (WA-Ap1) were inoculated to plants of 19 B. napus cultivars and one breeding line. All plants of these cultivars and the breeding line proved susceptible to 12.1 and 12.5 but developed only resistance phenotypes with WA-Ap1 or mostly resistance phenotypes with NSW-1 and NSW-2. Five different TuMV resistance phenotypes occurred either alone or segregating in different combinations. When these five isolates were inoculated to plants of nine other crop or wild Brassicaceae spp. and four indicator hosts in other families, 12.1 and 12.5 resembled the other three in inducing TuMV resistance phenotypes in some Brassicaceae spp. but not others, and by inducing extreme resistance phenotypes in all inoculated plants of B. oleracea var. botrytis and Raphanus sativus. Therefore, the overall resistance-breaking properties of 12.1 and 12.5 were restricted to B. napus. When isolates 12.1, 12.5, and WA-Ap1 and additional Australian isolate WA-EP1 were sequenced and complete genomes of each compared, 12.1 and 12.5 grouped separately from the other 2 and from all 23 Australian isolates with complete genomes sequenced previously. In addition, there was evidence for at least six separate TuMV introductions to Australia. Spread of this B. napus resistance-breaking strain poses a significant threat to the B. napus oilseed industry. Breeding B. napus cultivars with resistance to this strain constitutes a critical priority for B. napus breeding programs in Australia and elsewhere.
Publisher: Elsevier BV
Date: 2008
Publisher: Springer Science and Business Media LLC
Date: 24-12-2013
Publisher: Scientific Societies
Date: 09-2013
DOI: 10.1094/PDIS-03-13-0299-PDN
Abstract: Inspection of field plantings of erse cruciferous species, mainly oilseed varieties sown for agronomic assessment at Crawley, (31.99°S, 115.82°E), Western Australia, in September 2012, indicated the occurrence of extensive leaf and stem colonization by powdery mildew at the late flowering stage, with whitish patches 3 to 4 cm in length on stems of Brassica c estris var. pekinensis, B. carinata, B. oleracea var. capitata, B. rapa, Eruca sativa, and E. vesicaria. These patches coalesced to form a dense, white, powdery layer. Infected leaves showed signs of early senescence. Pathogenicity was demonstrated from transferring field inoculum from the most susceptible variety by pressing diseased leaves onto leaves of the six potted plant species, and incubating plants in a moist chamber for 48 hours post-inoculation (hpi) in an air-conditioned glasshouse approximating 25°C. Signs of powdery mildew were evident by 7 days post-inoculation (dpi), and well developed symptoms by 10 dpi and as observed in the field. Uninoculated control plants did not develop powdery mildew. On all inoculated species, abundant conidia typical of those produced by Erysiphe cruciferarum were observed, matching the descriptions of conidia given by Purnell and Sivanesan (3), with cylindrical conidia typically borne singly or in short chains. Mycelia were higenous, in patches, often spreading to become effused. Conidiophores were 3 to 4 cells, unbranched, and foot cells cylindrical. Across all host species, conidia were mostly produced singly with overall mean measured lengths 19.7 to 35.4 μm (mean 26.9 μm), and measured widths 7.1 to 12.9 μm (mean 9.7 μm), from measurements taken on 200 conidia for each of the six different species. Spore sizes measured approximated those found for E. cruciferarum by Kaur et al. (1) on B. juncea in Western Australia (viz. 21.2 to 35.4 × 8.8 to 15.9 μm), but were smaller than those reported by Purnell and Sivanesan (3) (viz. 30 to 40 × 12 to 16 μm) or by Koike and Saenz (1) (viz. 35 to 50 × 12 to 21 μm). We confirmed a length-to-width ratio (mean range 2.7 to 2.8 across all six species) as found by both Purnell and Sivanesan (3) and Koike and Saenz (2). Amplification of the internal transcribed spacer (ITS)1 and (ITS)2 regions flanking the 5.8S rRNA gene was carried out with universal primers ITS1 and ITS4 and PCR products from E. cruciferarum from B. oleracea var. capitata and B. rapa sequenced. BLAST analyses to compare sequences with those in GenBank showed a % nucleotide identity for E. cruciferarum. In Western Australia, E. cruciferarum has been recorded on B. napus var. napobrassica since 1971 (4), B. napus since 1986 (4), and on B. juncea since 2008 (1). In other regions of Australia, E. cruciferarum has been recorded on B. c estris, B. oleracea var. capitata, B. oleracea var. acephala, B. napus, B. napus var. naprobrassica, and B. rapa var. rapa. To the best of our knowledge, this is the first record of E. cruciferarum on B. c estris var. pekinensis, B. carinata, E. sativa, and E. vesicaria in Australia and on B. rapa and B. oleracea var. capitata in Western Australia. Powdery mildew epidemics on other brassicas in Western Australia are generally sporadic and it remains to be seen what the impact of this disease will be on these new host species. References: (1) P. Kaur et al. Plant Dis. 92:650, 2008. (2) S. T. Koike and G. S. Saenz. Plant Dis. 81:1093, 1997. (3) T. J. Purnell and A. Sivanesan. No. 251 in IMI Descriptions of Fungi and Bacteria, 1970. (4) R. G. Shivas. J. Royal Soc. West. Aust. 72:1, 1989.
Publisher: Scientific Societies
Date: 2015
DOI: 10.1094/PDIS-09-13-0964-RE
Abstract: Understanding combined abiotic (waterlogging) and biotic (Pythium spp.) stress resistance remains an important challenge to improving common bean (Phaseolus vulgaris) productivity in disease-prone regions with irregular but intensive rainfall patterns. This study documented the effects of timing (1, 3, 5, 7, and 9 days after sowing) and duration (3, 6, 12, and 24 h) of soil saturation (waterlogging) on d ing-off, as well as hypocotyl and root diseases of common bean caused by Pythium irregulare. There were significant effects of timing of waterlogging as well as the presence or absence of the pathogen on emergence of the three bean varieties tested namely, ‘Gourmet Delight’, ‘Brown Beauty’, and ‘Pioneer’. The interaction between time of waterlogging and variety was significant for both root and hypocotyl disease severities. In the presence of P. irregulare, waterlogging 1 day after sowing resulted in the least emergence (55.2 ± 5.6%), although plants that survived after 5 weeks had less hypocotyl and root disease (percent hypocotyl disease index [%HDI] ± standard deviation [SD] = 42.0 ± 2.1% and percent root disease index [%RDI] ± SD = 42.4 ± 2.1%, respectively) than nonwaterlogged plants (%HDI = 50.8 ± 2.1% and %RDI = 48.0 ± 2.1%, respectively). The most severe disease assessed 5 weeks after sowing occurred when plants were subjected to waterlogging 9 days after sowing (%HDI = 61.3 ± 2.1% and %RDI = 56.0 ± 2.1%). In general, both hypocotyl and root disease severity increased as the duration of waterlogging increased from 1 to 24 h, with %HDI increasing from 53.9 ± 3.2% to 70.9 ± 3.2%, while %RDI increased from 57.2 ± 1.5% to 73.7 ± 1.5%. Varieties responded differentially in terms of disease development after waterlogging, with the least hypocotyl and root disease on Gourmet Delight (%HDI = 51.4 ± 3.2 and %RDI = 60.1 ± 1.5, respectively) and greatest on Pioneer (%HDI = 66.2 ± 3.2 and %RDI = 64.9 ± 1.5, respectively). Despite being susceptible to hypocotyl and root disease, Pioneer had the greatest emergence and shoot dry weight overall among the three varieties, suggesting that this variety has a degree of tolerance to waterlogging, P. irregulare infection, and the combination of these two stresses. Although the resistance of Gourmet Delight could be exploited to breed bean varieties that exhibit less hypocotyl and root disease when waterlogging occurs, the tolerance to both P. irregulare infection and waterlogging observed for Pioneer could also be exploited to breed varieties that incur less damage from hypocotyl or root disease or waterlogging. Furthermore, this study demonstrated what appears to be independent resistance to hypocotyl versus root infection by P. irregulare, which offers an opportunity to combine resistance to both stresses to reduce the impact of d ing-off and root rot in conditions conducive for P. irregulare.
Publisher: CSIRO Publishing
Date: 2005
DOI: 10.1071/EA04150
Abstract: Fifty-seven genotypes, including 10 cultivars, of Trifolium subterraneum var. subterraneum and var. yanninicum were screened in the field for resistance to rust (Uromyces trifolii-repentis) using artificial inoculation. There was outstanding resistance among the var. yanninicum, types with all but 1 genotype showing no rust symptoms. Several var. subterraneum genotypes also showed only a low rust incidence (≤3.5 on a 0–10 scale) with little or no leaf collapse from rust infection, including 83S19–07, CPI 103906F, EP132Sub-E, 84S20–02, and 84S20–01. Several other lines had a significant incidence of rust, while little leaf collapse from the disease was evident. Several highly susceptible lines were identified, including cultivars Green Range, Seaton Park and York, all with 100% of leaves affected by rust and extensive leaf collapse. There was excellent positive correlation between rust incidence and leaf collapse across the genotypes tested (R2 = 0.91). The excellent rust resistance observed in the majority of var. yanninicum lines and the good resistance in some var. subterraneum lines, indicates that these are useful sources of resistance that can be exploited, either directly as new cultivars to minimise leaf collapse from this disease or as parents in breeding programmes to develop more rust-resistant cultivars.
Publisher: Frontiers Media SA
Date: 28-10-2020
Publisher: Informa UK Limited
Date: 03-07-2023
Publisher: American Society for Microbiology
Date: 15-03-2018
Abstract: Analysis of an RNA-Seq library from cucumber leaf RNA revealed the first complete genome sequence of Cucurbit aphid-borne yellows virus (CABYV) from Papua New Guinea. We compared it with 36 complete CABYV genomes from other world regions. It most resembled the genome of South Korean isolate GS6.
Publisher: Wiley
Date: 30-01-2015
DOI: 10.1111/PPA.12348
Publisher: Wiley
Date: 08-2021
DOI: 10.1111/PPA.13437
Abstract: Studies were undertaken to determine the combined environmental effects of two temperature regimes (14/11 ℃, 17/14 ℃ day/night) and duration of postinoculation high humidity on progression of white leaf spot, caused by Neopseudocercosporella capsellae , in rapeseed ( Brassica napus ) at each of two different plant growth stages. Overall, percentage disease indices were significantly affected by temperature, high humidity duration, plant growth stage, and host cultivar (all p 0.001). There were significant two‐way interactions of temperature regime with plant age ( p 0.001) and with host cultivar ( p 0.01), and significant three‐way interactions of high humidity duration with growth stage and host cultivar ( p = 0.01) and with temperature and host cultivar ( p = 0.03). At cotyledon stage, mean percentage cotyledon disease index was 38.2 at 17/14 ℃ day/night, and 33.1 at 14/11 ℃. At fourth leaf stage, mean percentage leaf disease index was 32.0 at 14/11 ℃ but 17.5 at 17/14 ℃. Disease severity increased with increasing duration of high humidity. Results explain why this disease is more prevalent and severe in Australia following longer durations of high humidity why disease at cotyledon stage is largely independent of temperature if seasonal temperature ranges between 11 and 17 ℃ and why more severe leaf infection (e.g., at fourth leaf stage) can be attributed to cooling winter conditions between autumn and winter. Studies suggest current redicted climate changes across southern Australia of increasingly warmer autumn‐winter temperatures and decreasing growing‐season (May–August) precipitation will lessen severity of future epidemics.
Publisher: Scientific Societies
Date: 04-2018
DOI: 10.1094/PDIS-08-17-1324-RE
Abstract: The viability of ascospores of the Phoma stem canker (blackleg) pathogen, Leptosphaeria maculans, was tested on a range of carrier materials, including metals, fabrics, woods, and plastics, and under different temperature conditions of 23 and 4, 36 and 14, and 45 and 15°C day and night, respectively. At 23 and 4°C (day and night, respectively), ascospores remained viable for up to 240 days on Tasmanian oak (Eucalyptus regnans) and pine wood (Pinus radiata). At 36 and 14°C (day and night, respectively), ascospores remained viable on pine wood for up to 180 days. At 45 and 15°C (day and night, respectively), ascospores remained viable up to 60 days on jute. There were also significant differences (P 0.001) between carrier materials in their abilities to retain ascospores following washing. At least 30% of intact ascospores recovered from inert carrier materials were able to germinate on artificial growth media within 48 h of recovery and some ascospores were still viable after 240 days. These findings confirm that L. maculans ascospores remain viable for a much longer time in the absence of a host than previously considered. This demonstrates the importance of inert materials as long-term and long-distance carriers of viable L. maculans ascospores, and highlights their potential role for spread of L. maculans races to new regions and countries via farming equipment, clothing, and other associated materials. Local, national, and international biosecurity agencies need to be aware that the risks of spread of ascomycete plant, animal, and human pathogens via inert materials are significantly greater than currently assessed.
Publisher: Scientific Societies
Date: 06-2014
DOI: 10.1094/PDIS-08-13-0806-RE
Abstract: Black spot (also referred to as Ascochyta blight, Ascochyta foot rot and black stem, and Ascochyta leaf and pod spot) is a devastating disease of pea (Pisum sativum) caused by one or more pathogenic fungi, including Didymella pinodes, Ascochyta pisi, and Phoma pinodella. Surveys were conducted across pea-growing regions of Western Australia in 1984, 1987, 1989, 1996, 2010, and 2012. In total, 1,872 fungal isolates were collected in association with pea black spot disease symptoms. Internal transcribed spacer regions from representative isolates, chosen based on morphology, were sequenced to aid in identification. In most years and locations, D. pinodes was the predominant pathogen in the black spot complex. From 1984 to 2012, four new pathogens associated with black spot symptoms on leaves or stems (P. koolunga, P. herbarum, Boeremia exigua var. exigua, and P. glomerata) were confirmed. This study is the first to confirm P. koolunga in association with pea black spot symptoms in field pea in Western Australia and show that, by 2012, it was widely present in new regions. In 2012, P. koolunga was more prevalent than D. pinodes in Northam and P. pinodella in Esperance. P. herbarum and B. exigua var. exigua were only recorded in 2010. Although A. pisi was reported in Western Australia in 1912 and again in 1968 and is commonly associated with pea black spot in other states of Australia and elsewhere, it was not recorded in Western Australia from 1984 to 2012. It is clear that the pathogen population associated with the pea black spot complex in Western Australia has been dynamic across time and geographic location. This poses a particular challenge to development of effective resistance against the black spot complex, because breeding programs are focused almost exclusively on resistance to D. pinodes, largely ignoring other major pathogens in the disease complex. Furthermore, development and deployment of effective host resistance or fungicides against just one or two of the pathogens in the disease complex could radically shift the make-up of the population toward pathogen species that are least challenged by the host resistance or fungicides, creating an evolving black spot complex that remains ahead of breeding and other management efforts.
Publisher: Elsevier BV
Date: 09-2015
Publisher: CSIRO Publishing
Date: 2004
DOI: 10.1071/EA03178
Abstract: Three different times of sowing in conjunction with various fungicide treatments were evaluated for the management of blackleg in canola (Brassica napus L.) variety Karoo. The trials were conducted at 4 different locations in Western Australia: East Chapman, Merredin, Wongan Hills and Mt Barker, representing a range of environmental conditions. The first time of sowing was at the break of the season followed by 2 subsequent sowings about 3 and 6 weeks later. Blackleg severity was significantly reduced by 14% when sowing was delayed until the end of June or early July, however, there were yield penalties due to the shortened growing season. Yield losses from blackleg were 16, 38 and 34% for mid-May, early to mid-June and end June to early July sown crops, respectively. All the fungicide treatments substantially reduced blackleg severity and increased yields at all the locations except for East Chapman (low rainfall site). The maximum protection fungicide treatment (Jockey seed dressing at 6.6 g a.i./kg seed + Impact in-furrow at 100 g a.i./ha + 3 foliar applications of flusilazole at 100 g a.i/ha) improved seed yield by 47, 56, 46 and 16% at Merredin, Wongan Hills and Mt Barker and East Chapman, respectively, compared with the nil treatment. Averaged over time of sowing and locations, the treatments of Jockey and Impact reduced disease severities by 20 and 25% and increased seed yields by 19 and 24%, respectively. There is potential for some other fungicide treatments, such as seed dressing with Jockey in combination with foliar application of either flusilazole or prochloraz, for the control of blackleg. These investigations suggest that damage from blackleg, in some areas during some seasons, could be minimised by sowing canola crops as early as possible before the onset of maturation of pseudothecia thus avoiding major ascospore showers at the seedling stage of maximum susceptibility. However, in case of a late break of season, fungicide protection may be essential to minimise losses from blackleg, particularly if sowing moderately susceptible cultivars under moderate to high disease pressure situations.
Publisher: Elsevier BV
Date: 07-2011
Publisher: Springer Science and Business Media LLC
Date: 03-02-2017
Publisher: CSIRO Publishing
Date: 13-07-2022
DOI: 10.1071/CP22098
Abstract: Context Studies of Phoma black stem and leaf spot disease (caused by Phoma medicaginis) in annual medics (Medicago spp.) normally involve a ‘once-only’ inoculation not reflecting multiple pathogen infection and phytoestrogen production cycles in the field. Phytoestrogen production by plants can result in lower ovulation rates in grazing animals. Aims We aimed to determine whether sequential infections by P. medicaginis increase production of phytoestrogens in annual medics, and to measure the genetic ersity of isolates. Methods In a greenhouse experiment, pathogenicity and virulence were investigated across 32 isolates of P. medicaginis following one, two or three rounds of inoculation of M. polymorpha var. brevispina. Production of the phytoestrogens coumestrol and 4′-O-methyl coumestrol was measured, and correlation with disease parameters assessed. DNA sequencing using ITS, β-tubulin, calmodulin and P. medicaginis-specific EFNI-1α was applied for phylogenetic analysis of isolates from Western Australia and elsewhere. Key results Across isolates, highest leaf disease incidence was 76%, petiole disease incidence 61%, leaf disease severity 52% and petiole disease severity 53%. Stem coumestrol content range was 45–1247 mg kg−1, and 4′-O-methyl coumestrol 0–344 mg kg−1. All measures were highest after three rounds of inoculation. Overall, there was a positive correlation of leaf disease incidence with coumestrol content (P 0.05) and of both leaf and petiole disease incidence with 4′-O-methylcoumestrol content (P 0.01, P 0.05, respectively). Phylogenetic analysis revealed a high degree of genetic similarity among Western Australian isolates, generally grouping into a single separate cluster across the four markers, and genetically distinct from isolates sourced outside Australia. Conclusions Leaf disease incidence was the best discriminating disease parameter for coumestrol and 4′-O-methylcoumestrol content. Western Australian isolates of P. medicaginis were genetically similar and unique, possibly due to geographic separation. Implications The study emphasised the importance of sequential inoculations when screening annual Medicago genotypes towards developing cultivars with superior disease resistance and enhanced animal reproductive outcomes.
Publisher: Springer Science and Business Media LLC
Date: 08-2012
Publisher: Wiley
Date: 04-12-2017
DOI: 10.1111/AAB.12324
Publisher: Springer Science and Business Media LLC
Date: 21-05-2021
Publisher: Wiley
Date: 09-11-2009
Publisher: CSIRO Publishing
Date: 2017
DOI: 10.1071/CP16098
Abstract: Subterranean clover (Trifolium subterraneum L.) is an important pasture legume in many regions of Australia, and elsewhere. A survey was undertaken in 2014 to define the levels of soilborne disease and associated pathogens in annual subterranean clover pastures across southern Australia. Most of the 202 s les processed had very severe levels of taproot rot disease (disease index 60–80%) and extremely severe lateral root rot disease (disease index 80–100%). A complex of soilborne root pathogens including Aphanomyces trifolii, Phytophthora clandestina, and one or more of Pythium, Rhizoctonia and Fusarium spp. was found responsible for severe pre- and post-emergence d ing-off and root disease. This is the first study to highlight the high incidence of A. trifolii across southern Australian pastures and the first to highlight the existence of natural synergistic associations in the field between Rhizoctonia and Pythium spp., Pythium and Fusarium spp., Pythium spp. and A. trifolii, and P. clandestina and A. trifolii. Nodulation was generally poor, mainly only in the 20–40% nodulation index range. There was no relationship between rainfall zone and tap or lateral root disease level, with root disease equally severe in lower (330 mm) and higher (1000 mm) rainfall zones. This dispels the previous belief that severe root disease in subterranean clover is an issue only in higher rainfall zones. Although overall the relationship between tap and lateral root disease was relatively weak, these two root-disease components were strongly positively expressed within each pathogen’s presence grouping, providing explanation for variability in this relationship across different field situations where soilborne root disease is a major problem. Most producers underestimated the levels and effect of root disease in their pastures. This study established that tap and lateral root diseases are widespread and severe, having devastating impact on the feed gap during autumn–early winter across southern Australia. Severe root disease was independent of the highly variable complex of soilborne pathogens associated with diseased roots, geographic location and rainfall zone. It is evident that soilborne root diseases are the primary factor responsible for widespread decline in subterranean clover productivity of pastures across southern Australia. Implications for disease management and options for extension are discussed.
Publisher: Scientific Societies
Date: 06-2010
Abstract: Studies on infection processes and gene expression were done to determine differential responses of cultivars of Trifolium subterraneum resistant and susceptible to infection by races of Phytophthora clandestina. In the infection process study, one race was inoculated onto the roots of T. subterraneum cvs. Woogenellup and Junee (compatible or incompatible interactions, respectively). There were no differences in relation to the processes of cyst attachment, germination, and hyphal penetration. There were, however, major differences in infection progression observed post-penetration between compatible and incompatible interactions. In susceptible cv. Woogenellup, hyphae grew into the vascular bundles and produced intercellular antheridia and oogonia in the cortex and stele by 4 days postinoculation (dpi), oospores in the cortex and stele by 8 dpi, when sporangia were evident on the surface of the root. Infected taproots were discolored. Early destruction of taproots prevented emergence of lateral roots. Roots of resistant cv. Junee showed no oospores or sporangia and no disease at 8 dpi. In the gene expression studies, two races of P. clandestina were inoculated onto three cultivars of T. subterraneum. Results showed that three genes known to be associated with plant defense against plant pathogens were differentially expressed in the roots during compatible and incompatible interactions. Phenylalanine ammonia lyase and chalcone synthase genes were activated 4 h postinoculation (hpi) and cytochrome P450 trans-cinnamic acid 4-monooxygenase gene was activated 8 hpi in the incompatible interactions in cvs. Denmark and Junee following inoculation with Race 177. In contrast, in compatible interactions in cv. Woogenellup, there were no significant changes in the activation of these three genes following inoculation, indicating that these three genes were associated with the expression of resistance to Race 177 of the pathogen by the host. To confirm this result, in the second test, cv. Woogenellup was challenged by Race 000 of P. clandestina. In this incompatible interaction, cv. Woogenellup was resistant and expressed highly all three genes in the manner similar to the incompatible interactions observed in the first test.
Publisher: Scientific Societies
Date: 2022
DOI: 10.1094/PDIS-04-21-0885-RE
Abstract: Sclerotinia sclerotiorum is a necrotrophic fungus causing devastating stem rot and associated yield losses of canola/rapeseed (Brassica napus) worldwide, including in Australia. Developing host resistance against Sclerotinia stem rot is critical if this disease in canola/rapeseed is to be successfully managed, as cultural or chemical control options provide only partial or sporadic control. Three B. napus breeding populations, C2, C5 and C6, including the parents, F 1 , F 2 , BC 1 P1, and BC 2 P2, were used in a field study with an objective of exploring the inheritance pattern of disease resistance (based on stem lesion length [SLL]) and the genetic relationships of disease with stem diameter (SD) or days to first flowering (DTF), and to compare these new adult plant stem resistances against S. sclerotiorum with those of seedling (cotyledon and leaf) resistances in earlier studies. Heritability (broad sense) of SLL was 0.57 and 0.73 for population C2 at 3 and 5 weeks postinoculation and 0.21 for population C5 at 5 weeks postinoculation. Additive genetic variance was evident within all 3 populations for DTF but not for SD. Narrow-sense heritability for DTF was 0.48 (C2), 0.42 (C5), and 0.32 (C6). SD, DTF, and SLL were all inherited independently, with no significant genetic covariance between traits in bivariate analysis. Genetic variance for SLL in populations C2 and C5 was entirely nonadditive, and there was significant nonadditive genetic covariance of SLL at 3 and 5 weeks postinoculation. Generation means analysis in population C2 supported the conclusion that complex epistatic interactions controlled SLL. Several C2 and C5 progeny showed high adult plant stem resistance, which may be critical in developing enhanced stem resistance in canola/rapeseed. Although population C6 showed no genetic variation for SLL resistance in this study, it showed significant nonadditive genetic variance at the cotyledon and leaf stages in earlier studies. We conclude that host resistance varies across different plant growth stages, and breeding must be targeted for resistance at each growth stage. In populations C2, C5, and C6, resistance to S. sclerotiorum in stem, leaf, and cotyledon was always controlled by nonadditive effects such as complex epistasis or dominance. Overall, our findings in relation to the quantitative inheritance of Sclerotinia stem rot resistance, together with the new high-level resistances identified, will enable breeders to select/develop genotypes with enhanced resistances to S. sclerotiorum.
Publisher: Springer Science and Business Media LLC
Date: 2008
DOI: 10.1071/AP08031
Publisher: Scientific Societies
Date: 03-2008
Abstract: Stem canker of crucifers is caused by an ascomycete species complex comprising of two main species, Leptosphaeria maculans and L. biglobosa. These are composed of at least seven distinct subclades based on biochemical data or on sequences of internal transcribed spacer (ITS), the mating type MAT1-2 or fragments of actin or β-tubulin genes. In the course of a wide-scale characterization of the race structure of L. maculans from Western Australia, a few isolates from two locations failed to lify specific sequences of L. maculans, i.e., the mating-type or minisatellite alleles. Based on both pathogenicity tests and ITS size, these isolates were classified as belonging to the L. biglobosa species. Parsimony and distance analyses performed on ITS, actin and β-tubulin sequences revealed that these isolates formed a new L. biglobosa subclade, more related to the Canadian L. biglobosa ‘canadensis’ subclade than to the L. biglobosa ‘australensis’ isolates previously described in Australia (Victoria). They are termed here as L. biglobosa ‘occiaustralensis’. These isolates were mainly recovered from resistant oilseed rape cultivars that included the Brassica rapa sp. sylvestris-derived resistance source, but not from the susceptible cv. Westar. The pathogenicity of L. biglobosa ‘occiaustralensis’ to cotyledons of most oilseed rape genotypes was higher than that of L. biglobosa ‘canadensis’ or L. biglobosa ‘australensis’ isolates.
Publisher: Springer Science and Business Media LLC
Date: 2009
DOI: 10.1071/AP09004
Publisher: Wiley
Date: 29-04-2016
DOI: 10.1111/JPH.12484
Publisher: CSIRO Publishing
Date: 2014
DOI: 10.1071/CP14117
Abstract: Foliar pathogens result in significant losses in herbage and seed yields and regeneration capacity in annual clover pastures, the last leading to their rapid deterioration and lack of persistence. The most important pathogens include Kabatiella caulivora (clover scorch), Cercospora zebrina (cercospora), Uromyces trifolii-repentis (rust), Erysiphe trifoliorum (powdery mildew), and Leptosphaerulina trifolii (pepper spot). Several other foliar pathogens on annual clovers, in particular Phoma medicaginis (black stem and leaf spot), one or more Stemphylium spp. (stemphylium leaf spot), Pseudopeziza trifolii (common leaf spot), Stagonospora spp. (stagonospora leaf spot), Colletotrichum trifolii (anthracnose) and Sclerotinia trifoliorum (sclerotinia), occur widely and together contribute to reduce productivity in some localities. Severe attack by the most important pathogens (e.g. K. caulivora, U. trifolii-repentis, E. trifoliorum) not only greatly reduces winter–spring pasture production but frequently also coincides with the critical feed shortage across autumn–winter, leading to significantly decreased autumn–winter biomass production in regenerating stands. Approaches to disease control include a range of management strategies. Wider utilisation of cultural and fungicidal control strategies offers producers greater management flexibility, particularly in conjunction with deployment of cultivars with useful resistance. Host resistance offers the greatest potential for delivering the most cost-effective and long-term control. Many of these foliar pathogens co-occur, magnifying losses this highlights the need for in idual host genotypes with resistance to multiple pathogens and unique geographic locations such as Sardinia offer enormous scope to select such clovers. Future research opportunities and critical priorities to improve management of foliar pathogens in annual clover pastures across southern Australia include the need to: (i) define pathogen strain–race structures, particularly for K. caulivora and U. trifolii-repentis, and determine associated host resistances against specific strains–races to allow strategic deployment of host resistances (ii) define relative resistances to major fungal foliar pathogens of all parental and near-release breeding genotypes and all commercial cultivars across important annual clover species (iii) identify new sources of host resistance, particularly genotypes with cross-resistance to multiple pathogens, for breeders to utilise (iv) identify and demonstrate the benefits to farmers of effective cultural (e.g. grazing, removal of infested residues) and fungicidal control options that allow greater management flexibility to reduce the impact of fungal foliar diseases and (v) determine current incidences and impacts (losses and economic importance) of major fungal foliar diseases in the different agro-climatic regions across southern Australia. Failure to address these critical issues leaves livestock industries carrying the risks from release of new varieties of unknown susceptibilities to one or more of the major foliar diseases, and the risks from continued use of older varieties exposed to new pathogen races with few if any flexible management options during periods of critical feed shortage and without the basic information on current disease impacts that is needed to make sensible management and funding decisions.
Publisher: Wiley
Date: 21-02-2010
Publisher: Oxford University Press (OUP)
Date: 13-03-2006
DOI: 10.1093/AOB/MCL062
Publisher: Scientific Societies
Date: 11-2019
DOI: 10.1094/PDIS-03-19-0664-RE
Abstract: Sclerotinia sclerotiorum and Leptosphaeria maculans are two of the most important pathogens of many cruciferous crops. The reaction of 30 genotypes of Camelina sativa (false flax) was determined against both pathogens. C. sativa genotypes were inoculated at seedling and adult stages with two pathotypes of S. sclerotiorum, highly virulent MBRS-1 and less virulent WW-1. There were significant differences (P 0.001) among genotypes, between pathotypes, and a significant interaction between genotypes and pathotypes in relation to percent cotyledon disease index (% CDI) and stem lesion length. Genotypes 370 (% CDI 20.5, stem lesion length 1.8 cm) and 253 (% CDI 24.8, stem lesion length 1.4 cm) not only consistently exhibited cotyledon and stem resistance, in contrast to susceptible genotype 2305 (% CDI 37.7, stem lesion length 7.2 cm), but their resistance was independent to S. sclerotiorum pathotype. A F 5 -recombinant inbred line population was developed from genotypes 370 × 2305 and responses characterized. Low broad-sense heritability indicated a complex pattern of inheritance of resistance to S. sclerotiorum. Six isolates of L. maculans, covering combinations of five different avirulent loci (i.e., five different races), were tested on C. sativa cotyledons across two experiments. There was a high level of resistance, with % CDI 17, and including development of a hypersensitive reaction. This is the first report of variable reaction of C. sativa to different races of L. maculans and the first demonstrating comparative reactions of C. sativa to S. sclerotiorum and L. maculans. This study not only provides new understanding of these comparative resistances in C. sativa, but highlights their potential as new sources of resistance, both for crucifer disease-resistance breeding in general and to enable broader adoption of C. sativa as a more sustainable oilseed crop in its own right.
Publisher: Springer Science and Business Media LLC
Date: 08-12-2011
Publisher: Oxford University Press (OUP)
Date: 07-10-2010
DOI: 10.1093/AOB/MCQ196
Publisher: Wiley
Date: 02-10-2011
Publisher: Scientific Societies
Date: 03-2018
DOI: 10.1094/PDIS-08-17-1156-RE
Abstract: Sweet potato feathery mottle virus (SPFMV) and Sweet potato virus C (SPVC) isolates from sweetpotato were studied to examine genetic connectivity between viruses from Australia and Southeast Asia. East Timorese s les from sweetpotato were sent to Australia on FTA cards. Shoot and tuberous root s les were collected in Australia and planted in the glasshouse, and scions were graft inoculated to Ipomoea setosa plants. Symptoms in infected sweetpotato and I. setosa plants were recorded. RNA extracts from FTA cards and I. setosa leaf s les were subjected to high-throughput sequencing (HTS). Complete genomic sequences (CS) of SPFMV and SPVC (11 each) were obtained by HTS, and coat protein (CP) genes from them were compared with others from GenBank. SPFMV sequences clustered into two major phylogroups (A and B = RC) and two minor phylogroups (EA[I] and O[II]) within A East Timorese sequences were in EA(I) and O(II), whereas Australian sequences were in O(II) and B(RC). With SPVC, CP trees provided sufficient ersity to distinguish major phylogroups A and B and six minor phylogroups within A (I to VI) East Timorese sequences were in minor phylogroup I, whereas Australian sequences were in minor phylogroups II and VI and in major phylogroup B. With SPFMV, Aus13B grouped with East Timorese sequence TM64B within minor phylogroup O, giving nucleotide sequence identities of 97.4% (CS) and 98.3% (CP). However, the closest match with an Australian sequence was the 97.6% (CS) and 98.7% (CP) nucleotide identity between Aus13B and an Argentinian sequence. With SPVC, closest nucleotide identity matches between Australian and East Timorese sequences were 94.1% with Aus6a and TM68A (CS) and 96.3% with Aus55-4C and TM64A (CP) however neither pair member belonged to the same minor phylogroup. Also, the closest Australian match was 99.1% (CP) nucleotide identity between Aus4C and New Zealand isolate NZ4-4. These first complete genome sequences of SPFMV and SPVC from sweetpotato plantings in the Australian continent and neighboring Southeast Asia suggest at least two (SPFMV) and three (SPVC) separate introductions to Australia since agriculture commenced more than two centuries ago. These findings have major implications for both healthy stock programs and biosecurity management in relation to pathogen entry into Australia and elsewhere.
Publisher: Wiley
Date: 15-05-2016
DOI: 10.1111/PPA.12402
Publisher: Wiley
Date: 11-03-2009
Publisher: Springer Science and Business Media LLC
Date: 2008
DOI: 10.1071/AP08022
Publisher: Public Library of Science (PLoS)
Date: 18-02-2010
Publisher: Springer Science and Business Media LLC
Date: 22-12-2018
Publisher: Wiley
Date: 21-11-2016
DOI: 10.1111/JPH.12456
Publisher: Springer Science and Business Media LLC
Date: 20-01-2016
Publisher: Scientific Societies
Date: 09-2022
DOI: 10.1094/PDIS-11-21-2576-RE
Abstract: Recent morphological and molecular studies confirmed Physoderma viciae, and not Olpidium viciae, to be the causative agent of the devastating Faba Bean Gall (FBG) disease on faba bean (Vicia faba) in Ethiopia and also highlighted its ability to cross-infect with other host genera such as Pisum and Trifolium. In this study, the first pair of specific primer ‘Physo 1’ and primer pair ‘Physo D’ are reported from molecular sequences of this pathogen from the conserved LSU (S28) gene. Whereas ‘Physo 1’ readily detects P. viciae, ‘Physo D’, clearly separates its identity from the common and confounding presence of Didymella/Phoma spp. The study also reports the presence of the Ascochyta blight pathogen complex, symptomless but almost universal on field pea (Pisum sativum), within faba bean infested by P. viciae. We emphasize historical evidence confirming such unique association in other legumes, such as the subterranean clover (Trifolium subterraneum). This new finding has significant implications for rotations involving different legume crop and/or forage legume genera and possibly provides the first explanation for the widespread occurrence of the field pea Ascochyta blight pathogen complex even in the absence of field pea cropping for many years.
Publisher: Public Library of Science (PLoS)
Date: 11-06-2013
Publisher: Wiley
Date: 21-04-2016
DOI: 10.1111/PPA.12533
Publisher: Frontiers Media SA
Date: 06-11-2017
Publisher: CSIRO Publishing
Date: 2018
DOI: 10.1071/CP17161
Abstract: Brassica napus (rapeseed, canola) is an important oilseed crop worldwide as well as a recent agricultural hybrid species, resulting from crosses between progenitor B. rapa (turnip) and B. oleracea (cabbage) species in the last few thousand years. No wild form of B. napus is known to exist, making B. napus an interesting model for studies of genetic and genomic evolution in a polyploid under agricultural selective pressure. We generated genotype (Illumina Infinium 60K Brassica array) and phenotype data for elite spring-type B. napus lines from Australia, China and India (only one line). Phenotypically, plant growth, silique development and flowering traits were more likely to differentiate Chinese germplasm, whereas resistance to blackleg disease, secondary branching and seed traits were more likely to differentiate Australian germplasm. Genetic differentiation between the Australian and Chinese populations was low (FST = 0.035). Genetic relationship was not a predictor of similarity in yield traits between lines. Presence–absence variants were detected across the population: variants shared by at least three lines were present in every chromosome in the B. napus genome, and large missing chromosome segments ( Mbp) putatively due to A–C genome translocations were observed on chromosomes A7, A10, C1, C2, C6, C8 and C9. Our results highlight that widespread presence–absence variation is usual in B. napus, and may suggest that phenotypic and genetic ersity are not closely linked within spring-type B. napus from Australia and China, although the low s le numbers in our study prevent strong conclusions. We propose that inbreeding and low levels of genetic ersity, coupled with exchanges between the A and C genomes, were major driving forces behind genome evolution in this recent agricultural crop species.
Publisher: Wiley
Date: 12-01-2017
DOI: 10.1111/PPA.12655
Publisher: Frontiers Media SA
Date: 14-11-2017
Publisher: Elsevier BV
Date: 08-2023
Publisher: Wiley
Date: 07-11-2022
DOI: 10.1111/PPA.13506
Abstract: White leaf spot ( Neopseudocercosporella capsellae ), Alternaria leaf spot ( Alternaria brassicae ), blackleg ( Leptosphaeria maculans ), and downy mildew ( Hyaloperonospora brassicae ) commonly co‐occur on rapeseed ( Brassica napus ). In controlled environment studies, the synergistic/antagonistic interactions between these four pathogens were determined using two cultivars (Surpass 400, Thunder TT) with contrasting susceptibilities/resistances towards these pathogens. A spectrum of significant ( p 0.001) contrasting synergistic/antagonistic interactions between the four pathogens was observed and specific pathogen–pathogen interaction outcomes were determined by sequence of inoculation of different pathogens on each cultivar. On Thunder TT, Alternaria leaf spot was more severe ( p 0.001) when A . brassicae was applied prior to N . capsellae , but was reduced ( p 0.001) when A . brassicae was applied following N . capsellae . On Surpass 400, Alternaria leaf spot was enhanced ( p 0.001) when A . brassicae was applied following N . capsellae . For interactions involving H . brassicae on Thunder TT, downy mildew was reduced ( p 0.001) when co‐inoculated with N . capsellae , A . brassicae , or L . maculans , irrespective of co‐inoculating pathogen application sequence. This study highlights how disease severity of one or more co‐occurring pathogens is enhanced/decreased in the presence of other co‐occurring pathogens and emphasizes the importance of both pathogen inoculation sequence and relative host plant resistances/susceptibilities to different pathogens in together determining the total disease burden from these co‐occurring rapeseed diseases. Clearly, there is a need for rapeseed germplasm selection and breeding programmes to seriously consider the implications of co‐occurring pathogen complexes rather than solely relying upon single‐pathogen screening tests.
Publisher: Elsevier BV
Date: 06-2023
Publisher: Springer Science and Business Media LLC
Date: 2006
DOI: 10.1071/AP06075
Publisher: Scientific Societies
Date: 06-2020
DOI: 10.1094/PDIS-10-19-2251-RE
Abstract: Recent surveys of canola (Brassica napus) crops across southern Australia highlighted that Alternaria leaf spot on canola is not solely caused by Alternaria brassicae but that other Alternaria spp. are also involved, including A. japonica. Studies were undertaken into the effects of different temperatures (14 and 10°C [day and night] or 22 and 17°C [day and night]) on development of Alternaria leaf spot caused by A. japonica as compared with A. brassicae in cotyledons (embryonic leaves) and true leaves (first leaves) of canola (B. napus ‘Thunder TT’) and mustard rape (B. juncea ‘Dune’). Both pathogens expressed less disease at lower temperatures of 14 and 10°C with percent disease index (%DI) of 19.1 for A. japonica and 41.8 for A. brassicae, but expressed significantly more disease at higher temperatures of 22 and 17°C with %DI of 80.8 and 88.2 for the same pathogens, respectively. At 14 and 10°C, mustard rape cotyledons showed less disease (percent cotyledons disease index [%CDI] = 18.1) from A. japonica but showed more disease (%CDI = 75.0) from A. brassicae. However, at 22 and 17°C, cotyledons and true leaves of both canola and mustard rape showed significantly more disease and varied in expressing the disease severity to the two pathogens true leaves of mustard rape showed less disease (percent true leaf disease index [%TDI] = 48.4) from A. japonica but showed more disease (%TDI = 92.0) from A. brassicae. At 22 and 17°C, cotyledons of canola expressed more disease from A. japonica (%CDI = 99.1) than from A. brassicae (%CDI = 70.7). At the lower temperature, both host species showed the least disease, with mean %DI of 27.3 and 33.5 for canola and mustard rape, respectively, as compared with the higher temperatures, where there was a greater DI, with %DI values of 87.9 and 81.2 for these same host species, respectively. We believe that these are the first studies to highlight the critical role played by temperature for A. japonica as compared with A. brassicae in Alternaria leaf spot disease development and severity. These findings explain how temperature affects Alternaria leaf spot severity caused by A. japonica as compared with A. brassicae on different foliage components of canola and mustard rape.
Publisher: Springer Science and Business Media LLC
Date: 12-11-2020
DOI: 10.1038/S41598-020-76788-7
Abstract: Rotating crop cultivars with different resistance genes could slow the evolution of virulent strains of fungal pathogens, but could also produce highly virulent pathogen strains. We present a new model that links polycyclic pathogen epidemiology and population genetics in order to predict how different strategies of rotating cultivars with different resistances will affect the evolution of pathogen virulence and the breakdown of crop resistance. We modelled a situation where there were four different resistance genes that can be deployed within each crop cultivar, and four virulence genes that may be present within the pathogen. We simulated four different rotational management strategies: (i) no rotation (ii) a different gene every year (iii) a different gene every 5 years and (iv) a different combination of two stacked genes each year. Results indicate that rotating cultivars can lead to longer periods of disease suppression but also to the selection of highly virulent strains. The efficacy and relative advantage of different resistant cultivar rotation strategies depended on the fitness penalties, initial virulence allele frequencies, and ability of non-virulent pathogen genotypes to grow and reproduce on resistant cultivars. By capturing the essential processes involved, our model provides a useful new tool for investigating the evolutionary dynamics of pathogen virulence and crop resistance breakdown.
Publisher: Springer Science and Business Media LLC
Date: 2007
DOI: 10.1071/AP07048
Publisher: Scientific Societies
Date: 09-2003
DOI: 10.1094/PHYTO.2003.93.9.1073
Abstract: A simple model has been developed to predict the onset of pseudothecia maturity and seasonal ascospore showers in relation to blackleg disease in canola, caused by the fungus Leptosphaeria maculans. The model considers a combination of two weather factors, daily mean temperature and daily total rainfall, to drive progress of maturity of pseudothecia on the infested canola stubble left from past crops. Each day is categorized as suitable or not suitable for progress of the maturation process. The onset of pseudothecia maturity occurs when approximately 43 suitable days have occurred. Following the onset of maturity, ascospore showers are triggered when daily rainfall exceeds a threshold. The model satisfactorily predicted the timing of the onset of pseudothecia maturity when tested with 3 years of field observations at four locations in Western Australia, which characteristically has a Mediterranean climate. The model also agreed reasonably well with the daily pattern of ascospore release observed in two locations. Sensitivity analysis was performed to show the relative importance of the parameters that describe the onset of pseudothecia maturity.
Publisher: Elsevier BV
Date: 06-2012
Publisher: Springer Science and Business Media LLC
Date: 27-10-2017
Publisher: CSIRO Publishing
Date: 2002
DOI: 10.1071/AR01010
Abstract: The efficacy of the fungicide Impact® (a.i. flutriafol at 250 g/L) was tested for control of blackleg (Leptosphaeria maculans), and for improved yield and oil content in canola (Brassica napus) cultivars with varying levels of blackleg resistance. Field trials were conducted in 1996 in Western Australia at 3 locations (Merredin, Wongan Hills, Mt Barker) in paddocks containing 1–4-year-old blackleg-infested residues. The fungicide (400 mL product/ha) was coated on a double superphosphate fertiliser and applied at seeding. Blackleg was substantially reduced and the seed yield improved following the application of Impact® in most treatments at all locations except Mt Barker, where the fungicide had no effect on reducing the blackleg severity. The percentage reduction in blackleg severity with Impact® ranged between 18 and 59% and 1 and 43% at Merredin and Wongan Hills, respectively, in cultivars with different levels of resistance and exposed to infected residues of various ages. Likewise, the application of Impact® increased the seed yield by 40–322, 186–357, and 71–426 kg/ha at Merredin, Wongan Hills, and Mt Barker, respectively, on residue of various ages. Seed oil content was also improved following the application of Impact® in most treatments at all locations. The improvement in seed yield when using Impact® was variable for different ages of the residue, and was greater under severe to moderate disease conditions caused by exposure to more recent residues than under the milder disease conditions resulting from older residues. In general, susceptible to moderately resistant cultivars showed greater improvement in yield than resistant cultivars. The rates of Impact® were further evaluated in paddocks containing 3-year-old residue in field trials at the same 3 locations during 1997. The fungicide was applied at 200, 400, and 800 mL product/ha. Although blackleg severity was substantially reduced following application of Impact® at 400 and 800 mL/ha compared with 0 and 200 mL/ha, yield was improved only in some cultivars and at some locations.
Publisher: Wiley
Date: 07-10-2019
DOI: 10.1111/PPA.13084
Publisher: Scientific Societies
Date: 11-2015
DOI: 10.1094/PDIS-12-14-1297-RE
Abstract: Camelina sativa (L.) Crantz. has been proposed as a novel source of oilseed resistance to Sclerotinia rot (SR causal agent Sclerotinia sclerotiorum (Lib.) de Bary). To assess factors likely important in determining the level of resistance to this pathogen, 30 erse C. sativa genotypes were evaluated using a cotyledon test under controlled environmental conditions. Confirmed cotyledon SR-resistant (CS370) and SR-susceptible (CS2305) genotypes were assessed for camalexin production across time following inoculation at the 1-month vegetative stage of growth. There were significant differences among C. sativa genotypes in response to inoculation with S. sclerotiorum in terms of percent cotyledon disease index (%CDI), with the mean %CDI ranging from 30.9 to 69.4% across germplasm and confirmation screening, respectively. Genotype CS370 consistently showed low %CDI indicating high level of resistance to S. sclerotiorum, whereas CS2305 showed the highest %CDI value. These findings highlight the potential to develop highly SR-resistant cultivars of C. sativa by selection. Furthermore, liquid chromatographic analysis of leaves for both SR-resistant and SR-susceptible genotypes demonstrated that camalexin was produced when inoculated with S. sclerotiorum. However, camalexin production was not linked with disease severity in either genotype, indicating that SR resistance in C. sativa is independent of the level of camalexin production.
Publisher: Scientific Societies
Date: 05-2012
DOI: 10.1094/PDIS-12-11-1040-PDN
Abstract: Tedera (Bituminaria bituminosa (L.) C.H. Stirton var. albomarginata) has been successfully established across the mixed-farming (wheat-sheep) region of Western Australia because this species has remarkable drought tolerance and can survive the dry-summer period with strong retention of green leaf. A leaf spot symptom involving pale brown lesions with distinct dark brown margins had been observed in genetic evaluation plots of tedera at Medina and Mount Barker, Western Australia, and a Phoma sp. was isolated. Single-spore isolations of a typical Phoma sp. isolate were made onto potato dextrose agar and maintained at 20°C, and a representative culture has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13435). Amplification of the internal transcribed spacer (ITS) 1 and ITS2 regions flanking the 5.8S rRNA gene were carried out with universal primers ITS1 and ITS4 according to published protocol (3). The DNA PCR products were sequenced and BLAST analyses was used to compare sequences with those in GenBank. The sequence had 99% nucleotide identity with the corresponding sequence in GenBank for Phoma herbarum. Isolates also showed morphological (e.g., 1) and molecular (e.g., 2) similarities with P. herbarum as described in other reports. The relevant sequence information for a representative isolate has been lodged in GenBank (Accession No. JQ282910). A conidial suspension of 10 7 conidia ml –1 from a single-spore culture was spray inoculated onto foliage of 6-week-old tedera plants maintained under % relative humidity conditions for 72-h postinoculation. Symptoms evident by 10 days postinoculation consisted of pale brown lesions, mostly 1.5 to 4 mm in diameter, which developed a distinct, dark brown margin. Occasional lesions also showed a distinct chlorotic halo extending 1 to 1.5 mm outside the boundary of the lesion. Infection studies were successfully repeated twice and P. herbarum was readily reisolated from infected foliage. No disease was observed on and no P. herbarum were isolated from water-inoculated control plants. Except for a recent published report of P. herbarum on field pea (Pisum sativum L.) (2), this pathogen has only been noted in the Australian Plant Pest Database as occurring on lucerne (Medicago sativa L.) and soybean (Glycine max (L.) Merr.) in Western Australia in 1985 and on a Protea sp. in 1991. To our knowledge, this is the first published report of P. herbarum as a pathogen on tedera in Australia or elsewhere. That P. herbarum occurs on other hosts in Australia and has a wide host range elsewhere together suggest its potential to be a pathogen on a wider range of host genera and species. References: (1) G. L. Kinsey. No. 1501 in: IMI Descriptions of Fungi and Bacteria. 2002. (2) Y. P. Li et al. Plant Dis. 95:1590, 2011. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.
Publisher: CSIRO Publishing
Date: 2016
DOI: 10.1071/CP15312
Abstract: Yellow spot (caused by Pyrenophora tritici-repentis) is a major foliar disease in wheat (Triticum aestivum) that has become more serious in recent years, possibly because of climate change. A major quantitative trait locus (QTL) located on the short arm of wheat chromosome 2B explaining 30–40% of the phenotypic variance has been identified as responsible for resistance to Australian yellow spot isolates, which reportedly produce mostly the ToxA effector. The closest marker linked to this QTL was a DArT marker not easy to use in large-scale selections, whereas the closest PCR-based marker available (2.7 cM) was too far away for reliably tagging the locus in wheat breeding. We therefore undertook studies to develop more closely linked and user-friendly markers for this major QTL. Forty-one new markers either synthesised from DArT markers or identified from the GrainGene database were assessed. From these, we developed a new PCR-based marker (Rfsts1), located 0.3 cM away from the major QTL. This is the first suitable marker for marker-assisted selection for yellow spot resistance in Australian wheat-breeding programs.
Publisher: Scientific Societies
Date: 11-2021
DOI: 10.1094/PDIS-03-21-0534-RE
Abstract: Potato virus Y (PVY) disrupts healthy seed potato production and causes tuber yield and quality losses globally. Its sub isions consist of strain groups defined by potato hypersensitive resistance (HR) genes and whether necrosis occurs in tobacco, and phylogroups defined by sequencing. When PVY isolate PP was inoculated to potato cultivar differentials with HR genes, the HR phenotype pattern obtained resembled that caused by strain group PVY D isolate KIP1. A complete genome of isolate PP was obtained by high-throughput sequencing. After removal of its short terminal recombinant segment, it was subjected to phylogenetic analysis together with 30 complete nonrecombinant PVY genomes. It fitted within the same minor phylogroup PVY O3 subclade as KIP1. Putative HR gene Nd was proposed previously to explain the unique HR phenotype pattern that developed when differential cultivars were inoculated with PVY D . However, an alternative explanation was that PVY D elicits HR with HR genes Nc and Ny instead. To establish which gene(s) it elicits, isolates KIP1 and PP were inoculated to F 1 potato seedlings from (i) crossing ‘Kipfler’ and ‘White Rose’ with ‘Ruby Lou’ and (ii) self-pollinated ‘Desiree’ and ‘Ruby Lou’, where ‘Kipfler’ is susceptible (S) but ‘White Rose’, ‘Desiree’, and ‘Ruby Lou’ develop HR. With both isolates, the HR:S segregation ratios obtained fitted 5:1 for ‘Kipfler’ × ‘Ruby Lou’, 11:1 for ‘White Rose’ × ‘Ruby Lou’, and 3:1 for ‘Desiree’. Those for ‘Ruby Lou’ were 68:1 (isolate PP) and 52:0 (isolate KIP1). Because potato is tetraploid, these ratios suggest PVY D elicits HR with Ny from ‘Ruby Lou’ (duplex condition) and ‘Desiree’ (simplex condition) and Nc from ‘White Rose’ (simplex condition) but provide no evidence that Nd exists. Therefore, our differential cultivar inoculations and inheritance studies highlight that PVY D isolates elicit an HR phenotype in potato cultivars with either of two HR genes Nc or Ny, so putative gene Nd can be discounted. Moreover, phylogenetic analysis placed isolate PP within the same minor phylogroup PVY O3 subclade as KIP1, which constitutes the most basal ergence within overall major phylogroup PVY O .
Start Date: 12-2005
End Date: 03-2009
Amount: $188,400.00
Funder: Australian Research Council
View Funded ActivityStart Date: 03-2011
End Date: 03-2014
Amount: $360,000.00
Funder: Australian Research Council
View Funded ActivityStart Date: 12-2005
End Date: 07-2009
Amount: $87,444.00
Funder: Australian Research Council
View Funded ActivityStart Date: 01-2009
End Date: 07-2012
Amount: $600,000.00
Funder: Australian Research Council
View Funded ActivityStart Date: 11-2006
End Date: 12-2009
Amount: $220,000.00
Funder: Australian Research Council
View Funded ActivityStart Date: 05-2007
End Date: 05-2010
Amount: $270,000.00
Funder: Australian Research Council
View Funded Activity