ORCID Profile
0000-0003-2006-5277
Current Organisations
Royal College of Pathologists of Australasia
,
Royal Australasian College of Physicians
,
Northern Territory Government
,
University of Melbourne Melbourne Medical School
Does something not look right? The information on this page has been harvested from data sources that may not be up to date. We continue to work with information providers to improve coverage and quality. To report an issue, use the Feedback Form.
Publisher: Oxford University Press (OUP)
Date: 16-03-2020
DOI: 10.1093/OFID/OFAA090
Abstract: Tropical Australia has a high incidence of nocardiosis, with high rates of intrinsic antimicrobial resistance. Linezolid, the only antimicrobial to which all local Nocardia species are susceptible, has been recommended in empirical combination treatment regimens for moderate–severe Nocardia infections at Royal Darwin Hospital (RDH) since 2014. We report the safety and efficacy of linezolid use for nocardiosis in this setting. We identified cases through a retrospective review of all RDH Nocardia isolates from December 2014 to August 2018 and included 5 linezolid-treated cases from a previous cohort. Laboratory, demographic, and clinical data were included in the primary analysis of safety and treatment outcomes. Between 2014 and 2018, Nocardia was isolated from 35 in iduals 28 (80%) had clinically significant infection and 23 (82%) received treatment. All isolates were linezolid-susceptible. Safety and efficacy were assessed for 20 patients receiving linezolid-containing regimens and 8 receiving nonlinezolid regimens. Median linezolid induction therapy duration was 28 days. Common adverse effects in those receiving linezolid were thrombocytopenia (45%) and anemia (40%). Adverse events prompted discontinuation of trimethoprim-sulfamethoxazole more often than linezolid (40% vs 20%). Linezolid therapeutic drug monitoring was used in 1 patient, with successful dose reduction and outcome. There was no difference in 30-day survival between those treated with linezolid (90%) vs no linezolid (87%). One Nocardia-attributed death occurred during linezolid therapy. Linezolid is safe and efficacious in empirical treatment for moderate to severe nocardiosis in a monitored hospital setting, with 100% drug susceptibility and no difference in adverse events or outcomes compared with nonlinezolid regimens.
Publisher: Oxford University Press (OUP)
Date: 02-1996
DOI: 10.1111/J.1574-6968.1996.TB08040.X
Abstract: Dermatophytes such as Trichophyton species are common human pathogens, the infection of which results in dermatophytosis (also known as ringworm). Several laboratory tests are used routinely for the diagnosis of dermatophytosis, but they are either slow or lacking specificity. Through examination of genomic DNA from Trichophyton dermatophytes and other fungi in arbitrarily primed PCR, it was shown that a random primer 5'-ACCCGACCTG-3' produced bands of 4.3 kb, 1.9 kb, 1.7 kb and 0.7 kb in T. rubrum DNA, bands of 2.5 kb, 1.9 kb and 0.8 kb in T. mentagrophytes var. interdigitale and T. mentagrophytes var. mentagrophytes DNA, and bands of 2.5 kb, 1.9 kb, 1.5 kb and 0.9 kb in T. tonsurans DNA. This primer lified bands of different sizes in other fungal DNA. Therefore, based on the distinct band patterns observed in arbitrarily primed PCR using this primer, T. rubrum, T. mentagrophytes and T. tonsurans dermatophytes could be rapidly differentiated.
Publisher: MDPI AG
Date: 19-06-2017
Publisher: MDPI AG
Date: 11-06-2018
DOI: 10.3390/V10060319
Publisher: Future Medicine Ltd
Date: 09-2018
Abstract: Aim: To develop a probe-based triplex quantitative real-time PCR assay to simultaneously detect the upregulation of the efflux pumps AmrAB–OprA, BpeAB–OprB and BpeEF–OprC in Burkholderia pseudomallei strains exhibiting increased minimum inhibitory concentrations toward meropenem, doxycycline or trimethoprim-sulfamethoxazole. Methods: The triplex assay was developed and subsequently tested on RNA isolated from eight clinical and eight laboratory-generated B. pseudomallei mutants harboring efflux pump regulator mutations. Results: The triplex assay accurately detected efflux pump upregulation in all clinical and laboratory mutants, which corresponded with decreased antibiotic susceptibility or antibiotic resistance. Conclusion: Rapid detection of antibiotic resistance provides clinicians with a tool to identify potential treatment failure in near real time, enabling informed alteration of treatment during an infection and improved patient outcomes.
Publisher: Wiley
Date: 27-09-2016
DOI: 10.1111/JPC.13303
Abstract: To determine the prevalence of respiratory syncytial virus (RSV) in the Top End of the Northern Territory and investigate potential drivers of seasonality including rainfall and humidex (humidity and heat index). We performed a retrospective audit of laboratory confirmed cases of RSV from January 2012 to August 2014. Demographic details including age, sex and ethnicity were examined. RSV cases were correlated with monthly rainfall and humidex. There were 272 positive isolates detected from 4305 clinical s les (positivity rate 6.3%). The majority of cases occurred in children <12 months (n = 151, 55.5%), with a higher burden of disease seen in Indigenous compared to non-Indigenous infants in this age category (P < 0.005). The prevalence of RSV in the 0-5 years age category was 58/10 000 children per annum. Indigenous patients had higher prevalence rates (88.8/10 000 population per annum) and younger onset of infection (7.5 months Interquartile range (IQR) 3-19 months compared to 13 months for non-Indigenous children IQR 5 months to 2.4 years). RSV cases correlated most strongly with rainfall in the preceding month (r = 0.72). The Top End of the Northern Territory has a distinct RSV season that correlates with rainfall and humidex, which differs from Southern Australian disease patterns.
Publisher: Microbiology Society
Date: 06-2000
DOI: 10.1099/0022-1317-49-6-493
Abstract: Infection of the keratinised tissues (skin, hair and nails) in man and animals by keratinophilic fungi (dermatophytes) results in dermatophytosis (also known as tinea or ringworm). As conventional laboratory procedures for the identification of dermatophytes are either slow or lack specificity, improved diagnostic methods are required. The application of nucleic acid lification technology has made rapid and precise identification of dermatophytes possible. Recent studies have shown that when one of the four random primers (OPAA11, OPD18, OPAA17 and OPU15) was used in arbitrarily primed PCR (AP-PCR), up to 20 of the 25 dermatophyte species or subspecies under investigation could be distinguished on the basis of characteristic band patterns detected in agarose gel electrophoresis. A combination of two random primers (OPD18 and OPAA17) used in separate reaction tubes identified 23 of the 25 dermatophyte species or subspecies examined. AP-PCR provides a rapid and practical tool for identification of dermatophyte isolates that is independent of morphological and biochemical characteristics and thus enhances laboratory diagnosis of dermatophytosis.
Publisher: Oxford University Press (OUP)
Date: 2016
DOI: 10.1093/OFID/OFW208
Abstract: Nocardia is an opportunistic pathogen that can cause life-threatening disease. We aimed to characterize the epidemiological, microbiological, and clinical features of nocardiosis in the tropical north of Australia. We conducted a retrospective cohort study of nocardiosis diagnosed between 1997 and 2014. Population-based incidences were calculated using district population data. Clinically significant nocardiosis was identified in 61 patients. The unadjusted population-based annual incidence of nocardiosis was 2.02 (95% confidence interval [CI], 1.55–2.60) per 100000 people and was 1.7 (95% CI, .96–2.90) fold higher in Indigenous compared with non-Indigenous persons (P = .027). Of 61 patients, 47 (77%) had chronic lung disease, diabetes, and/or hazardous alcohol consumption 22 (36%) were immunocompromised and 8 (13%) had no identified comorbidities. Disease presentations included pulmonary (69% 42 of 61), cutaneous (13% 8 of 61), and disseminated nocardiosis (15% 9 of 61). The most commonly identified species were Nocardia asteroides and Nocardia cyriacigeorgica (each 11%). Linezolid was the only antimicrobial to which isolates were universally susceptible 89% (48 of 54), 60% (32 of 53), and 48% (26 of 54) of isolates were susceptible to trimethoprim-sulfamethoxazole, ceftriaxone, and imipenem, respectively. Eighteen patients (30%) required intensive care unit (ICU) admission, and 1-year mortality was 31%. The incidence of nocardiosis in tropical Australia is amongst the highest reported globally. Nocardiosis occurs in both immunocompromised and immunocompetent hosts, and it is associated with high rates of ICU admission, 1-year mortality, and resistance to commonly recommended antimicrobials. Diagnosis should be considered in patients with consistent clinical features, particularly if they are Indigenous or have chronic lung disease.
Publisher: Oxford University Press (OUP)
Date: 31-01-2018
DOI: 10.1093/CID/CIY069
Abstract: Burkholderia pseudomallei, the causative agent of the high-mortality disease melioidosis, is a gram-negative bacterium that is naturally resistant to many antibiotics. There is no vaccine for melioidosis, and effective eradication is reliant on biphasic and prolonged antibiotic administration. The carbapenem drug meropenem is the current gold standard option for treating severe melioidosis. Intrinsic B. pseudomallei resistance toward meropenem has not yet been documented however, resistance could conceivably develop over the course of infection, leading to prolonged sepsis and treatment failure. We examined our 30-year clinical collection of melioidosis cases to identify B. pseudomallei isolates with reduced meropenem susceptibility. Isolates were subjected to minimum inhibitory concentration (MIC) testing toward meropenem. Paired isolates from patients who had evolved decreased susceptibility were subjected to whole-genome sequencing. Select agent-compliant genetic manipulation was carried out to confirm the molecular mechanisms conferring resistance. We identified 11 melioidosis cases where B. pseudomallei isolates developed decreased susceptibility toward meropenem during treatment, including 2 cases not treated with this antibiotic. Meropenem MICs increased from 0.5-0.75 µg/mL to 3-8 µg/mL. Comparative genomics identified multiple mutations affecting multidrug resistance-nodulation- ision (RND) efflux pump regulators, with concomitant overexpression of their corresponding pumps. All cases were refractory to treatment despite aggressive, targeted therapy, and 2 were associated with a fatal outcome. This study confirms the role of RND efflux pumps in decreased meropenem susceptibility in B. pseudomallei. These findings have important ramifications for the diagnosis, treatment, and management of life-threatening melioidosis cases.
Publisher: Elsevier BV
Date: 05-2017
DOI: 10.1016/J.IJID.2017.03.010
Abstract: To establish the relationship between hepatitis B virus (HBV) and human T-cell lymphotropic virus type 1 (HTLV-1) serological markers in the Northern Territory, Australia. A retrospective serological study of patients presenting to public healthcare facilities in the Northern Territory between 2008 and 2015 was performed in order to determine the presence and relationships of serological markers of HBV and HTLV-1. Seven hundred and forty in idual patients were found to be serologically positive for HTLV-1 in the Northern Territory over the 8-year period. Hepatitis B results were available for 521 of these patients. Hepatitis B surface antigen (HBsAg) positivity was demonstrated in 15.9% (83/521) of this cohort, which was significantly different to the HTLV-1-negative group (3.7%, 125/3354) (p<0.001). Excluding in iduals with isolated hepatitis B surface antibody (anti-HBs), those in the HTLV-1-positive group had a higher HBV exposure history (67.5%, 352/521) when compared to HTLV-1-negative in iduals (37.8%, 1259/3354) (p<0.001). HTLV-1-positive in iduals had a lower prevalence of HBV combined anti-HBs and hepatitis B core antibody (anti-HBc) positive markers compared to those who were HTLV-1-negative (56.3% (198/352) versus 73.8% (937/1269), respectively p<0.001). A significantly higher prevalence rate of HBV was found in HTLV-1-positive in iduals from the Northern Territory. When considering the higher exposure to HBV in HTLV-1-positive in iduals, the clearance of HBV appears lower than in those in iduals testing HTLV-1-negative. A lower prevalence of clearance in HTVL-1-positive in iduals than in HTLV-1-negative in iduals, as signified by formation of HBVcAb and HBVsAb in HTVL-1 positive in idual's may equate to higher prevalence of ongoing coinfection.
Publisher: Oxford University Press (OUP)
Date: 09-1997
DOI: 10.1046/J.1365-2133.1997.18481941.X
Abstract: Dermatophytes are keratinophilic fungi capable of causing dermatophytosis (commonly known as tinea or ringworm) in humans and animals. Previously, we reported the differentiation of the common dermatophytes Trichophyton rubrum, T. mentagrophytes and T. tonsurans using a random primer 5'-ACCCGACCTG-3' (OPAA11) in the arbitrarily primed polymerase chain reaction (AP-PCR). In the present study, by examining additional dermatophytes including eight Microsporum spp., 16 Trichophyton species/subspecies and Epidermophyton floccosum using both OPAA11 and a second random decamer 5'-GAGAGCCAAC-3' (OPD18) in AP-PCR, we show that except for T. rubrum and T. gourvilli, and three T. mentagrophytes varieties, most of the dermatophyte fungi investigated formed distinct DNA band patterns on gel electrophoresis. The lification of specific DNA bands in AP-PCR appeared to be independent of culture variations shown by dermatophyte isolates. These results provide the basis for the rapid identification of dermatophytes at the genetic level, supplementing existing laboratory methods and improving the diagnosis of human dermatophytosis.
Publisher: American Society for Microbiology
Date: 06-2012
DOI: 10.1128/JCM.06773-11
Abstract: In tropical northern Australia, approximately 20% of Staphylococcus aureus bacteremia is caused by methicillin-resistant Staphylococcus aureus (MRSA). We prospectively evaluated the impact on clinician antibiotic prescribing of the results obtained from performing the GeneXpert MRSA/SA test on 151 positive blood cultures with clustered Gram-positive cocci. The GeneXpert result led to earlier appropriate prescription of vancomycin for 54% of patients with MRSA 25% of patients avoided vancomycin, and 16% of patients had all antibiotics ceased.
Publisher: American Society of Tropical Medicine and Hygiene
Date: 06-04-2016
Publisher: Wiley
Date: 24-06-2012
DOI: 10.1111/J.1440-1797.2012.01603.X
Abstract: To describe the incidence and prevalence of blood-borne viruses (BBV) including: hepatitis B virus (HBV), hepatitis C virus (HCV), human immunodeficiency virus (HIV) and human T-cell leukaemia virus type-1 (HTLV) in the haemodialysis-dependent population of the Top End of the Northern Territory (TENT). We retrospectively reviewed the serology of BBV in a longitudinal fashion in the haemodialysis-dependent population treated in the TENT of Australia from 2000 to 2009 inclusive. HBV, HCV, HIV and HTLV serology on commencement of dialysis and at exit or January 2010, whichever was earlier, as well as demographic details were collected. Patients with a change in serological status had all serology reviewed. Four-hundred and forty patients were included in the analysis. Of these, 84.3% were Indigenous and 55.4% female, with a median age of 50 (IQR 43-59) years at the commencement of haemodialysis. Evidence of past HBV infection was documented in 42.7% and 8.9% were hepatitis B surface antigen-positive. Positive serology for HTLV was documented in 2.2%, 1.6% were hepatitis C antibody-positive and no in idual was HIV-positive. Three patients had a definite change in their HBV serology over time this equates to an absolute seroconversion risk of 0.1 per 100 person years or 0.0006 per dialysis episode. In this cohort, there was a high rate of past and current hepatitis B infection but low rates of seroconversion while on haemodialysis.
Publisher: AMPCo
Date: 03-2012
DOI: 10.5694/MJA11.11170
Abstract: To compare the unprecedented 91 cases of melioidosis in the Top End of the Northern Territory of Australia from 1 October 2009 to 30 September 2010 with the 540 cases in the preceding 20 years and postulate reasons for this year of very high melioidosis incidence. Review of prospectively collected data on all patients with culture-confirmed melioidosis at Royal Darwin Hospital, the Top End's tertiary referral centre, since 1 October 1989. Population-based annual incidence of melioidosis differences in epidemiology, clinical presentations and outcomes for 2009-2010 compared with the preceding 20 years. In 2009-2010, the estimated population-based incidence of melioidosis was 50.2 cases per 100 000 in the Top End population overall, and 102.4 cases per 100 000 in the Top End Indigenous population. The proportion of patients acquiring melioidosis in the Darwin urban area increased from 49% in 1989-2009 to 65% in 2009-2010 (OR, 1.96 95% CI, 1.20-3.19). Among the 49 Indigenous Australian patients with melioidosis in 2009-2010, 63% acquired the infection in Darwin, compared with 35% of Indigenous patients in the previous 20 years (OR, 3.17 95% CI, 1.62-6.24). In 2009-2010, the Top End had the highest annual incidence of melioidosis documented from anywhere to date. The prominent increase in cases in Darwin was associated with above average rainfall in Darwin during December 2009 to February 2010. The increase in the proportion of Indigenous Australians who acquired melioidosis in Darwin may reflect movement of some Indigenous people into Darwin from remote communities.
Publisher: Oxford University Press (OUP)
Date: 16-09-2014
DOI: 10.1093/CID/CIU733
Abstract: Melioidosis is less common in children than adults. The clinical spectrum of disease varies greatly between the 2 groups. Treatment guidelines are currently based on adult studies, and revision of existing guidelines is necessary to instruct specific pediatric management. Culture-confirmed cases of melioidosis in the Northern Territory between 1989 and 2013 were identified from the Prospective Melioidosis Study. The epidemiology and clinical spectrum of disease for children aged ≤ 16 years were analyzed and compared with the adult data. Forty-five pediatric patients were identified, representing 5% of the total 820 melioidosis cases over 24 years. Most children (84%) had no recognized risk factors for melioidosis, and 80% presented during the wet season. Primary cutaneous melioidosis was the commonest presentation in children (60% vs 13% P < .001), whereas pneumonia predominated in adults (54% vs 20% P < .001). Bacteremia was less common in children than in adults (16% vs 59% P < .001). Brainstem encephalitis occurred in 3 children without risk factors. Children were more likely to report an inoculating event (42% P < .001). There was no difference in mortality between the groups (P = .178), with 3 children dying (7%) all had identifiable risk factors. Four children with cutaneous melioidosis were successfully treated with oral therapy alone, while 2 had skin lesions that resolved spontaneously. Pediatric melioidosis commonly manifests as localized cutaneous disease in immunocompetent hosts. The disease can be fatal, especially in in iduals with risk factors for disease. Melioidosis with encephalomyelitis can result in severe residual disability. Prompt diagnosis requires a high index of clinical suspicion in endemic areas.
Publisher: Oxford University Press (OUP)
Date: 03-11-2015
DOI: 10.1093/JAC/DKV366
Abstract: The objective of this study was to develop a real-time PCR method for specific detection of the gonococcal GyrA amino acid 91 locus directly in clinical s les so as to predict Neisseria gonorrhoeae ciprofloxacin susceptibility. The real-time PCR assay, GyrA91-PCR, was designed using two probes, one for detection of the WT S91 sequence and the other for detection of the S91F alteration. The performance of the assay was initially assessed using characterized N. gonorrhoeae isolates (n = 70), a panel of commensal Neisseria and Moraxella species (n = 55 isolates) and clinical s les providing negative results by a commercial N. gonorrhoeae nucleic acid lification test (NAAT) method (n = 171). The GyrA91-PCR was then applied directly to N. gonorrhoeae NAAT-positive clinical s les (n = 210) from the year 2014 for which corresponding N. gonorrhoeae isolates with susceptibility results were also available. The GyrA91-PCR accurately characterized the GyrA 91 locus of all 70 N. gonorrhoeae isolates (sensitivity = 100%, 95% CI = 94.9%-100%), whereas all non-gonococcal isolates and N. gonorrhoeae NAAT-negative clinical s les gave negative results by the GyrA91-PCR (specificity = 100%, 95% CI = 98.4%-100%). When applied to the 210 N. gonorrhoeae NAAT-positive clinical s les, the GyrA91-PCR successfully characterized 195 s les (92.9%, 95% CI = 88.5%-95.9%). When compared with the corresponding bacterial culture results, positivity by the GyrA91-PCR WT probe correctly predicted N. gonorrhoeae susceptibility to ciprofloxacin in 161 of 162 (99.4%, 95% CI = 96.6%-99.9%) s les. The use of a PCR assay for detection of mutation in gyrA applied directly to clinical s les can predict ciprofloxacin susceptibility in N. gonorrhoeae.
Publisher: Elsevier BV
Date: 09-1994
Publisher: Elsevier BV
Date: 06-2018
DOI: 10.1016/J.JGAR.2017.12.010
Abstract: High rates of antimicrobial resistance (AMR) are seen throughout Southeast Asia. However, limited AMR data exist for Timor-Leste, which is situated on the south-eastern portion of the Malay Archipelago. The purpose of this study was to identify AMR in bacteria isolated from urine and skin swabs from patients in Dili, the capital of Timor-Leste. Urine and skin swabs were collected from symptomatic patients in Timor-Leste and were processed for bacterial culture. Isolates were processed in Australia using a VITEK A total of 154 urine isolates and 57 skin isolates were analysed. Of the Enterobacteriaceae, 35% were resistant to ceftriaxone with an extended-spectrum β-lactamase (ESBL)-producing phenotype. Carbapenem resistance was not observed in any of the Gram-negative isolates. Of the Staphylococcus aureus isolates, 11% were of the community-associated methicillin-resistant S. aureus (CA-MRSA) phenotype. A moderately high proportion of Gram-negative urine isolates in Timor-Leste demonstrate phenotypic ESBL production, and a relatively low proportion of S. aureus isolates were methicillin-resistant. Improved understanding of AMR rates in Timor-Leste can help guide antimicrobial prescribing and inform antimicrobial stewardship strategies.
Publisher: Centers for Disease Control and Prevention (CDC)
Date: 06-2015
Publisher: Elsevier BV
Date: 12-2014
Publisher: Oxford University Press (OUP)
Date: 21-03-2022
DOI: 10.1093/OFID/OFAC149
Abstract: Culture of Burkholderia pseudomallei remains the gold standard for diagnosis of melioidosis but is not possible in many resource-limited settings where melioidosis is endemic. Direct identification of B. pseudomallei antigen in clinical s les has been developed using a lateral flow immunoassay (LFA) targeting B. pseudomallei capsular polysaccharide. We summarized the findings from the 8 studies to date of the Active Melioidosis Detect (AMD) LFA and compared these with our results from 232 patients with culture-confirmed melioidosis. We have also optimized the methodology for testing different clinical s les. Sensitivity and specificity for different s les were broadly similar in our study to those published from Thailand, India, Laos, and Malaysia. One hundred thirty of 232 (56%) of our melioidosis patients were positive on 1 or more AMD tests: 27% for serum (rising to 39% in those with bacteremic melioidosis and 68% in those with septic shock), 63% for urine (72% in bacteremic melioidosis and 90% in septic shock), 85% in sputum that was culture positive, and 83% in pus that was culture positive. Heating sputum and pus s les increased sensitivity. Faint false-positive urine bands seen on earlier AMD versions were not seen when retested using the most recent version, AMD-Plus. While the sensitivity of melioidosis LFA is low overall for blood s les, there is potential for use as a rapid diagnostic: testing serum and urine from those with severe sepsis who may have melioidosis and testing sputum and pus s les from clinically relevant scenarios. Prospective studies of patients with sepsis and other clinical presentations resembling melioidosis are required to ascertain if the specificity of AMD-PLUS is adequate to enable diagnosis of melioidosis with a high positive predictive value.
Publisher: Elsevier BV
Date: 09-2014
Publisher: AMPCo
Date: 03-2013
DOI: 10.5694/MJA12.11615
Abstract: To determine the prevalence and trends of human hookworm infection (HWI) in the Northern Territory over the past 10 years, and to assess the influence of the community children's deworming program (CCDP). A retrospective observational analysis of consecutive microbiologically confirmed cases of HWI in patients diagnosed at NT government health care facilities and the main private laboratory servicing the NT between January 2002 and July 2012. Annual prevalence of HWI (2002-2011) age, sex, Indigenous status, residence, haemoglobin level and eosinophil count of patients with HWI and proportion of patients within the CCDP target population (children aged 6 months to 16 years, who should receive 6-monthly albendazole). From 64 691 faecal s les examined during the study period, hookworm was detected in 112 patients. There was a downward trend in the annual prevalence of HWI, falling from 14.0 cases per 100 000 population (95% CI, 8.8-19.2) in 2002 to 2.2 per 100 000 population (95% CI, 0.3-4.1) in 2011. Only 16 patients (14.3%) fell within the CCDP target population. Seventy-one patients (63.4%) were living in remote communities, and 94 (84.7%) were recorded as Indigenous Australians. The prevalence of HWI in the NT reduced over the 10-2013 period. HWI predominantly occurs in in iduals outside the CCDP target population. Our data support continuation of the CCDP in conjunction with improvements in housing, health hardware and health promotion. Continued use of albendazole in in iduals beyond the CCDP may facilitate the eventual eradication of HWI from the NT.
Publisher: American Society of Tropical Medicine and Hygiene
Date: 03-12-2014
Publisher: Elsevier BV
Date: 1999
Abstract: Pulmonary coccidioidomycosis is a rare cause of pulmonary nodules and respiratory infection in travellers to endemic areas. An Australian tourist suffered an acute respiratory illness while on holiday in Mexico. She subsequently developed erythema nodosum and was noted to have a left pulmonary nodule on chest X-ray after return to Australia. The diagnosis of Coccidioides immitis infection was established by histology and culture of the resected lung lesion. The patient made an uneventful recovery and received one month of therapy with ketoconazole. Culture of the fungus took place under controlled Class 3 conditions. An unusual fungal infection in Australia, coccidioidomycosis poses special risks to staff of microbiology laboratories.
Publisher: Microbiology Society
Date: 02-2002
DOI: 10.1099/0022-1317-51-2-117
Abstract: Diagnosis of dermatophytosis employing conventional laboratory procedures has been complicated by the slow growth and varied morphological features shown by dermatophytes. After analysis of the nucleotide base sequences of a 1.2-kb fragment lified from a dermatophyte fungus Trichophyton rubrum by arbitrarily primed PCR with random primer OPD18, a pair of primers (TRIF and TR1R) was designed and evaluated for specific identification of T. rubrum. The sensitivity of the primers TR1F and TR1R was high, as a specific PCR band of c. 600 bp was detected from as little as 7 pg of T. rubrum DNA. By examining 92 dermatophyte strains and clinical isolates, it was found that this pair of primers reacted in PCR with T. rubrum, T. soudanense and T. gourvilii through formation of the specific fragment of 600 bp, but not with any other of the dermatophyte species or varieties, fungi, yeasts or bacteria tested. As T rubrum is one of the most frequently isolated dermatophyte fungi, and T. soudanense and T. gourvilii are relatively uncommon in many parts of the world, these primers can be used for rapid, sensitive and specific identification and differentiation of T. rubrum from other fungi and micro-organisms.
Publisher: Elsevier BV
Date: 1994
DOI: 10.1080/00313029400169471
Abstract: Pneumocystis carinii pneumonia (PCP) is the commonest opportunistic infection in AIDS patients. By using the polymerase chain reaction (PCR), specific DNA sequences can be lified and used in diagnosis of infections such as PCP where the causative pathogen is both difficult to grow and present in low numbers. Twenty HIV positive patients were investigated for PCP. Twenty sputa (15 induced and 5 expectorated) had toluidine blue O staining, direct immunofluorescence and PCR performed for Pneumocystis carinii in a blinded fashion. PCR was performed using primers pAZ102-E 5' GATGGCTGTTTCCAAGCCCA 3' and pAZ102-H 5' GTGTACGTTGCAAAGTACTC 3' from the gene coding for Pneumocystis carinii mitochondrial ribosomal RNA with a specific 346 base-pair sequence being lified from positive specimens. Ten of the patients had Pneumocystis carinii shown by conventional tests and PCR. Another 3 patients were positive only by PCR, all had evidence of infection with Pneumocystis carinii the first was positive by subsequent conventional stains, the second was treated for bacterial bronchitis but had a non-resolving chest infection with PCP found on postmortem after 4 mths, the third had a typical interstitial infiltrate on CXR and responded to empiric PCP treatment. PCR is more sensitive than toluidine blue O staining and direct immunofluorescence in detecting Pneumocystis carinii in sputum from HIV patients and may become the diagnostic method of choice for PCP.
Publisher: Elsevier BV
Date: 09-1988
DOI: 10.1016/0002-9343(88)90614-6
Abstract: With the increase in the trend of social networking, celebrations, over a couple of decades weather in the hostel or at home. Snacking has become an important aspect of activity. Today teen prefer snacks more than a proper meal. Skipping of meal and nibbling in between meal is a common practice. The main meals (breakfast, lunch and dinner) are missed and total proportions of calories are consumed from the snacks eaten. Hence, this disordered eating behavior when continued may further lead to development of serious syndrome i.e., night eating syndrome. A purposive random s le comprising 188 males and 192 females (N=380), adolescents (18-22 years) were selected including hostlers and day scholars. The subjects were administered with self-organized questionnaire so to analyze the pattern of NES among them. Out of total 380 respondents, the numbers of hostlers were 211 and day scholars 169, while boys were 188 and girls were 192 in number. Results indicated that nearly half the percentage of adolescents snacked at night, out of which very few respondents met the criteria of NES, in which the number of hostlers were quite more than the day scholars, i.e.,76.3%.
Publisher: Oxford University Press (OUP)
Date: 02-1994
Abstract: Previous studies have shown that lipoteichoic acid (LTA) of group A streptococci plays a central role in the adherence of these organisms to epithelial cells. In this study, intranasal instillation of purified LTA but not deacylated LTA in mice blocked colonization and prevented death after intranasal challenge infection with group A streptococci. Bacteria pretreated with rabbit antisera against LTA also failed to colonize or infect mice after intranasal challenge. In vitro studies showed that LTA and M protein inhibited adherence of type 24 streptococci to mouse pharyngeal cells. Passive intranasal administration of purified type 24 M protein protected mice from death after challenge infection with type 24 streptococci but had no significant effect on pharyngeal colonization. Surface LTA and M protein may mediate adherence of streptococci to mouse pharyngeal cells, and blocking adherence with LTA prevents colonization and infection in this animal model.
Publisher: Elsevier BV
Date: 02-2013
Publisher: Cold Spring Harbor Laboratory
Date: 17-04-2018
DOI: 10.1101/301960
Abstract: Burkholderia pseudomallei , the causative agent of the deadly tropical disease melioidosis, is intrinsically resistant to many antibiotics, leaving few effective treatment options. Trimethoprim-sulfamethoxazole (SXT), meropenem (MEM) and doxycycline (DOX) are valuable antibiotics for melioidosis treatment due to inherently low or no primary resistance. Although considered rare, upregulation of one or more resistance-nodulation- ision (RND) efflux pumps is now known to lead to acquired resistance towards these drugs in B. pseudomallei. Here, we developed a triplex quantitative PCR assay to detect upregulation of the three clinically relevant RND efflux systems: AmrAB-OprA, BpeB-OprB and BpeEF-OprC. The triplex assay was tested on seven clinically-derived B. pseudomallei isogenic pairs, where the latter strain of each pair had altered regulator activity and exhibited reduced susceptibility to SXT, MEM or DOX. The triplex assay accurately detected efflux pump upregulation between isogenic pairs, which corresponded with decreased antibiotic susceptibility. We further verified assay performance on eight laboratory-generated B. pseudomallei mutants encoding efflux pump regulator mutations. Targeting antibiotic resistance in B. pseudomallei using molecular genotyping provides clinicians with a rapid tool to identify potential treatment failure in near real-time, enabling informed alteration of treatment during an infection and improved patient outcomes. The melioidosis bacterium Burkholderia pseudomallei is intrinsically resistant to many antibiotics, limiting treatment options to a handful of drugs including meropenem, doxycycline and trimethoprim-sulfamethoxazole. Although rare, there have now been several documented melioidosis cases where resistance to these antibiotics has developed during an infection, leading to treatment failure and increased mortality rates. Interestingly, all strains resistant to these drugs exhibit increased efflux pump expression, representing a shared molecular signature that can be exploited for rapid diagnostic purposes. Here, we developed and validated a single-tube real-time qPCR assay to detect clinically relevant efflux pump upregulation in B. pseudomallei , an important first step towards high-level resistance. This triplex assay offers a drastically reduced turn-around-time compared to current methodology, enabling earlier detection of resistance emergence. Implementation of this new diagnostic will aid clinicians in the selection of appropriate therapy, thereby minimizing resistance development and treatment failure for this high-mortality disease.
Publisher: Oxford University Press (OUP)
Date: 02-1996
Abstract: Currently, the pharmaceutical industry is well-developed, and a large number of chemotherapeutics are being produced. These include antibacterial substances, which can be used in treating humans and animals suffering from bacterial infections, and as animal growth promoters in the agricultural industry. As a result of the excessive use of antibiotics and emerging resistance amongst bacteria, new antimicrobial drugs are needed. Due to the increasing trend of using natural, ecological, and safe products, there is a special need for novel phytocompounds. The compounds analysed in the present study include two triterpenoids ursolic acid (UA) and oleanolic acid (OA) and the flavonoid dihydromyricetin (DHM). All the compounds displayed antimicrobial activity against Gram-positive (
Publisher: Wiley
Date: 29-10-2014
DOI: 10.1111/TMI.12405
Abstract: Invasive group A streptococcus (iGAS) disease is an important cause of mortality globally. The incidence of iGAS in Australia's tropical Northern Territory (NT) has been previously reported as 32.2/100 000 in Indigenous people for the period 1991-1996. We aimed to measure the incidence and severity of iGAS disease in the NT since this time. We collected demographic data for all GAS blood culture isolates over a 12-year period (1998-2009) from the three hospital laboratories serving the tropical NT. We then collected detailed clinical information from hospital records and databases for the subset of these patients who were admitted to Royal Darwin Hospital during 2005-2009. There were 295 confirmed cases of GAS bacteraemia over the study period, with a mean (SD) age of 42.1 (22.0) years, and 163 (55.0%) were male. The annual age-adjusted incidence was 15.2 (95% CI 13.4-16.9)/100 000 overall and 59.4 (95% CI 51.2-67.6) in Indigenous Australians. For 2005-2009, there were 123 cases with the most common focus of infection being skin/soft tissue [44 (35.6%)] 29 patients (23.6%) required intensive care unit admission and 20 (16.3%) had streptococcal toxic shock syndrome. Antecedent sore throat or use of non-steroidal anti-inflammatory drugs was rare, but current or recent scabies, pyoderma and trauma were common. The incidence and severity of iGAS are high and increasing in tropical northern Australia, and urgent attention is needed to improve surveillance and the social determinants of health in this population. This study adds to emerging data suggesting increasing importance of iGAS in low- and middle-income settings globally.
Publisher: American Society for Microbiology
Date: 08-2015
DOI: 10.1128/JCM.00540-15
Abstract: A multitarget PCR was developed for the direct detection of penicillinase-producing Neisseria gonorrhoeae (PPNG). The assay was validated by testing 342 PPNG isolates and 415 clinical s les. The method is suitable for routine detection of PPNG strains. Its multitarget approach reduces the potential for false-negative results caused by sequence variations.
Publisher: Springer Science and Business Media LLC
Date: 09-1992
DOI: 10.1007/BF00215766
Publisher: CSIRO Publishing
Date: 2015
DOI: 10.1071/SH14136
Abstract: Background To improve HIV detection, Royal Darwin Hospital implemented a guideline in 2012 recommending routine HIV testing for all adult acute medical admissions. This study aimed to determine the uptake, point prevalence and impact on late diagnosis of HIV screening following guideline implementation. Methods: Data on the number of HIV tests and number of acute medical admissions over the 8 months prior and post guideline implementation were extracted from hospital databases. A qualitative survey was conducted to ascertain clinician response to routine screening. Results: Fourteen per cent of admissions were tested post-implementation compared with 5.3% during the implementation period (P 0.001). HIV prevalence pre-implementation was 1.4% compared with 0.3% following implementation (P 0.05). The average CD4 count at diagnosis was cells/mm3. Conclusions: There was a significant increase in HIV testing following guideline implementation however, the overall testing rate remained low. Routine screening did not increase detection of HIV, and HIV continues to be diagnosed late at Royal Darwin Hospital. Methods for improving understanding of the rationale for routine screening and increased promotion of the guidelines are required to increase testing.
Publisher: American Society for Microbiology
Date: 12-2018
DOI: 10.1128/JCM.01437-18
Publisher: American Society for Microbiology
Date: 09-2013
DOI: 10.1128/JCM.01290-13
Abstract: Misidentifications of Burkholderia pseudomallei as Burkholderia cepacia by Vitek 2 have occurred. Multidimensional scaling ordination of biochemical profiles of 217 Malaysian and Australian B. pseudomallei isolates found clustering of misidentified B. pseudomallei isolates from Malaysian Borneo. Specificity of B. pseudomallei identification in Vitek 2 and potentially other automated identification systems is regionally dependent.
Publisher: Centers for Disease Control and Prevention (CDC)
Date: 09-2017
Publisher: American Society for Microbiology
Date: 03-2014
DOI: 10.1128/JCM.03286-13
Abstract: Enterococci are a major cause of health care-associated infections and account for approximately 10% of all bacteremias globally. The aim of this study was to determine the proportion of enterococcal bacteremia isolates in Australia that are antimicrobial resistant, with particular emphasis on susceptibility to icillin and the glycopeptides, and to characterize the molecular epidemiology of the Enterococcus faecalis and Enterococcus faecium isolates. From 1 January to 31 December 2011, 1,079 unique episodes of bacteremia were investigated, of which 95.8% were caused by either E. faecalis (61.0%) or E. faecium (34.8%). The majority of bacteremias were health care associated, and approximately one-third were polymicrobial. Ampicillin resistance was detected in 90.4% of E. faecium isolates but was not detected in E. faecalis isolates. Vancomycin nonsusceptibility was reported in 0.6% and 36.5% of E. faecalis and E. faecium isolates, respectively. Unlike Europe and the United States, where vancomycin resistance in E. faecium is predominately due to the acquisition of the vanA operon, 98.4% of E. faecium isolates harboring van genes carried the vanB operon, and 16.1% of the vanB E. faecium isolates had vancomycin MICs at or below the susceptible breakpoint of the CLSI. Although molecular typing identified 126 E. faecalis pulsed-field gel electrophoresis pulsotypes, % belonged to two pulsotypes that were isolated across Australia. E. faecium consisted of 73 pulsotypes from which 43 multilocus sequence types were identified. Almost 90% of the E. faecium isolates were identified as CC17 clones, of which approximately half were characterized as ST203, which was isolated Australia-wide. In conclusion, the Australian Enterococcal Sepsis Outcome Programme (AESOP) study has shown that although they are polyclonal, enterococcal bacteremias in Australia are frequently caused by icillin-resistant vanB E. faecium .
Publisher: Oxford University Press (OUP)
Date: 06-2019
DOI: 10.1093/OFID/OFZ263
Abstract: Community-onset bacteremic Acinetobacter baumannii pneumonia recurred in 3 of 30 (10%) patients followed prospectively, all with ongoing hazardous alcohol intake, 3–56 months after initial pneumonia. Paired isolates underwent whole-genome sequencing. Phylogenetic analysis showed that recurrence strains were all distinct from preceding strains, indicating reinfection in susceptible in iduals rather than relapse.
Publisher: Elsevier BV
Date: 06-2012
Publisher: Microbiology Society
Date: 12-1997
DOI: 10.1099/00222615-46-12-1043
Abstract: Dermatophytes are a group of keratinophilic fungi falling within the genera of Epidermophyton, Microsporum and Trichophyton. The genus Trichophyton is particularly important and complex it comprises at least 15 recognised species. In addition, there are several different variants in the species T. mentagrophytes, which occur both in man and animals. The current methods of determining T. mentagrophytes varieties may require several different culture media and time-consuming procedures, as well as specialist skills. This study used a random primer, 5'-GAGCCCGACT-3', in the arbitrarily primed polymerase chain reaction (AP-PCR) and showed that the two common T. mentagrophytes varieties (var. interdigitale and var. mentagrophytes) can be clearly identified on the basis of their characteristic DNA band patterns. The relative reproducibility, ease of use and precision of this method make the AP-PCR a valuable tool in the laboratory diagnosis of human dermatophytosis.
Publisher: Oxford University Press (OUP)
Date: 2001
Abstract: A DNA fragment of approximately 1.2 kb, generated from the common dermatophyte Microsporum canis by arbitrarily primed polymerase chain reaction (PCR) using random primer OPU13, was cloned and sequenced. Based on the resulting sequencing data, a forward primer (MC1F) and a reverse primer (MC1R) have been designed and assessed by PCR for their usefulness in the improved identification of M. canis. The results obtained suggest that these primers are specific for M. canis, as a band of 900 bp was lified in PCR with genomic DNA from M. canis only, and not from any of the other dermatophyte species or varieties, other fungi or common bacteria examined. Combining this PCR technique with a rapid mini-preparation method for fungal DNA, a definitive diagnosis of M. canis can be achieved within a day from the primary cultures. Future refinement of a DNA purification protocol from clinical specimens would further enhance the potential of the PCR based test for improved detection and identification of M. canis.
Publisher: MDPI AG
Date: 11-05-2018
Publisher: Oxford University Press (OUP)
Date: 26-03-2014
DOI: 10.1093/JPIDS/PIU013
Abstract: Despite a high burden of staphylococcal skin disease in children and high incidence of Staphylococcus aureus bacteremia in adult Indigenous populations in northern Australia, there are few studies describing incidence or clinical information of invasive S aureus (ISA) infections in children. We conducted a retrospective review for all cases of S aureus bacteremia and sterile site infections, for children under 15 years, in northern Australia over a 4-year period (2007-2010). Cases were categorized as neonatal (<28 days) and pediatric (≥28 days). Forty-four cases (9 neonatal, 35 pediatric) were identified. The annual incidence of ISA was 27.9 cases per 100 000 population. Among pediatric cases, the annual incidence was significantly higher in the Indigenous (46.6) compared with the non-Indigenous (4.4) population (IRR: 10.6 [95% confidence interval, 3.8-41.4]). Pediatric infections were predominantly community-associated (86%). Clinical infection sites included osteoarticular (66%), pleuropulmonary (29%), and endocarditis (9%), and multifocal disease was common (20%). Eighty-three percent of pediatric cases presented with sepsis 34% resulted in intensive care admission. Neonatal cases were all born prematurely 89% were late-onset infections. Overall, 27% of infections were due to methicillin-resistant S aureus (MRSA). Compared with methicillin-sensitive S aureus (MSSA), there was no difference in severity or presentation in pediatric MRSA cases, but a higher proportion of MRSA cases were readmitted. The annual incidence of ISA infection in this study is among the highest described, largely due to a disproportionate burden in Indigenous children. Infections are frequently severe and infection with MRSA is common. Children presenting with suspected ISA in this region should be treated empirically for MRSA.
Publisher: Elsevier BV
Date: 08-2014
DOI: 10.1016/J.IJANTIMICAG.2014.04.012
Abstract: Burkholderia pseudomallei is a saprophytic Gram-negative bacterium responsible for the tropical infectious disease melioidosis. Melioidosis is endemic to northern Australia and Southeast Asia. In this study, 234 isolates of B. pseudomallei obtained from the first positive clinical specimen from 234 consecutive patients diagnosed with melioidosis between October 2009 and September 2012 were reviewed. All isolates were susceptible to meropenem and ceftazidime. In total, 226 isolates (96.6%) were susceptible to doxycycline and 232 (99.1%) were susceptible to trimethoprim/sulfamethoxazole (TMP/SMX co-trimoxazole). Primary resistance of B. pseudomallei to ceftazidime and/or meropenem is exceedingly rare and clinicians can be confident in the current treatment guidelines for melioidosis. Whether the very low rates of TMP/SMX resistance seen in Australia reflect the global situation requires further studies using Etest, especially to clarify the rate of resistance in Thailand.
Publisher: Oxford University Press (OUP)
Date: 05-08-2021
DOI: 10.1093/CID/CIAA1105
Publisher: Public Library of Science (PLoS)
Date: 08-09-2017
Publisher: Ovid Technologies (Wolters Kluwer Health)
Date: 09-2018
Publisher: Wiley
Date: 10-09-2010
DOI: 10.1111/J.1440-0960.2010.00678.X
Abstract: To characterise the trends in dermatophyte isolation from specimens sourced from metropolitan Melbourne over a 48-year time period. Analysis of submitted specimens from three time periods. Trends identified include: an increasing mean age of the patients increased numbers of onychomycosis isolates a significant age difference among patients with Trichophyton interdigitale isolates compared with patients who had other dermatophyte species and an increasing number of previously rarely isolated imported dermatophytes. Significant shifts are occurring in dermatophyte epidemiology.
Publisher: Oxford University Press (OUP)
Date: 05-1990
Abstract: Intramedullary spinal tuberculomas are a rare cause of spinal cord compression. We report a recent case and review 17 cases described in the literature since 1960. Intramedullary spinal tuberculomas occurred in relatively young patients (mean age, 28.6 years) and more frequently in women (63% of cases) than in men. The commonest symptoms were those of subacute spinal cord compression (mean duration, 2.3 months) with progressive lower-limb weakness (94%), paresthesia, and bowel and bladder dysfunction. The major physical finding was paraplegia, either spastic (61%) or flaccid (33%). The majority of patients (55%) had a thoracic sensory level. Extraspinal tuberculous disease, predominantly pulmonary, occurred in 69% of reported cases. Myelography efficiently localized the lesion. The diagnosis was made surgically in 16 patients (89%) and clinically in two (11%). Eleven (65%) of 17 patients improved. Four deaths occurred, three in the perioperative period. Though rare, intramedullary spinal cord tuberculoma should be considered in the differential diagnosis of spinal cord compression, particularly when clinical disease compatible with tuberculosis is present.
Publisher: Elsevier BV
Date: 09-2005
DOI: 10.1071/HI12030
Publisher: Oxford University Press (OUP)
Date: 13-02-2017
DOI: 10.1093/JAC/DKX047
Publisher: Elsevier BV
Date: 2016
Publisher: Centers for Disease Control and Prevention (CDC)
Date: 02-2015
Publisher: Elsevier BV
Date: 04-2017
Publisher: BMJ
Date: 02-2018
DOI: 10.1136/BMJOPEN-2017-019632
Abstract: Diarrhoeal disease is the second leading cause of death in children under 5 years globally, killing 525 000 annually. Australian Aboriginal and Torres Strait Islander (hereafter Aboriginal) children suffer a high burden of disease. Randomised trials in other populations suggest nitazoxanide accelerates recovery for children with Giardia , amoebiasis, Cryptosporidium, Rotavirus and Norovirus gastroenteritis, as well as in cases where no enteropathogens are found. This double blind, 1:1 randomised, placebo controlled trial is investigating the impact of oral nitazoxanide on acute gastroenteritis in hospitalised Australian Aboriginal children aged 3 months to years. Dosing is based on age-based dosing. The primary endpoint is the time to resolution of ‘significant illness’ defined as the time from randomisation to the time of clinical assessment as medically ready for discharge, or to the time of actual discharge from hospital, whichever occurs first. Secondary endpoints include duration of hospitalisation, symptom severity during the period of significant illness and following treatment, duration of rehydration and drug safety. Patients will be followed for medically significant events for 60 days. Analysis is based on Bayesian inference. Subgroup analysis will occur by pathogen type (bacteria, virus or parasite), rotavirus vaccination status, age and illness severity. Ethics approval has been granted by the Central Australian Human Research Ethics Committee (HREC-14–221) and the Human Research Ethics Committee of the Northern Territory Department of Health and Menzies School of Health Research (HREC2014-2172). Study investigators will ensure that the trial is conducted in accordance with the principles of the Declaration of Helsinki. In idual participant consent will be obtained. Results will be disseminated via peer-reviewed publication. ACTRN12614000381684.
Publisher: Oxford University Press (OUP)
Date: 08-09-2016
DOI: 10.1093/CID/CIV808
Abstract: In vitro laboratory and animal studies demonstrate a synergistic role for the combination of vancomycin and antistaphylococcal β-lactams for methicillin-resistant Staphylococcus aureus (MRSA) bacteremia. Prospective clinical data are lacking. In this open-label, multicenter, clinical trial, adults with MRSA bacteremia received vancomycin 1.5 g intravenously twice daily and were randomly assigned (1:1) to receive intravenous flucloxacillin 2 g every 6 hours for 7 days (combination group) or no additional therapy (standard therapy group). Participants were stratified by hospital and randomized in permuted blocks of variable size. Randomization codes were kept in sealed, sequentially numbered, opaque envelopes. The primary outcome was the duration of MRSA bacteremia in days. We randomly assigned 60 patients to receive vancomycin (n = 29), or vancomycin plus flucloxacillin (n = 31). The mean duration of bacteremia was 3.00 days in the standard therapy group and 1.94 days in the combination group. According to a negative binomial model, the mean time to resolution of bacteremia in the combination group was 65% (95% confidence interval, 41%-102% P = .06) that in the standard therapy group. There was no difference in the secondary end points of 28- and 90-day mortality, metastatic infection, nephrotoxicity, or hepatotoxicity. Combining an antistaphylococcal β-lactam with vancomycin may shorten the duration of MRSA bacteremia. Further trials with a larger s le size and objective clinically relevant end points are warranted. Australian New Zealand Clinical Trials Registry: ACTRN12610000940077 (www.anzctr.org.au).
Publisher: American Society of Tropical Medicine and Hygiene
Date: 04-03-2015
Publisher: Cold Spring Harbor Laboratory
Date: 20-10-2017
DOI: 10.1101/205070
Abstract: Burkholderia pseudomallei , the causative agent of the high-mortality disease melioidosis, is a Gram-negative bacterium that is naturally resistant to many antibiotics. There is no vaccine for melioidosis, and effective eradication is reliant on biphasic and prolonged antibiotic administration. The carbapenem drug, meropenem, is the current gold-standard option for treating severe melioidosis. Intrinsic B. pseudomallei resistance towards meropenem has not yet been documented however, resistance could conceivably develop over the course of infection, leading to prolonged sepsis and treatment failure. Here, we document 11 melioidosis cases in which B. pseudomallei isolates developed decreased susceptibility towards meropenem during treatment, including two cases not treated with this antibiotic. Meropenem minimum inhibitory concentrations increased over time from 0.5-0.75 to 3-8 μg/mL. Using comparative genomics, we identified multiple mutations affecting multidrug resistance-nodulation- ision (RND) efflux pump regulators, leading to over-expression of their corresponding pumps. The most commonly affected pump was AmrAB-OprA, although alterations in the local regulators of BpeEF-OprC or BpeAB-OprB were observed in three cases. This study confirms the role of RND efflux pumps in decreased meropenem susceptibility in B. pseudomallei . Further, we document two concerning ex les of severe melioidosis where the reduced treatment efficacy of meropenem was associated with a fatal outcome. The bacterium Burkholderia pseudomallei , which causes the often-fatal tropical disease melioidosis, is difficult to eradicate. Due to high levels of intrinsic antibiotic resistance, only a handful of antibiotics are effective against this pathogen. One of these, meropenem, is commonly used in the treatment of melioidosis patients who are unresponsive to other treatments or are critically ill. Here, we describe 11 melioidosis cases whereby patients exhibited prolonged or repeated infections that were associated with the development of decreased meropenem susceptibility. We identified the molecular basis for this decreased susceptibility in latter B. pseudomallei isolates obtained from these patients, and functionally confirmed the mechanism conferring this phenotype. Our findings have important ramifications for the diagnosis, treatment and management of life-threatening melioidosis cases.
Publisher: American Society for Microbiology
Date: 11-2022
DOI: 10.1128/JCM.05038-11
Abstract: Corynebacterium diphtheriae is commonly isolated from cutaneous skin lesions in the Northern Territory of Australia. We prospectively assessed 32 recent isolates from infected skin lesions, in addition to reviewing 192 isolates collected over 5 years for toxin status. No isolates carried the toxin gene. Toxigenic C. diphtheriae is now a rare occurrence in the Northern Territory.
Publisher: Elsevier BV
Date: 06-2012
DOI: 10.1071/HI11027
Publisher: American Society of Tropical Medicine and Hygiene
Date: 04-2015
Publisher: American Society of Tropical Medicine and Hygiene
Date: 04-2015
Publisher: Oxford University Press (OUP)
Date: 11-1996
DOI: 10.1111/J.1574-6968.1996.TB08551.X
Abstract: Candida species are opportunistic human pathogens capable of causing a variety of clinical diseases. Rapid and precise identification of Candida to species level is essential for effective treatment and management strategies. Conventional diagnosis of candidiasis is sometimes slow and variable. By using a random primer 5'-ACGGGCCAGT-3' in arbitrarily primed polymerase chain reaction, seven common Candida species (i.e., C. albicans, C. guilliermondii, C. parapsilosis, C. krusei, C. lipolytica, C. tropicalis and C. (Torulopsis) glabrata) produced characteristic DNA band patterns, which enabled rapid determination to species level among them. Further analysis of the nucleotide sequences of Candida specific fragments should improve our understanding of the molecular structures and possible functions of the gene regions involved.
Publisher: Elsevier BV
Date: 10-2015
Publisher: Elsevier BV
Date: 1999
Abstract: A comparison of dermatophyte infections, diagnosed by specimens sent to the laboratory, between 1961/64 and 1995/96 revealed two major trends, namely the site of clinical disease and the types of dermatophytes causing tinea infections. There was a marked decrease in scalp specimens submitted. Pedal disease and nail infections remained the predominant entities. There was a marked increase in Trichophyton rubrum isolations, such that T. rubrum now accounts for 69.5% of all dermatophyte infections. Possible causes for these trends include altered hygiene standards, changing immigration patterns and the availability, restrictions and diagnostic requirements for the prescription of various antifungal drugs over this time period.
Publisher: Elsevier BV
Date: 10-2014
Abstract: The genus Acinetobacter, well known as a nosocomial pathogen, can also cause severe community-onset pneumonia. Previous small case series have suggested fulminant disease and a pooled hospital mortality of > 60%. We conducted a prospective observational study of all episodes of bacteremic, community-onset, and radiologically confirmed pneumonia due to Acinetobacter species at a tertiary referral hospital in tropical Australia from 1997 to 2012 following the introduction of routine empirical treatment protocols covering Acinetobacter. Demographic, clinical, microbiologic, and outcome data were collected. There were 41 episodes of bacteremic community-onset Acinetobacter pneumonia, of which 36 had no indicators suggesting health-care-associated infection. Of these, 38 (93%) were Indigenous Australians, one-half were men, the average age was 44.1 years, and 36 episodes (88%) occurred during the rainy season. All patients had at least one risk factor, with hazardous alcohol intake in 82%. Of the 37 isolates available for molecular speciation, 35 were Acinetobacter baumannii and two were Acinetobacter nosocomialis. All isolates were susceptible in vitro to gentamicin, meropenem, and ciprofloxacin, but only one was fully susceptible to ceftriaxone. ICU admission was required in 80%. All 41 patients received appropriate antibiotics within the first 24 h of admission, and 28- and 90-day mortality were both low at 11%. Community-acquired Acinetobacter pneumonia is a severe disease, with the majority of patients requiring ICU admission. Most patients have risk factors, particularly hazardous alcohol use. Despite this severity, correct initial empirical antibiotic therapy in all patients was associated with low mortality.
Publisher: Wiley
Date: 04-05-2015
DOI: 10.1111/JPC.12885
Abstract: Review of dwarf tapeworm (Hymenolepis nana) presentations to Northern Territory (NT) Government health-care facilities over 12 years. We postulated H. nana infections would remain unchanged despite the introduction of deworming programmes as H. nana is not eradicated with albendazole treatment. A retrospective observational analysis of consecutive microbiologically confirmed cases of H. nana identified by NT Government health-care facilities between 2002 and 2013. Four hundred sixty-one episodes of H. nana infection were identified over the 12-year period from 68 387 faecal s les. Infections were overwhelmingly in young children with a median age of patients being 3.0 years (interquartile range 2.25-4.67). Patients were predominantly Indigenous (98.9%, P = 0.001) and infections occurred across the entire NT. Infections were associated with anaemia (18.2%) and eosinophilia (39.6%). The annual prevalence of NT Government health-care facility diagnosed H. nana infection remains relatively constant from 6.9 {4.8-9.0 (confidence interval (CI))} cases per 10 000 Indigenous population in 2002, compared with 6.6 (4.7-8.4 CI) cases per 10 000 Indigenous population in 2013. Infection rates in Indigenous children <5 years of age were: 46.1 (16.4-75.8 CI) cases/10 000 in 2002, compared with 44.3 (15.3-73.3 CI) cases/10 000 Indigenous population in 2013. H. nana is the most frequently identified cestode (tapeworm) in NT Government health-care facilities. H. nana remains endemic throughout the NT, predominantly infecting Indigenous children less than 5 years of age.
Publisher: Wiley
Date: 11-09-2018
DOI: 10.1002/CJP2.110
Publisher: AMPCo
Date: 03-2014
DOI: 10.5694/MJA13.00141
Abstract: To observe the prevalence, disease associations, and temporal trends in Trichuris trichiura (whipworm) infection in the Northern Territory between 2002 and 2012. Retrospective observational analysis of consecutive microbiologically confirmed cases of T. trichiura infection among members of the NT population from whom a faecal s le was obtained for testing by NT Government health care facilities between 1 January 2002 and 31 December 2012. Annual prevalence of T. trichiura infection age, sex, Indigenous status and place of residence of infected patients percentage of infected patients with anaemia (haemoglobin level, ≤ 110 g/L) and eosinophilia (eosinophil count, ≥ 0.5 × 10(9)/L). 417 episodes of T. trichiura infection were identified over the 11 years from 63 668 faecal s les. The median age of patients was 8 years (interquartile range [IQR], 3-36 years). Patients were predominantly Indigenous (95.3% P = 0.001) and from three main geographical areas (Victoria Daly, East Arnhem Land and West Arnhem Land). Infections were associated with anaemia (40.2%) and eosinophilia (51.6%). There was a downward trend in the prevalence of T. trichiura infection diagnosed at NT Government health care facilities, from 123.1 cases (95% CI, 94.8-151.3 cases) per 100,000 Indigenous population in 2002 to 35.8 cases (95% CI, 21.8-49.9 cases) per 100,000 Indigenous population in 2011. T. trichiura is the most frequently identified soil-transmitted helminth infecting patients in NT Government health care facilities. Cases are identified predominantly in Indigenous patients in remote communities. We have observed a declining prevalence of whipworm infection in the NT.
Publisher: Elsevier BV
Date: 12-2017
Publisher: Wiley
Date: 13-05-2018
DOI: 10.1111/JPC.13936
Abstract: The epidemiology of community-acquired bacterial meningitis has changed following the introduction of routine immunisation against common causative organisms. Indigenous children living in the Northern Territory, Australia, have high rates of bacterial infections. This study describes changes in the epidemiology of childhood bacterial meningitis and the distribution of the burden of disease in the Top End. A retrospective review of cases derived from hospital medical records and laboratory data was performed. Inclusion criteria were children aged 3 months to 14 years of age, admitted to Royal Darwin Hospital between 1992 and 2014 and diagnosed with bacterial meningitis. Annual incidence of bacterial meningitis and the distribution of causative pathogens are described. Demographic data, investigations, treatment and outcomes were compared between Indigenous and non-Indigenous children. There were 137 cases of childhood bacterial meningitis identified over the 23-year period. The incidence reduced from 21 per 100 000 children per year for 1992-2002 to 11 per 100 000 per year for 2003-2014 (P = 0.0025). Haemophilus influenzae type b, Streptococcus pneumoniae and Neisseria meningitidis were the most common causative organisms, with a reduction in cases for each pathogen observed across the study period. Indigenous children were over-represented (104/137, 76%). Case fatality rate was 8% (11/137) 91% of fatal cases presented to a remote facility. The incidence of childhood bacterial meningitis has declined in the Northern Territory of Australia, but Indigenous children are disproportionately affected. Routine immunisation is beneficial for all, although further efforts to 'Close the Gap' between health outcomes in Indigenous and non-Indigenous Australians is required.
Publisher: Elsevier BV
Date: 2020
Publisher: AMPCo
Date: 19-11-2019
DOI: 10.5694/MJA2.50423
Publisher: Oxford University Press (OUP)
Date: 11-04-2014
DOI: 10.1093/CID/CIU227
Publisher: American Society for Microbiology
Date: 02-2014
DOI: 10.1128/JCM.02239-13
Abstract: The Darwin Prospective Melioidosis Study has documented 785 melioidosis cases over 23 years. Recurrent melioidosis occurred in 39/679 (5.7%) patients surviving initial infection 29 patients suffered relapse of the original infection, and 10 presented with a new Burkholderia pseudomallei infection. With improved therapy, relapse has become rare in recent years.
Publisher: Oxford University Press (OUP)
Date: 08-11-2016
DOI: 10.1093/JAC/DKW422
Abstract: Knowledge of contemporary epidemiology of candidaemia is essential. We aimed to identify changes since 2004 in incidence, species epidemiology and antifungal susceptibilities of Candida spp. causing candidaemia in Australia. These data were collected from nationwide active laboratory-based surveillance for candidaemia over 1 year (within 2014-2015). Isolate identification was by MALDI-TOF MS supplemented by DNA sequencing. Antifungal susceptibility testing was performed using Sensititre YeastOne™. A total of 527 candidaemia episodes (yielding 548 isolates) were evaluable. The mean annual incidence was 2.41/105 population. The median patient age was 63 years (56% of cases occurred in males). Of 498 isolates with confirmed species identity, Candida albicans was the most common (44.4%) followed by Candida glabrata complex (26.7%) and Candida parapsilosis complex (16.5%). Uncommon Candida species comprised 25 (5%) isolates. Overall, C. albicans (>99%) and C. parapsilosis (98.8%) were fluconazole susceptible. However, 16.7% (4 of 24) of Candida tropicalis were fluconazole- and voriconazole-resistant and were non-WT to posaconazole. Of C. glabrata isolates, 6.8% were resistant/non-WT to azoles only one isolate was classed as resistant to caspofungin (MIC of 0.5 mg/L) by CLSI criteria, but was micafungin and anidulafungin susceptible. There was no azole/echinocandin co-resistance. We report an almost 1.7-fold proportional increase in C. glabrata candidaemia (26.7% versus 16% in 2004) in Australia. Antifungal resistance was generally uncommon, but azole resistance (16.7% of isolates) amongst C. tropicalis may be emerging.
Publisher: American Society for Microbiology
Date: 06-04-2017
Abstract: We report here paired isogenic Burkholderia pseudomallei genomes obtained from three patients receiving intravenous meropenem for melioidosis treatment, with post-meropenem isolates developing decreased susceptibility. Two genomes were finished, and four were drafted to improved high-quality standard. These genomes will be used to identify meropenem resistance mechanisms in B. pseudomallei .
Publisher: American Society for Microbiology
Date: 12-2012
DOI: 10.1128/JCM.02195-12
Abstract: Streptococcus pyogenes is commonly believed to be resistant to trimethoprim-sulfamethoxazole (SXT), resulting in reservations about using SXT for skin and soft tissue infections (SSTI) where S. pyogenes is involved. S. pyogenes ' in vitro susceptibility to SXT depends on the medium's thymidine content. Thymidine allows S. pyogenes to bypass the sulfur-mediated inhibition of folate metabolism and, historically, has resulted in apparently reduced susceptibility of S. pyogenes to sulfur antibacterials. The low thymidine concentration in Mueller-Hinton agar (MHA) is now regulated. We explored S. pyogenes susceptibility to SXT on various media. Using two sets of 100 clinical S. pyogenes isolates, we tested for susceptibility using SXT Etests on MHA containing defibrinated horse blood and 20 mg/liter β-NAD (MHF), MHA with sheep blood (MHS), MHA alone, MHA with horse blood (MHBA), and MHA with lysed horse blood (MHLHBA). European Committee on Antibacterial Susceptibility Testing (EUCAST) breakpoints defined susceptibility (MIC, ≤1 mg/liter) and resistance (MIC, mg/liter). In study 1, 99% of S. pyogenes isolates were susceptible to SXT on MHA, MHBA, and MHLHBA, with geometric mean MICs of 0.04, 0.04, and 0.05 mg/liter, respectively. In study 2, all 100 S. pyogenes isolates were susceptible to SXT on MHF, MHS, MHA, and MHLHBA with geometric mean MICs of 0.07, 0.16, 0.07, and 0.09 mg/liter, respectively. This study confirms the in vitro susceptibility of S. pyogenes to SXT, providing support for the use of SXT for SSTIs. A clinical trial using SXT for impetigo is ongoing.
Publisher: Cambridge University Press (CUP)
Date: 21-04-2020
DOI: 10.1017/DMP.2019.128
Abstract: Clinical diagnostics in sudden onset disasters have historically been limited. We set out to design, implement, and evaluate a mobile diagnostic laboratory accompanying a type 2 emergency medical team (EMT) field hospital. Available diagnostic platforms were reviewed and selected against in field need. Platforms included HemoCue301/WBC DIFF, i-STAT, BIOFIRE FILMARRAY multiplex rt-PCR, Olympus BX53 microscopy, ABO/Rh grouping, and specific rapid diagnostic tests. This equipment was trialed in Katherine, Australia, and Dili, Timor-Leste. During the initial deployment, an evaluation of FilmArray tests was successful using blood culture identification, gastrointestinal, and respiratory panels. HemoCue301 (n = 20) hemoglobin values were compared on Sysmex XN 550 (r = 0.94). HemoCue WBC DIFF had some variation, dependent on the cell, when compared with Sysmex XN 550 (r = 0.88-0.16). i-STAT showed nonsignificant differences against Vitros 250. Further evaluation of FilmArray in Dili, Timor-Leste, diagnosed 117 pathogens on 168 FilmArray pouches, including 25 separate organisms on blood culture and 4 separate cerebrospinal fluid pathogens. This mobile laboratory represents a major advance in sudden onset disaster. Setup of the service was quick ( 24 hr) and transport to site rapid. Future deployment in fragmented health systems after sudden onset disasters with EMT2 will now allow broader diagnostic capability.
No related grants have been discovered for robert baird.