ORCID Profile
0000-0002-5332-1858
Current Organisation
Queensland University of Technology
Does something not look right? The information on this page has been harvested from data sources that may not be up to date. We continue to work with information providers to improve coverage and quality. To report an issue, use the Feedback Form.
Research Topics
In Research Link Australia (RLA), "Research Topics" refer to ANZSRC FOR and SEO codes. These topics are either sourced from ANZSRC FOR and SEO codes listed in researchers' related grants or generated by a large language model (LLM) based on their publications.
Top 5 Research Topics
ANZSRC Field of Research (FoR)
Microbiology | Microbiology Not Elsewhere Classified | Microbial Systematics, Taxonomy And Phylogeny | Biological Sciences Not Elsewhere Classified | Other Biological Sciences | Enzymes | Microbial Ecology | Environmental Technologies | Genetic Technologies: Transformation, Site-Directed Mutagenesis, Etc. |
ANZSRC Socio-Economic Objective (SEO)
Land and water management | Water services and utilities | Infectious diseases | Agricultural chemicals not elsewhere classified | Higher education | Biological sciences | Inherited diseases (incl. gene therapy) | Other
Related Links
Publications
Isolation of anaerobic, extremely thermophilic, sulphur metabolising archaebacteria from new zealand hot springs
Publisher: Informa UK Limited
Date: 09-1986
Biodegradation of beta-cyfluthrin by Pseudomonas stutzeri strain S1
Publisher: Springer Science and Business Media LLC
Date: 12-2005
DOI: 10.1007/S10532-005-0211-4
Abstract: beta-Cyfluthrin [alpha-cyano-4-fluoro-3-phenoxybenzyl-3(2,2-dichlorovinyl)-2,2-dimethylcyclopropane carboxylate] pesticide has been in agricultural use in the recent years for controlling Lepidopteran pests affecting solanaceous crops. The extensive use of synthetic pyrethroids like beta-cyfluthrin has resulted in wide spread environmental contamination. The purpose of this study was to isolate bacteria from soil and to determine their ability to degrade beta-cyfluthrin and identify the intermediates in culture broth using spectroscopy. An aerobic bacterium capable of degrading beta-cyfluthrin was isolated by enrichment culture. The 16S ribosomal DNA sequence of the isolate (strain S1) had 100% identity to the sequence from Pseudomonas stutzeri. Finally products formed during degradation of beta-cyfluthrin have been identified as alpha-cyano-4-fluoro-3-phenoxybenzyl-3(2,2-dichlorovinyl)-2,2-dimethylcyclopropane carboxylate (M.W. 341) 4-fluoro-3-phenoxy-alpha-cyanobenzyl alcohol (M.W. 243) and 3(2,2-dichlorovinyl)-2,2-dimethyl cyclopropanecarboxylic acid (M.W. 208).
Mahella australiensis gen. nov., sp. nov., a moderately thermophilic anaerobic bacterium isolated from an Australian oil well
Publisher: Microbiology Society
Date: 11-2004
Abstract: A novel Gram-positive, anaerobic and moderately thermophilic bacterium, strain 50-1 BON T , was isolated from an Australian terrestrial oil reservoir. Cells were spore-forming straight rods, motile by peritrichous flagella. The optimum growth conditions were 50 °C, pH 7·5 and 0·1 % NaCl. Strain 50-1 BON T fermented arabinose, cellobiose, fructose, galactose, glucose, mannose, sucrose, xylose and yeast extract. Glucose was fermented mainly into lactate, formate, hydrogen and CO 2 . The major end product of pyruvate fermentation was acetate together with H 2 and CO 2 . Thiosulfate, sulfate, elemental sulfur and nitrate were not used as terminal electron acceptors. The DNA G+C content was 55·5 mol%. The closest phylogenetic relative of strain 50-1 BON T was Thermoanaerobacterium thermosulfurigenes (16S rRNA gene sequence similarity of 85·7 %). As strain 50-1 BON T was physiologically and phylogenetically different from members of the order ‘ Thermoanaerobacteriales ’, it is proposed that strain 50-1 BON T (=DSM 15567 T =CIP 107919 T ) be classified as the type strain of a novel species of a new genus, Mahella australiensis gen. nov., sp. nov.
Dictyoglomia class. nov.
Publisher: Wiley
Date: 14-09-2015
DOI: 10.1002/9781118960608.CBM00024
Abstract: Dic.ty.o.glo'mi.a. N.L. n. Dictyoglomus type genus of the type order of the class suff. ‐ ia ending proposed by Gibbons and Murray and by Stackebrandt et al. to denote a class N.L. neut. pl. n. Dictyoglomia the class of the order Dictyoglomales . Dictyoglomi / Dictyoglomia
Desulfohalobium Ollivier, Hatchikian, Prensier, Guezennec and Garcia 1991, 78 VP
Publisher: Springer-Verlag
Date: 2005
Seven novel species of Acinetobacter isolated from activated sludge
Publisher: Microbiology Society
Date: 07-2003
Abstract: Thirteen isolates of Acinetobacter were obtained from activated sludge plants in Victoria, Australia. Earlier 16S-23S rDNA genomic fingerprinting and partial 16S rDNA sequence data had suggested that these isolates might contain previously undescribed species. This view was confirmed here. A polyphasic taxonomic approach involving phenotypic characterization, near-complete 16S rDNA sequence data and DNA-DNA hybridization analyses support the view that seven novel genomic species can be differentiated in this group of isolates. However, when fluorescence in situ hybridization (FISH) studies were performed with a 16S-rRNA-targeted probe specific for the genus Acinetobacter, used to identify Acinetobacter in activated sludge plants, all these strains responded positively. This suggests that these isolates would not have been missed in earlier FISH studies where their role as polyphosphate-accumulating bacteria has been questioned. This report describes these isolates and proposes that they be named Acinetobacter baylyi (type strain B2T = DSM 14961T = CIP 107474T), Acinetobacter bouvetii (type strain 4B02T = DSM 14964T = CIP 107468T), Acinetobacter grimontii (type strain 17A04T = DSM 14968T = CIP 107470T), Acinetobacter tjernbergiae (type strain 7N16T = DSM 14971T = CIP 107465T), Acinetobacter towneri (type strain AB1110T = DSM 14962T = CIP 107472T), Acinetobacter tandoii (type strain 4N13T = DSM 14670T = CIP 107469T) and Acinetobacter gerneri (type strain 9A01T = DSM 14967T = CIP 107464T).
Peptide and amino acid oxidation in the presence of thiosulfate by members of the genus Thermoanaerobacter
Publisher: Springer Science and Business Media LLC
Date: 09-1995
DOI: 10.1007/BF00293546
Dethiosulfovibrio salsuginis sp. nov., an anaerobic, slightly halophilic bacterium isolated from a saline spring
Publisher: Microbiology Society
Date: 04-2010
Abstract: A mesophilic, strictly anaerobic, slightly halophilic bacterium, designated strain USBA 82 T , was isolated from a terrestrial saline spring in the Colombian Andes. The non-spore-forming curved rods (5–7×1.3 μm) with pointed or rounded ends, stained Gram-negative and were motile by means of laterally inserted flagella. The strain grew optimally at 30 °C (growth range 20–40 °C), pH 7.3 (growth range pH 5.5–8.5) and 2 % (w/v) NaCl (growth range 0.1–7 % NaCl). The strain fermented peptides, amino acids and a few organic acids, but growth was not observed on carbohydrates, alcohols or fatty acids. The strain reduced thiosulfate and sulfur to sulfide. Sulfate, sulfite, nitrate and nitrite were not used as electron acceptors. On peptone alone, acetate, succinate, propionate and traces of ethanol were formed, but in the presence of thiosulfate, acetate and succinate were formed. The G+C content of the chromosomal DNA was 52 mol% ( T m ).16S rRNA gene sequence analysis indicated that strain USBA 82 T was affiliated to Dethiosulfovibrio peptidovorans within the phylum Synergistetes with a similarity value of approximately 93 %. Based on the differences between the new strain and the type species of the genus Dethiosulfovibrio , we suggest that strain USBA 82 T represents a novel species of the genus for which the name Dethiosulfovibrio salsuginis sp. nov. is proposed. The type strain is USBA 82 T (=DSM 21565 T =KCTC 5659 T ).
Caloramator mitchellensis sp. nov., a thermoanaerobe isolated from the geothermal waters of the Great Artesian Basin of Australia, and emended description of the genus Caloramator
Publisher: Microbiology Society
Date: 03-2011
Abstract: A strictly thermophilic anaerobe, designated strain VF08 T , was isolated from a water s le collected from a Great Artesian Basin bore (registered bore number 22981) situated at Mitchell, QLD, Australia. Cells of isolate VF08 T were slightly curved, non-sporulating rods (1.5–3.5×0.4–0.8 μm), which stained Gram-negative but possessed a Gram-positive cell-wall ultrastructure. The strain grew optimally in tryptone-yeast extract-glucose (TYEG) medium at 55 °C (temperature growth range between 37 and 60 °C) and a pH of 7 (pH growth range, 6.0–9.0). Yeast extract or tryptone was required for growth on glucose, fructose, xylose, maltose, sucrose, raffinose, cellobiose, ribose, pyruvate, tryptone, peptone, Casamino acids, amyl media and serine, but could also support growth as the sole carbon source. End products from glucose fermentation were acetate, ethanol, CO 2 and H 2 . The strain reduced vanadium(V), but not iron(III), manganese(IV), elemental sulfur, sulfate, thiosulfate, sulfite, nitrate or nitrite in the presence of 0.2 % yeast extract, peptone, tryptone, glucose, sucrose and Casamino acids, but an increase in the growth rate or cell yield was not observed. Growth was inhibited by chlor henicol, streptomycin, tetracycline, penicillin, icillin and ≥2 % NaCl (w/v). The G+C content of the DNA was 38.4±0.8 mol% as determined by the thermal denaturation ( T m ) method. 16S rRNA gene sequence analysis revealed that isolate VF08 T was a member of the genus Caloramator with Caloramator australicus and Caloramator fervidus (formerly Clostridium fervidus ) being the closest relatives with similarity values of 85.0 and 86.1 %, respectively, when helix 6 nucleotides were included in the analysis, and 95.2 % and 94 %, respectively, when these nucleotides were masked from the analysis. Further analysis revealed that strain VF08 T formed an in idual cluster (cluster II) within the genus Caloramator and could be distinguished from other species within the genus Caloramator (clusters I, III and IV) on the basis of signature nucleotides and differences in phenotypic traits. These data suggest that strain VF08 T is a novel species of the genus Caloramator , for which the name Caloramator mitchellensis sp. nov. is proposed. The type strain is VF08 T (=JCM 15828 T =KCTC 5735 T ). An emended description of the genus Caloramator is also provided.
Engineering a thermostable Halothermothrix orenii β-glucosidase for improved galacto-oligosaccharide synthesis
Publisher: Springer Science and Business Media LLC
Date: 12-2016
Isolation and characterization of a thermostable dextranase
Publisher: Elsevier BV
Date: 03-1997
The phylogenetic diversity of Thermus and Meiothermus from microbial mats of an Australian subsurface aquifer runoff channel
Publisher: Oxford University Press (OUP)
Date: 10-2004
DOI: 10.1016/J.FEMSEC.2004.05.008
Abstract: Spectral analysis of the cell free extracts of four mat s les colonizing a Great Artesian Bain (GAB) aquifer bore runoff channel suggested that Thermus was present in the 75 degrees C grey mat, Meiothermus was present in the 66 degrees C red mat, a mixed population of Meiothermus/Thermus and photosynthetic microbes were present in the 57 degrees C green mat and photosynthetic microbes were present in the 52 degrees C brown mat. Enumeration studies indicated that Thermus dominated the grey mats and Meiothermus dominated the red mat but both were absent in s les collected at the bore source (89 degrees C) and below the bore source (88 degrees C). Culture-dependent studies followed by 16S rRNA gene sequence analysis indicated that 13 of the 14 Thermus isolates clustered closely with each other and to T. igniterrae, with the remaining strain clustering with Thermus strain SRI-96. The two Meiothermus isolates were closely related to Meiothermus ruber. A culture-independent study with 367 16S rRNA gene clones concurred that Thermus dominated the grey mat, but to a lesser extent in the red mat and the green mats and its complete absence in the brown mat. Of the four Thermus phylogroups identified one phylogroup dominated the cloned library and was related to the cluster represented by T. scotoductus. The second most dominant phylogroup was related to the cluster represented by T. igniterrae and the third and fourth phylogroups, which were the least dominant, were related to cluster represented by Thermus strain SRI-248 and T. oshima respectively. Meiothermus was only represented in the 16S rRNA gene libraries of the red, green and brown mats and formed two phylogroups, of which the most dominant was associated with the red mat and phylogenetically related to M. ruber while the second phylogroup was found only in the green mat gene library and was related to M. cerberus.
Desulfocella Brandt, Patel and Ingvorsen 1999, 198VP
Publisher: Springer-Verlag
Date: 2005
Crystal structure of a fructokinase homolog from Halothermothrix orenii
Publisher: Elsevier BV
Date: 09-2010
DOI: 10.1016/J.JSB.2010.05.007
Abstract: Fructokinase (FRK EC 2.7.1.4) catalyzes the phosphorylation of d-fructose to d-fructose 6-phosphate (F6P). This irreversible and near rate-limiting step is a central and regulatory process in plants and bacteria, which channels fructose into a metabolically active state for glycolysis. Towards understanding the mechanism of FRK, here we report the crystal structure of a FRK homolog from a thermohalophilic bacterium Halothermothrixorenii (Hore_18220 in sequence databases). The structure of the Hore_18220 protein reveals a catalytic domain with a Rossmann-like fold and a beta-sheet "lid" for dimerization. Based on comparison of Hore_18220 to structures of related proteins, we propose its mechanism of action, in which the lid serves to regulate access to the substrate binding sites. Close relationship of Hore_18220 and plant FRK enzymes allows us to propose a model for the structure and function of FRKs.
Draft Genome Sequence of the 1,2-Dichloroethane-Utilizing Micrococcus sp. Strain NDB3Y10, Isolated from an Australian Bore Well Producing Coal Seam Gas
Publisher: American Society for Microbiology
Date: 27-04-2017
Abstract: Micrococcus luteus strain NDB3Y10, which utilizes 1,2-dichloroethane as a carbon source, was isolated from a bore well that produces coal seam gas. The draft genome size of the strain was 2.49 Mb with a G+C content of 72.97%. Genes involved in the metabolism of halogenated substrates, including halogenated hydrocarbons, were identified.
Microbiology of the ‘G‐bacteria’ in activated sludge
Publisher: Wiley
Date: 12-2000
DOI: 10.1046/J.1462-2920.2000.00153.X
Abstract: This review discusses a group of bacteria, the 'G-bacteria', which have a distinctive morphology of cocci in tetrads, sheets or clusters, that are seen in large numbers in many activated sludge biomass s les. Isolates of 'G-bacteria' that have been grown axenically are phylogenetically erse. The Gram-negative members include several alpha- and beta-proteobacteria, among which is the genus Amaricoccus, while the Gram-positive 'G-bacteria' contain several members of the actinobacteria. It is probable that other, as yet uncharacterized, 'G-bacteria' exist in activated sludge. The hypothesis that these 'G-bacteria' are detrimental to the process of enhanced biological phosphate removal by competing for substrates anaerobically with the phosphate-accumulating bacteria in such systems, based as it is largely on mixed-culture studies, receives little support from studies using those available in pure culture. The evidence on which these conclusions are founded is discussed, as are the arguments used to explain why these 'G-bacteria' all appear to thrive under conditions found in certain activated sludge systems.
Crystal Structure of the Polyextremophilic α-Amylase AmyB from Halothermothrix orenii: Details of a Productive Enzyme-Substrate Complex and an N Domain with a Role in Binding Raw Starch
Publisher: Elsevier BV
Date: 05-2008
DOI: 10.1016/J.JMB.2008.02.041
Abstract: The gene for a membrane-bound, halophilic, and thermostable alpha-amylase, AmyB, from Halothermothrix orenii was cloned and sequenced. The crystal structure shows that, in addition to the typical domain organization of family 13 glycoside hydrolases, AmyB carries an additional N-terminal domain (N domain) that forms a large groove--the N-C groove--some 30 A away from the active site. The structure of AmyB with the inhibitor acarbose at 1.35 A resolution shows that a nonasaccharide has been synthesized through successive transglycosylation reactions of acarbose. Unexpectedly, in a complex of wild-type AmyB with alpha-cyclodextrin and maltoheptaose at 2.2 A resolution, a maltotetraose molecule is bound in subsites -1 to +3, spanning the cleavage point at -1/+1, with the -1 glucosyl residue present as a (2)S(o) skew boat. This wild-type AmyB complex was obtained in the presence of a large excess of substrate, a condition under which it is possible to capture Michaelis complexes, which may explain the observed binding across -1/+1 and ring distortion. We observe three methionine side chains that serve as "binding platforms" for glucosyl rings in AmyB, a seemingly rare occurrence in carbohydrate-binding proteins. The structures and results from the biochemical characterization of AmyB and AmyB lacking the N domain show that the N domain increases binding of the enzyme to raw starch. Furthermore, theoretical modeling suggests that the N-C groove can accommodate, spatially and chemically, large substrates such as A-starch.
Clostridium thiosulfatireducens sp nov., a proteolytic, thiosulfate- and sulfur-reducing bacterium isolated from an upflow anaerobic sludge blanket (UASB) reactor
Publisher: Microbiology Society
Date: 09-2002
The hunt for the g-bacteria in activated sludge biomass
Publisher: IWA Publishing
Date: 1998
An improved method for purifying genomic DNA from forest leaf litters and soil suitable for PCR
Publisher: Springer Science and Business Media LLC
Date: 28-03-2009
Bacillus decisifrondis sp. nov., isolated from soil underlying decaying leaf foliage
Publisher: Microbiology Society
Date: 05-2007
Abstract: An aerobic bacterium, designated strain E5HC-32 T , was isolated from soil underlying the decaying leaf litter of a slash pine forest located in south east Queensland, Australia. The strictly aerobic, motile rod-shaped cells (0.8–1.6×2.6–4.8 μm) produced subterminal spherical spores which distended the cells. Strain E5HC-32 T grew optimally in 1 % trypticase soy broth (TSB) at 30 °C (temperature range for growth, 25–40 °C) and a pH of 8.4 (pH growth range, pH 7.1–9.1). Electron microscopic examination of negatively stained cells revealed the presence of peritrichous flagella and thin sections showed the presence of a typical Gram-positive type cell-wall ultrastructure. The strain was catalase-positive and oxidase-negative and metabolized pyruvic acid methyl ester, d -galactonic acid lactone, α -ketobutyric acid, α -ketovaleric acid, l -proline, l -alanine, urocanic acid, inosine, uridine, thymidine, glycerol, α -cyclodextrin, α - d -lactose, d -psicose, d -raffinose, l -rhamnose, d -sorbitol, turanose, cis -aconitic acid, α -hydroxybutyric acid, l -alaninamide and 2-aminoethanol. The G+C content of DNA was 41±1 mol% as determined by the thermal denaturation method. 16S rRNA gene sequence analysis revealed that strain E5HC-32 T was placed equidistantly as a member of the class Bacilli , phylum Firmicutes , with Bacillus sphaericus DSM 28 T and Bacillus odysseyi ATCC PTA-4993 T (similarity of 93 %). In addition to its significant phylogenetic separation from its nearest relatives, strain E5HC-32 T possessed phenotypic traits that also suggested that it represented a novel species, for which the name Bacillus decisifrondis sp. nov. is proposed. The type strain is E5HC-32 T (=JCM 13601 T =DSM 17725 T ).
Crystallization of an α-amylase, AmyA, from the thermophilic halophile Halothermothrix orenii
Publisher: International Union of Crystallography (IUCr)
Date: 26-11-2002
DOI: 10.1107/S0907444902015469
Abstract: This report is the first crystallographic study of an amylase from an organism that is both thermophilic and halophilic. alpha-Amylase from the thermophilic halophile Halothermothrix orenii (AmyA) is a 515-residue protein. It is stable and significantly active at 338 K in starch solution containing NaCl [up to 25%(w/v)]. Purified recombinant AmyA protein crystallizes in the orthorhombic space group P2(1)2(1)2(1), with unit-cell parameters a = 55.126, b = 61.658, c = 147.625 A, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 1.89 A.
Genetic characterization of a Neisseria meningitidis cluster in Queensland, Australia
Publisher: Canadian Science Publishing
Date: 07-2017
Abstract: Neisseria meningitidis serogroups B and C have been responsible for the majority of invasive meningococcal disease in Australia, with serogroup B strains causing an increasing proportion of cases in recent years. Serogroup Y has typically caused sporadic disease in Australia. In 2002, a cluster of 4 cases was reported from a rural region in Queensland. Three of these cases were serogroup C, with 1 case diagnosed by molecular detection only, and the fourth case was identified as a serogroup Y infection. Genomic analysis, including antigen finetyping, multilocus sequence typing (MLST), and core genome MLST, demonstrated that the serogroup Y case, though spatially and temporally linked to a serogroup C disease cluster, was not the product of a capsule switch and that one of the serogroup C isolates had a deletion of the entire porA sequence.
Fervidobacterium nodosum gen. nov. and spec. nov., a new chemoorganotrophic, caldoactive, anaerobic bacterium
Publisher: Springer Science and Business Media LLC
Date: 02-1985
DOI: 10.1007/BF00446741
Tistlia consotensis gen. nov., sp. nov., an aerobic, chemoheterotrophic, free-living, nitrogen-fixing alphaproteobacterium, isolated from a Colombian saline spring
Publisher: Microbiology Society
Date: 06-2010
Abstract: A Gram-negative, aerobic, mesophilic, non-spore-forming, chemotrophic, chlorophyll-lacking, nitrogen-fixing bacterium, designated strain USBA 355 T , was isolated from the saline spring ‘Salado de Consotá’ situated in the Colombian Andes. The non-flagellated cells of strain USBA 355 T were straight to slightly curved rods (0.6–0.7 × 3.0–3.5 μm). Growth occurred optimally at 30 °C (growth temperature range between 20 and 40 °C), at pH 6.5–6.7 (pH growth range between 5.0 and 8.0) and at 0.5 % NaCl (w/v) (range between 0 and 4 %). The major quinone present was Q-10 and the predominant fatty acids identified were C 19 : 0 cyclo ω 8 c , C 18 : 1 ω 7 c and C 18 : 0 . The G+C content of the chromosomal DNA was 71±1 mol%. 16S rRNA gene sequence analysis indicated that strain USBA 355 T formed a distant phylogenetic line of descent with members of the genus Thalassobaculum , family Rhodospirillaceae , class Alphaproteobacteria (90 % gene sequence similarity). Comparison of the phylogenetic, chemotaxonomic and physiological features of strain USBA 355 T with all other members of the family Rhodospirillaceae suggested that it represents a novel genus and species for which the name Tistlia consotensis gen. nov., sp. nov. is proposed. The type strain of the type species is USBA 355 T (=JCM 15529 T =KCTC 22406 T ).
High-resolution crystal structure of a polyextreme GH43 glycosidase from Halothermothrix orenii with α-l-arabinofuranosidase activity
Publisher: International Union of Crystallography (IUCr)
Date: 19-02-2015
DOI: 10.1107/S2053230X15003337
Abstract: A gene from the heterotrophic, halothermophilic marine bacterium Halothermothrix orenii has been cloned and overexpressed in Escherichia coli . This gene encodes the only glycoside hydrolase of family 43 (GH43) produced by H. orenii . The crystal structure of the H. orenii glycosidase was determined by molecular replacement and refined at 1.10 Å resolution. As for other GH43 members, the enzyme folds as a five-bladed β-propeller. The structure features a metal-binding site on the propeller axis, near the active site. Based on thermal denaturation data, the H. orenii glycosidase depends on alent cations in combination with high salt for optimal thermal stability against unfolding. A maximum melting temperature of 76°C was observed in the presence of 4 M NaCl and Mn 2+ at pH 6.5. The gene encoding the H. orenii GH43 enzyme has previously been annotated as a putative α-L-arabinofuranosidase. Activity was detected with p -nitrophenyl-α-L-arabinofuranoside as a substrate, and therefore the name Ho Araf43 was suggested for the enzyme. In agreement with the conditions for optimal thermal stability against unfolding, the highest arabinofuranosidase activity was obtained in the presence of 4 M NaCl and Mn 2+ at pH 6.5, giving a specific activity of 20–36 µmol min −1 mg −1 . The active site is structurally distinct from those of other GH43 members, including arabinanases, arabinofuranosidases and xylanases. This probably reflects the special requirements for degrading the unique biomass available in highly saline aqueous ecosystems, such as halophilic algae and halophytes. The amino-acid distribution of Ho Araf43 has similarities to those of mesophiles, thermophiles and halophiles, but also has unique features, for ex le more hydrophobic amino acids on the surface and fewer buried charged residues.
Efficacy of bacterial consortium-AIE2 for contemporaneous Cr(VI) and azo dye bioremediation in batch and continuous bioreactor systems, monitoring steady-state bacterial dynamics using qPCR assays
Publisher: Springer Science and Business Media LLC
Date: 11-06-2009
DOI: 10.1007/S10532-009-9269-8
Abstract: Bacterial consortium-AIE2 with a capability of contemporaneous Cr(VI) reduction and azo dye RV5 decolourization was developed from industrial wastewaters by enrichment culture technique. The 16S rRNA gene based molecular analyses revealed that the consortium bacterial community structure consisted of four bacterial strains namely, Alcaligenes sp. DMA, Bacillus sp. DMB, Stenotrophomonas sp. DMS and Enterococcus sp. DME. Cumulative mechanism of Cr(VI) reduction by the consortium was determined using in vitro Cr(VI) reduction assays. Similarly, the complete degradation of Reactive Violet 5 (RV5) dye was confirmed by FTIR spectroscopic analysis. Consortium-AIE2 exhibited simultaneous bioremediation efficiencies of (97.8 +/- 1.4) % and (74.1 +/- 1.2) % in treatment of both 50 mg l(-1) Cr(VI) and RV5 dye concentrations within 48 h of incubation at pH 7 and 37 degrees C in batch systems. Continuous bioreactor systems achieved simultaneous bioremediation efficiencies of (98.4 +/- 1.5) % and (97.5 +/- 1.4) % after the onset of steady-state at 50 mg l(-1) input Cr(VI) and 25 mg l(-1) input RV5 concentrations, respectively, at medium dilution rate (D) of 0.014 h(-1). The 16S rRNA gene copy numbers in the continuous bioreactor as determined by real-time PCR assay indicated that Alcaligenes sp. DMA and Bacillus sp. DMB dominated consortium bacterial community during the active continuous bioremediation process.
The Structure of Sucrose Phosphate Synthase from Halothermothrix orenii Reveals Its Mechanism of Action and Binding Mode
Publisher: Oxford University Press (OUP)
Date: 04-2008
Abstract: Sucrose phosphate synthase (SPS) catalyzes the transfer of a glycosyl group from an activated donor sugar, such as uridine diphosphate glucose (UDP-Glc), to a saccharide acceptor d-fructose 6-phosphate (F6P), resulting in the formation of UDP and d-sucrose-6′-phosphate (S6P). This is a central regulatory process in the production of sucrose in plants, cyanobacteria, and proteobacteria. Here, we report the crystal structure of SPS from the nonphotosynthetic bacterium Halothermothrix orenii and its complexes with the substrate F6P and the product S6P. SPS has two distinct Rossmann-fold domains with a large substrate binding cleft at the interdomain interface. Structures of two complexes show that both the substrate F6P and the product S6P bind to the A-domain of SPS. Based on comparative analysis of the SPS structure with other related enzymes, the donor substrate, nucleotide diphosphate glucose, binds to the B-domain of SPS. Furthermore, we propose a mechanism of catalysis by H. orenii SPS. Our findings indicate that SPS from H. orenii may represent a valid model for the catalytic domain of plant SPSs and thus may provide useful insight into the reaction mechanism of the plant enzyme.
Real-time homogeneous assay of rapid cycle polymerase chain reaction product for identification of Leptonema illini
Publisher: Elsevier BV
Date: 05-1998
Abstract: Partial 16S rDNA sequences of eight Leptospira-like field isolates that reacted weakly or not at all to microscope agglutination test were found to be similar to the 16S rDNA sequence of the nonpathogen Leptonema illini-type strain 3055. Comparison of these sequences with those of Leptospira 16S rDNA sequences revealed a Leptonema species signature sequence for which a forward lification primer was designed. This primer was used in conjunction with a bacterial-specific 16S rDNA universal reverse primer for developing a LightCycler-based rapid PCR protocol in which fluorescence emission due to the binding of SYBR green I dye to the lified products was continuously monitored. A melting temperature (T(m)) determined from the melting curve of the lified product immediately after PCR confirmed that the product was of Leptonema. The protocol for 24 s les consisting of 30 PCR cycles and melting curve acquisitions required 30 min to complete and agarose gel electrophoresis of the PCR products was not necessary. The method was specific as PCR products were detected from the seven Leptonema reference strains and the eight field isolates that had been previously verified as Leptonema by 16S rDNA sequencing, but not from the two representative strains from each of the eight Leptospira genospecies tested.
Draft Genome Sequence of Caloramator mitchellensis, a Thermoanaerobe Isolated from the Waters of the Great Artesian Basin
Publisher: American Society for Microbiology
Date: 25-02-2016
Abstract: The genome sequence of Caloramator mitchellensis strain VF08, a rod-shaped, heterotrophic, strictly anaerobic bacterium isolated from the free-flowing waters of a Great Artesian Basin (GAB) bore well located in Mitchell, an outback Queensland town in Australia, is reported here. The analysis of the 2.42-Mb genome sequence indicates that the attributes of the genome are consistent with its physiological and phenotypic traits.
Rapid detection and differentiation of pathogenic Campylobacter jejuni and Campylobacter coli by real-time PCR
Publisher: Elsevier BV
Date: 2005
DOI: 10.1016/J.RESMIC.2004.08.008
Abstract: A two-tube real-time assay, developed in a LightCycler, was used to detect, identify and differentiate C ylobacter jejuni and C ylobacter coli from all other pathogenic members of the family C ylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5'-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3') and a universal downstream probe Cy5 (5'-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO(4)-3'), to the 681-base pair 16S rRNA gene licon target (Escherichia coli position 1024-1048 and 1050-1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E. coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E. coli position 1464), detected C. coli, C. lari and C. jejuni. As expected, a Tm of 65 degrees C was derived from the temperature-dependent probe DNA strand disassociation. In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA licons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C. jejuni but not for C. coli which lacks the hipO gene. A Tm of 85+/-0.5 and 56 degrees C determined from temperature-dependent dye-DNA disassociation identified C. jejuni and the non-specific PCR products, respectively, in line with our expectation. The two-tube assay was subsequently used to identify and differentiate the 169 C ylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C. coli (74 isolates), C. jejuni (86 isolates) and non-C. coli-C. jejuni (9 isolates). In addition, the method successfully detected C. jejuni, C. coli and C. lari from 24-h enrichment cultures initiated from 30 commercial chicken s les.
Draft Genome Sequence of Paenibacillus Strain P1XP2, a Polysaccharide-Degrading, Thermophilic, Facultative Anaerobic Bacterium Isolated from a Commercial Bioreactor Degrading Food Waste
Publisher: American Society for Microbiology
Date: 26-02-2015
Abstract: The analysis of the ~5.8-Mb draft genome sequence of a moderately thermophilic, heterotrophic, facultative anaerobic bacterium, Paenibacillus strain P1XP2, identified genes for enzymes with the potential for degrading complex food wastes, a property consistent with the ecological habitat of the isolate.
Draft genome sequence of Caloramator australicus strain RC3T, a thermoanaerobe from the Great Artesian Basin of Australia
Publisher: American Society for Microbiology
Date: 15-05-2011
DOI: 10.1128/JB.00193-11
Abstract: Caloramator australicus strain RC3 T (JCM 15081 T = KCTC 5601 T ) is the type strain of a newly identified thermophilic species, which was isolated from red microbial mats that thrive at 66°C in the runoff channel of a Great Artesian Basin bore (New Lorne bore, registered number 17263) in outback Queensland, Australia. The ability of the C. australicus strain to use metals as terminal electron acceptors has led to concerns that it could colonize and enhance corrosion of the metal casing of Great Artesian Basin bore well pipes and that this could subsequently lead to bore failure and loss of water availability for the community which is so reliant on it. The genome of the C. australicus strain has been sequenced, and annotation of the ∼2.65-Mb sequence indicates that the attributes are consistent with physiological and phenotypic traits.
Geoalkalibacter subterraneus sp. nov., an anaerobic Fe(III)- and Mn(IV)-reducing bacterium from a petroleum reservoir, and emended descriptions of the family Desulfuromonadaceae and the genus Geoalkalibacter
Publisher: Microbiology Society
Date: 04-2009
Abstract: A strictly anaerobic Fe(III)-reducing bacterium, designated strain Red1(T), was isolated from the production water of the Redwash oilfield, USA. The cells were motile rods (1-5x0.5-0.6 microm) that stained Gram-negative and possessed polar flagella. Strain Red1(T) obtained energy from the reduction of Fe(III), Mn(IV), nitrate, elemental sulfur and trimethylamine N-oxide in the presence of a wide range of electron donors, including a variety of organic acids, alcohols, biological extracts and hydrogen. Strain Red1(T) was incapable of fermentative growth. The novel isolate grew optimally at 40 degrees C (temperature range for growth, 30-50 degrees C) and at pH 7 (pH range, 6-9) with 2 % (w/v) NaCl (NaCl range, 0.1-10 %, w/v). The DNA G+C content was 52.5 mol%. Phylogenetic analysis of the 16S rRNA gene sequence indicated that strain Red1(T) was a member of the order Desulfuromonadales within the class Deltaproteobacteria and most closely related to Geoalkalibacter ferrihydriticus Z-0531(T) (95.8 %), Desulfuromonas palmitatis SDBY1(T) (92.5 %) and 'Desulfuromonas michiganensis' BB1 (92.4 %). On the basis of phenotypic and phylogenetic differences, the novel strain is proposed to represent a novel species, Geoalkalibacter subterraneus sp. nov. (type strain Red1(T)=JCM 15104(T)=KCTC 5626(T)).
A hot topic: thermophilic plastic biodegradation
Publisher: Elsevier BV
Date: 09-2023
Bacillus okhensis sp. nov., a halotolerant and alkalitolerant bacterium from an Indian saltpan
Publisher: Microbiology Society
Date: 05-2006
Abstract: A strictly aerobic, rod-shaped bacterium (0.6–0.8×2–3 μm), designated strain Kh10-101 T , was isolated from a saltpan (22° 15′ N, 69° 1′ E) in the vicinity of Port Okha, India. The creamish pigmented colonies of strain Kh10-101 T were round, flat and translucent with irregular margins and a smooth surface. The strain possessed up to three subpolar flagella, and was motile by a corkscrew motion. The strain grew optimally at 37 °C (temperature growth range 25–40 °C) in a complex glucose-containing medium with 5 % NaCl (NaCl growth range 0–10 %) at pH 9 (pH growth range pH 7–10), indicating that it was a mesophilic halotolerant alkaliphile. The strain was sensitive to lincomycin, meticillin, cefuroxime and cephalexin, but resistant to gentamicin, tetracycline and cotrimazine. Spores were not detected and cells were heat sensitive. The isolate metabolized a range of carbohydrates and hydrolysed casein, gelatin and starch. Growth was not observed on aromatic compounds, Tween 40 or Tween 80. Nitrate was not reduced and catalase was produced. Electron microscopic examination of thin sections revealed a single thick Gram-positive cell wall. The DNA G+C content was 41±1 mol%. Phylogenetic analyses of the 16S rRNA gene sequence revealed that strain Kh10-101 T was a member of the sixth rRNA group of the genus Bacillus , which includes alkalitolerant, alkaliphilic and halotolerant species. The halotolerant obligate alkaliphile Bacillus krulwichiae is the closest relative of strain Kh10-101 T (96 % similarity) but a number of phenotypic differences suggest that strain Kh10-101 T (=JCM 13040 T =ATCC BAA-1137 T ) should be designated the type strain of a new species, for which the name Bacillus okhensis sp. nov. is proposed.
Exploring the Ecology of Thermophiles from Australia’s Great Artesian Basin During the Genomic Era
Publisher: Springer Netherlands
Date: 2013
Expression, purification and preliminary crystallographic analysis of sucrose phosphate synthase (SPS) from Halothermothrix orenii
Publisher: International Union of Crystallography (IUCr)
Date: 24-12-2005
Microbial community in a geothermal aquifer associated with the subsurface of the Great Artesian Basin, Australia
Publisher: Springer Science and Business Media LLC
Date: 25-06-2005
DOI: 10.1007/S00792-005-0454-3
Abstract: To investigate the biomass and phylogenetic ersity of the microbial community inhabiting the deep aquifer of the Great Artesian Basin (GAB), geothermal groundwater gushing out from the aquifer was s led and analyzed. Microbial cells in the groundwater were stained with acridine orange and directly counted by epifluorescence microscopy. Microbial cells were present at a density of 10(8)-10(9) cells per liter of groundwater. Archaeal and bacterial small-subunit rRNA genes (rDNAs) were lified by PCR with Archaea- and Bacteria-specific primer sets, and clone libraries were constructed separately. A total of 59 clones were analyzed in archaeal and bacterial 16S rDNA libraries, respectively. The archaeal 16S rDNA clones were ided into nine operated taxonomic units (OTUs) by restriction fragment length polymorphism. These OTUs were closely related to the methanogenic genera Methanospirillum and Methanosaeta, the heterotrophic genus Thermoplasma, or miscellaneous crenarchaeota group. More than one-half of the archaeal clones (59% of total 59 clones) were placed beside phylogenetic clusters of methanogens. The majority of the methanogen-related clones (83%) was closely related to a group of hydrogenotrophic methanogens (genus Methanospirillum). The bacterial OTUs branched into seven phylogenetic clusters related to hydrogen-oxidizing thermophiles in the genera Hydrogenobacter and Hydrogenophilus, a sulfate-reducing thermophile in the genus Thermodesulfovibrio, chemoheterotropic bacteria in the genera Thermus and Aquaspirillum, or the candidate ision OP10. Clones closely related to the thermophilic hydrogen-oxidizers in the genera Hydrogenobacter and Hydrogenophilus were dominant in the bacterial clone library (37% of a total of 59 clones). The dominancy of hydrogen-users strongly suggested that H(2) plays an important role as a primary substrate in the microbial ecosystem of this deep geothermal aquifer.
Thermotalea metallivorans gen. nov., sp. nov., a thermophilic, anaerobic bacterium from the Great Artesian Basin of Australia aquifer
Publisher: Microbiology Society
Date: 30-04-2009
Abstract: A strictly anaerobic, thermophilic bacterium, designated strain B2-1(T), was isolated from microbial mats colonizing a runoff channel formed by free-flowing thermal water from a Great Artesian Basin, Australia, bore well (registered number 17263). The cells of strain B2-1(T) were slightly curved rods (3.0-3.5 x 0.6-0.7 microm) which stained Gram-negative. The strain grew optimally in tryptone-yeast extract-glucose medium at 50 degrees C (temperature growth range 30-55 degrees C) and a pH of 8 (pH growth range 6.5-9). Strain B2-1(T) grew poorly on yeast extract (0.2 %) and/or tryptone (0.2 %), which were obligately required for growth on other energy sources, including a range of other carbohydrates and organic acids, but not amino acids. The end-products of glucose fermentation were ethanol and acetate. In the presence of 0.2 % yeast extract, iron(III), manganese(IV) and elemental sulfur were reduced but sulfate, thiosulfate, sulfite, nitrate and nitrite were not reduced. Growth was inhibited by chlor henicol, streptomycin, tetracycline, penicillin, icillin, sodium azide and by NaCl concentrations greater than 4 % (w/v). The DNA G+C content was 48+/-1 mol% as determined by the thermal denaturation method. 16S rRNA gene sequence analysis indicated that strain B2-1(T) was a member of the family Clostridiaceae, class Clostridia, phylum Firmicutes and was most closely related to Geosporobacter subterraneus DSM 17957(T) (89.9 % similarity). On the basis of 16S rRNA gene sequence comparisons and physiological characteristics, strain B2-1(T) is considered to represent a novel species of a new genus, for which the name Thermotalea metallivorans gen. nov., sp. nov. is proposed. The type strain is B2-1(T) (=KCTC 5625(T)=JCM 15105(T)=DSM 21119(T)).
Taxonomic phylogenetic and ecological diversity of methanogenic Archaea
Publisher: Elsevier BV
Date: 08-2000
Amylase and 16S rRNA genes from a hyperthermophilic archaebacterium.
Publisher: Oxford University Press (OUP)
Date: 1999
DOI: 10.1046/J.1365-2672.1999.00642.X
Abstract: A hyperthermophilic and amylolytic prokaryote, designated Rt3, was isolated from a thermal spring near Rotorua, New Zealand. The 16S rRNA gene of Rt3 was cloned and sequenced with the aim of determining its phylogenetic affiliations. The phylogenetic analysis of this sequence, which included a selection of archaebacterial and eubacterial 16S rRNA sequences, indicates that Rt3 most likely belongs to the archaebacterial order Thermococcales. An amylase gene (amyA) from Rt3, encoding a highly thermostable amylase activity, was cloned and its DNA sequence determined. Transcriptional signals typical of archaebacteria were evident in this sequence. The sequence is homologous to a broad range of enzymes from the AMY superfamily and contains a typical N-terminal signal peptide. Phylogenetic analysis and comparison of structural features with other AMY superfamily enzymes reveals that, firstly, the closest homologues of the Rt3 amylase are members of the Bacillus and Plant alpha-amylase groups and secondly, that the Rt3 amylase is closely related to only one other currently known archaebacterial enzyme, i.e. an (AMY superfamily) alpha-amylase from Natronococcus.
Frondicola australicus gen. nov., sp. nov., isolated from decaying leaf litter from a pine forest
Publisher: Microbiology Society
Date: 06-2007
Abstract: An aerobic bacterium, designated strain E1HC-02 T , was isolated from the decaying leaf litter of a slash pine forest located in southeast Queensland, Australia. Cells of strain E1HC-02 T were short irregular rods (0.5–1.0×0.2–0.4 μm) which stained Gram-positive and possessed a cell-wall ultrastructure which appeared to be made of protein subunits. The novel strain grew optimally in 1 % trypticase soy broth (TSB) at 25 °C and at a pH of 9.1. Strain E1HC-02 T metabolized a range of carbohydrates, organic acids and amino acids. The G+C content of the DNA was 71±1 mol% as determined by the thermal denaturation method. 16S rRNA gene sequence analysis of strain E1HC-02 T showed that it was a member of the family Microbacteriaceae , phylum Actinobacteria . The cell wall contained a type B2 β peptidoglycan, the dominant cellular fatty acid was 18 : 1 ω 7 c and the major hydroxy fatty acid was 2-OH 14 : 0. The major menaquinones were MK-8 (76 %) and MK-7 (24 %) and the glycolipids present were disphosphatidylglycerol, phosphatidylglycerol and three unidentified phospholipids. The chemotaxonomic properties of strain E1HC-02 T were distinctly different to all of the 17 genera of the family Microbacteriaceae and hence strain E1HC-02 T is designated as representing a novel species of a new genus, Frondicola australicus gen. nov., sp. nov. The type strain of the type species is E1HC-02 T (=JCM 13598 T =DSM 17894 T ).
Isolation from a shea cake digester of a tannin-degrading Streptococcus gallolyticus strain that decarboxylates protocatechuic and hydroxycinnamic acids, and emendation of the species
Publisher: Microbiology Society
Date: 05-2002
Desulfosoma caldarium gen. nov., sp. nov., a thermophilic sulfate-reducing bacterium from a terrestrial hot spring
Publisher: Microbiology Society
Date: 04-2011
Abstract: A thermophilic, sulfate-reducing bacterium, designated strain USBA-053 T , was isolated from a terrestrial hot spring located at a height of 2500 m in the Colombian Andes (5° 45′ 33.29″ N 73° 6′ 49.89″ W), Colombia. Cells of strain USBA-053 T were oval- to rod-shaped, Gram-negative and motile by means of a single polar flagellum. The strain grew autotrophically with H 2 as the electron donor and heterotrophically on formate, propionate, butyrate, valerate, isovalerate, lactate, pyruvate, ethanol, glycerol, serine and hexadecanoic acid in the presence of sulfate as the terminal electron acceptor. The main end products from lactate degradation, in the presence of sulfate, were acetate, CO 2 and H 2 S. Strain USBA-053 T fermented pyruvate in the absence of sulfate and grew optimally at 57 °C (growth temperature ranged from 50 °C to 62 °C) and pH 6.8 (growth pH ranged from 5.7 to 7.7). The novel strain was slightly halophilic and grew in NaCl concentrations ranging from 5 to 30 g l −1 , with an optimum at 25 g l −1 NaCl. Sulfate, thiosulfate and sulfite were used as electron acceptors, but not elemental sulfur, nitrate or nitrite. The G+C content of the genomic DNA was 56±1 mol%. 16S rRNA gene sequence analysis indicated that strain USBA-053 T was a member of the class Deltaproteobacteria , with Desulfacinum hydrothermale MT-96 T as the closest relative (93 % gene sequence similarity). On the basis of physiological characteristics and phylogenetic analysis, it is suggested that strain USBA-053 T represents a new genus and novel species for which the name Desulfosoma caldarium gen. nov., sp. nov. is proposed. The type strain of the type species is USBA-053 T ( = KCTC 5670 T = DSM 22027 T ).
Metagenomic analysis of a freshwater toxic cyanobacteria bloom
Publisher: Oxford University Press (OUP)
Date: 04-2008
DOI: 10.1111/J.1574-6941.2008.00448.X
Abstract: High molecular weight (HMW) DNA prepared from a toxic freshwater cyanobacterial bloom s le was used to construct a PCR-generated 75-clone, 16S rRNA gene library and a 2850-clone bacterial artificial chromosome (BAC) library. Phylogenetic analysis of the 16S rRNA gene library demonstrated that members of eight phyla of domain Bacteria, which included Cyanobacteria, Actinobacteria, Verrucomicrobium, Bacteriodetes, Planctomycetes, Chloroflexi, Candidate Division OP10 and Alpha-, Beta- and Gammaproteobacteria, were present in the bloom community. Diversity estimates determined from 16S rRNA gene analysis and direct cell counts and morphological identification of phytoplanktons suggested that the bloom community was dominated by members of the genera Aphanizomenon and Cylindrospermopsis, phylum Cyanobacteria. BAC-end sequencing of 37 randomly selected clones and subsequent sequence analysis provided a snapshot of the total bloom community putative metabolic activities. The sequencing of the entire inserts of seven clones (clones designated 578, 67, 142, 543, 905, 1664 and 2089) selected from BAC-end sequence studies resulted in the generation of a total of 144-kb sequence data and in the identification of 130 genes for putative proteins representing at least four phyla, Proteobacteria, Actinobacteria, Bacteroidetes and Cyanobacteria. This is the first report on a snapshot analysis of a limited metagenome of a toxic cyanobacterial freshwater bloom.
Sporanaerobacter acetigenes gen. nov., sp nov., a novel acetogenic, facultatively sulfur-reducing bacterium
Publisher: Microbiology Society
Date: 07-2002
Dictyoglomales ord. nov
Publisher: Wiley
Date: 14-09-2015
DOI: 10.1002/9781118960608.OBM00046
Abstract: Dic'ty.o.glo.ma'les. N.L. neut. n. Dictyoglomus type genus of the order ‐ ales ending to denote an order N.L. fem. pl. n. Dictyoglomales the order of Dictyoglomus . Dictyoglomi / Dictyoglomia / Dictyoglomales
Isolation of Clostridium bifermentans from Oil Mill Wastewaters Converting Cinnamic Acid to 3-phenylpropionic Acid and Emendation of the Species
Publisher: Elsevier BV
Date: 08-2001
Crystal structure of AmyA lacks acidic surface and provide insights into protein stability at poly-extreme condition
Publisher: Wiley
Date: 19-04-2006
DOI: 10.1016/J.FEBSLET.2006.04.017
Abstract: Here we report the first crystal structure of a protein, AmyA, a secretory alpha-amylase isolated from Halothermothrix orenii, which is both halophilic and thermophilic. The crystal structure was determined at 1.6 A resolution. AmyA lacks the conserved acidic surface, which is considered essential for protein stability at high salinity. Sedimentation velocity and CD experiments on AmyA reveal the formation of unique reversible poly-dispersed oligomers that show unusually high thermal stability. These studies provide valuable insight into the structural elements that contribute to the stability of AmyA at both physical and chemical extremes and their functional implications.
Unusual microorganisms observed in New Zealand hot springs
Publisher: Springer Science and Business Media LLC
Date: 06-1986
DOI: 10.1007/BF02011202
Halophiles: Anaerobic Prokaryotes from Hypersaline Environments
Publisher: Wiley
Date: 15-01-2003
DOI: 10.1002/0471263397.ENV167
Abstract: The Environments and Physicochemical Characteristics Characteristics, Taxonomy, and Phylogeny
Development of fluorescent adjacent hybridization probes and their application in real-time PCR for the simultaneous detection and identification of Fervidobacterium and Caloramator
Publisher: Microbiology Society
Date: 09-2002
Petrobacter succinatimandens gen. nov., sp. nov., a moderately thermophilic, nitrate-reducing bacterium isolated from Australian oil well
Publisher: Microbiology Society
Date: 05-2004
Abstract: A novel Gram-negative, aerobic and moderately thermophilic bacterium, strain 4BON T , was isolated from a non-water-flooded Australian terrestrial oil reservoir. Cells were non-spore-forming straight rods, which were motile by means of a polar flagellum. The optimum growth conditions were 55 °C, pH 6·9 and 0·5 % NaCl. Strain 4BON T was oxidase- and catalase-positive it grew on fumarate, pyruvate, succinate, formate, ethanol and yeast extract in the presence of oxygen or nitrate as terminal electron acceptor. Nitrate was reduced to nitrous oxide. The DNA G+C content of the strain was 58·6 mol%. The closest phylogenetic relative of strain 4BON T was Hydrogenophilus thermoluteolus (similarity of 91·8 %), of the β - Proteobacteria . As strain 4BON T is physiologically and phylogenetically different from H. thermoluteolus , it is proposed that it be assigned to a novel species of a novel genus, Petrobacter succinatimandens gen. nov., sp. nov. The type strain is 4BON T (=DSM 15512 T =CIP 107790 T ).
Mycelial morphology and fungal protein production from starch processing wastewater in submerged cultures of Aspergillus oryzae
Publisher: Elsevier BV
Date: 06-1999
Microbiology of petroleum reservoirs
Publisher: Springer Science and Business Media LLC
Date: 2000
Abstract: Although the importance of bacterial activities in oil reservoirs was recognized a long time ago, our knowledge of the nature and ersity of bacteria growing in these ecosystems is still poor, and their metabolic activities in situ largely ignored. This paper reviews our current knowledge about these bacteria and emphasises the importance of the petrochemical and geochemical characteristics in understanding their presence in such environments.
Isolation and characterization of Desulfovibrio senezii sp. nov., a halotolerant sulfate reducer from a solar saltern and phylogenetic confirmation of Desulfovibrio fructosovorans as a new species
Publisher: Springer Science and Business Media LLC
Date: 09-09-1998
Abstract: A new halotolerant Desulfovibrio, strain CVLT (T = type strain), was isolated from a solar saltern in California. The curved, gram-negative, nonsporeforming cells (0.3 x 1.0-1.3 &mgr m) occurred singly, in pairs, or in chains, were motile by a single polar flagellum and tolerated up to 12.5% NaCl. Strain CVLT had a generation time of 60 min when grown in lactate-yeast extract medium under optimal conditions (37 degreesC, pH 7.6, 2.5% NaCl). It used lactate, pyruvate, cysteine, or H2/CO2 + acetate as electron donors, and sulfate, sulfite, thiosulfate, or fumarate as electron acceptors. Elemental sulfur, nitrate, or oxygen were not used. Sulfite and thiosulfate were disproportionated to sulfate and sulfide. The G+C content of the DNA was 62 mol%. Phylogenetic analysis revealed that Desulfovibrio fructosovorans was the nearest relative. Strain CVLT is clearly different from other Desulfovibrio species, and is designated Desulfovibrio senezii sp. nov. (DSM 8436).
Thermovenabulum gondwanense sp. nov., a thermophilic anaerobic Fe(III)-reducing bacterium isolated from microbial mats thriving in a Great Artesian Basin bore runoff channel
Publisher: Microbiology Society
Date: 05-2010
Abstract: A strictly anaerobic, thermophilic bacterium, designated strain R270 T , was isolated from microbial mats thriving in the thermal waters (66 °C) of a Great Artesian Basin bore (registered no. 17263) runoff channel. Cells of strain R270 T were straight to slightly curved rods (3.50–6.00×0.75–1.00 μm) that stained Gram-positive, but possessed a Gram-negative cell-wall ultrastructure. Strain R270 T grew optimally in tryptone-yeast extract-Casamino acids medium at 65 °C (growth temperature range between 50 and 70 °C) and at pH 7.0 (growth pH range between 6.0 and 9.0). In the presence of 0.02 and 0.10 % yeast extract, pyruvate and Casamino acids were the only substrates fermented from a wide spectrum of substrates tested. Fe(III), Mn(IV), thiosulfate and elemental sulfur were used as electron acceptors in the presence 0.2 % yeast extract, but not sulfate, sulfite, nitrate, nitrite or fumarate. Growth of strain R270 T increased in the presence of Fe(III), which was reduced in the presence of peptone, tryptone, Casamino acids, amyl media, starch, pyruvate, H 2 and CO 2 , but not in the presence of acetate, lactate, propionate, formate, benzoate, glycerol or ethanol. Growth and Fe(III) reduction were inhibited by chlor henicol, streptomycin, tetracycline, penicillin, icillin and 2 % NaCl (w/v). The DNA G+C content of strain R270 T was 41±1 mol% ( T m ) and phylogenetic analysis of the 16S rRNA gene indicated that this isolate was closely related to Thermovenabulum ferriorganovorum DSM 14006 T (similarity value of 96.1 %) within the family ‘ Thermoanaerobacteraceae ’, class ‘ Clostridia ’, phylum ‘ Firmicutes ’. On the basis of the phylogenetic distance separating the two, together with differences in a number of key phenotypic characteristics, strain R270 T represents a novel species of the genus Thermovenabulum , for which the name Thermovenabulum gondwanense sp. nov. is proposed the type strain is R270 T (=KCTC 5616 T =DSM 21133 T ).
Draft Genome Sequence of Anoxybacillus Strain BCO1, Isolated from a Thermophilic Microbial Mat Colonizing the Outflow of a Bore Well of the Great Artesian Basin of Australia
Publisher: American Society for Microbiology
Date: 26-02-2015
Abstract: Anoxybacillus strain BCO1, isolated from a thermophilic (50°C) microbial mat colonizing an outflow of a Great Artesian bore well of Australia, possessed a genome of ~2.8 Mb, with a G+C content of 41.7 mol%, and encoded 3,205 genes.
Thermaerobacter subterraneus sp. nov., a novel aerobic bacterium from the Great Artesian Basin of Australia, and emendation of the genus Thermaerobacter
Publisher: Microbiology Society
Date: 05-2002
Expression, purification, crystallization and preliminary X-ray diffraction analysis of a ribokinase from the thermohalophile Halothermothrix orenii
Publisher: International Union of Crystallography (IUCr)
Date: 27-01-2012
DOI: 10.1107/S1744309111041091
Abstract: A ribokinase gene ( rbk ) from the anaerobic halothermophilic bacterium Halothermothrix orenii was cloned and overexpressed in Escherichia coli . The recombinant protein (Ho-Rbk) was purified using immobilized metal-ion affinity chromatography and crystals were obtained using the sitting-drop method. Diffraction data were collected to a resolution of 3.1 Å using synchrotron radiation. The crystals belonged to the orthorhombic space group P 2 1 2 1 2 1 , with unit-cell parameters a = 45.6, b = 61.1, c = 220.2, and contained two molecules per asymmetric unit. A molecular-replacement solution has been found and attempts are currently under way to build a model of the ribokinase. Efforts to improve crystal quality so that higher resolution data can be obtained are also being considered.
Identification of Leptospira biflexa by real-time homogeneous detection of rapid cycle PCR product
Publisher: Elsevier BV
Date: 02-1999
DOI: 10.1016/S0167-7012(98)00095-5
Abstract: Sequence analysis of 16S rRNA genes extracted from nucleic acids databases enabled the identification of a Leptospira biflexa (L. biflexa) signature sequence, against which a reverse primer designated L613, was designed. This primer, when used in conjunction with a universal bacterial specific forward primer designated Fd1, enabled the development of a LightCycler-based PCR protocol in which fluorescence emission due to binding of SYBR Green I dye to lified products could be detected and monitored. A melting temperature (Tm), determined from the melting curve of the lified product immediately following the termination of thermal cycling, confirmed that the product was that of L. biflexa. Agarose gel electrophoresis therefore was not necessary for identification of PCR products. The PCR protocol was very rapid, and consisted of 30 cycles with a duration of 20 s for each cycle with the monitoring of the melting curve requiring an additional 3 min. The whole protocol was completed in less than 20 min. The PCR protocol was also specific and enabled the identification of 18 strains of L. biflexa, whilst excluding 14 strains of L. interrogans and Leptonema illini. Two ex les of its utility in improving work flow of a Leptospira reference laboratory are presented in this article. The use of a simple boiling method for extraction of DNA from all the members of the Leptospiraceae family DNA further simplifies the procedure and makes its use conducive to diagnostic laboratories.
Erratum to: A molecular phylogenetic framework for Bacillus subtilis using genome sequences and its application to Bacillus subtilis subspecies stecoris strain D7XPN1, an isolate from a commercial food-waste degrading bioreactor
Publisher: Springer Science and Business Media LLC
Date: 06-2017
Production of fungal protein and glucoamylase by Rhizopus oligosporus from starch processing wastewater
Publisher: Elsevier BV
Date: 1999
Microvirga subterranea gen. nov., sp. nov., a moderate thermophile from a deep subsurface Australian thermal aquifer
Publisher: Microbiology Society
Date: 03-2003
Abstract: A strictly aerobic bacterium, strain Fail4T, was isolated from free-flowing geothermal waters of a bore (bore register no. 3768) tapping the Great Artesian Basin of Australia. The non-sporulating, Gram-negative cells of strain Fail4T produced light-pink colonies, were rod-shaped (1 x 1.5-4 microm) and were motile by a single polar flagellum. Strain Fail4T grew optimally at 41 degrees C at a pH of 7.0 and had an absolute requirement for yeast extract. The strain grew on casein hydrolysate, tryptone, gelatin, xylose and acetate in a medium supplemented with 0.06 or 0.006% yeast extract. Weak acid production was detected from glucose and arabinose. Catalase was produced. Nitrite was produced from nitrate. Strain Fail4T was sensitive to antibiotics that inhibit growth of bacteria. The G + C content was 63.5 +/- 0.5 mol%. Strain Fail4T was a member of the class 'Alphaproteobacteria', phylum Proteobacteria, placed almost equidistantly between Methylobacterium species, Chelatococcus asaccharovorans and Bosea thiooxidans (similarity value of 93%) as its nearest phylogenetic relatives. Phylogenetic and phenotypic evidence suggest that strain Fail4T (=ATCC BAA-295T = DSM 14364T) should be placed as the type strain of a species in a newly created genus, for which the name Microvirga subterranea gen. nov., sp. nov. is proposed.
Sporolituus thermophilus gen. nov., sp. nov., a citrate-fermenting thermophilic anaerobic bacterium from geothermal waters of the Great Artesian Basin of Australia
Publisher: Microbiology Society
Date: 23-07-2009
Abstract: A strictly anaerobic, sluggishly motile, spore-forming, thermophilic bacterium, designated strain AeG(T), was isolated from microbial mats colonizing a runoff channel formed by free-flowing thermal waters of a bore well (New Lorne Bore registered number 17263) in the Great Artesian Basin, Australia. Cells of strain AeG(T) were curved rods (2.0-10.0x0.8-1.0 mum) and stained Gram-negative. The strain grew optimally in tryptone-yeast extract-citrate medium at 55 degrees C (range for growth between 45 and 60 degrees C) and pH 7.0 (range for growth between pH 6.5 and 8.0). Citrate and malate, but no other organic acids, carbohydrates or amino acids could be used in the presence of up to 0.1 % yeast extract. Although yeast extract and/or tryptone were required for growth on citrate, they did not support growth as sole carbon sources. Strain AeG(T) reduced thiosulfate and sulfite in the presence of 0.2 % yeast extract, but not Fe(III), Mn(IV), sulfate, elemental sulfur, nitrate or nitrite. Growth was inhibited by chlor henicol, streptomycin, tetracycline, penicillin and icillin and in the presence of NaCl concentrations >1 %. The DNA G+C content was 55.4+/-1.0 mol% as determined by the thermal denaturation method. 16S rRNA gene sequence analysis indicated that strain AeG(T) was a member of the family Veillonellaceae, class 'Clostridia', phylum 'Firmicutes' and was most closely related to members of the genus Propionispora (mean 16S rRNA gene sequence similarity value to type strains was 90.8 %). Based on these results, strain AeG(T) is considered to represent a novel species in a new genus, for which the name Sporolituus thermophilus gen. nov., sp. nov. is proposed. The type strain of the type species is AeG(T) (=JCM 15556(T)=KCTC 5668(T)).
Biochemical and structural characterization of a thermostable β-glucosidase from Halothermothrix orenii for galacto-oligosaccharide synthesis
Publisher: Springer Science and Business Media LLC
Date: 31-08-2014
Crystallization of a novel α-amylase, AmyB, from the thermophilic halophile Halothermothrix orenii
Publisher: International Union of Crystallography (IUCr)
Date: 27-11-2003
DOI: 10.1107/S0907444903018754
Abstract: This is a report on the structure determination of AmyB, the second alpha-amylase from Halothermothrix orenii, by X-ray crystallography. This bacterium was isolated from saltpans where conditions consisted of both high temperatures and high NaCl content. AmyB is a 599-residue protein which is stable and significantly active at 358 K in starch solution containing up to 10%(w/v) NaCl. The purified recombinant AmyB protein crystallizes in the monoclinic space group C2, with unit-cell parameters a = 225.85, b = 77.16, c = 50.13 A, beta = 99.32 degrees, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 1.97 A.
Isolation and characterization of a mesophilic heavy-metals-tolerant sulfate-reducing bacterium Desulfomicrobium sp. from an enrichment culture using phosphogypsum as a sulfate source
Publisher: Elsevier BV
Date: 02-2007
DOI: 10.1016/J.JHAZMAT.2006.07.073
Abstract: A sulfate-reducing bacterium, was isolated from a 6 month trained enrichment culture in an anaerobic media containing phosphogypsum as a sulfate source, and, designated strain SA2. Cells of strain SA2 were rod-shaped, did not form spores and stained Gram-negative. Phylogenetic analysis of the 16S rRNA gene sequence of the isolate revealed that it was related to members of the genus Desulfomicrobium (average sequence similarity of 98%) with Desulfomicrobium baculatum being the most closely related (sequence similarity of 99%). Strain SA2 used thiosulfate, sulfate, sulfite and elemental sulfur as electron acceptors and produced sulfide. Strain SA2 reduced sulfate contained in 1-20g/L phosphogypsum to sulfide with reduction of sulfate contained in 2g/L phosphogypsum being the optimum concentration. Strain SA2 grew with metalloid, halogenated and non-metal ions present in phosphogypsum and with added high concentrations of heavy metals (125ppm Zn and 100ppm Ni, W, Li and Al). The relative order for the inhibitory metal concentrations, based on the IC(50) values, was Cu, Te>Cd>Fe, Co, Mn>F, Se>Ni, Al, Li>Zn.
Rapid distinction between Leptospira interrogans and Leptospira biflexa by PCR amplification of 23S ribosomal DNA
Publisher: Oxford University Press (OUP)
Date: 05-1997
Helix 6 of the 16S rRNA of the bacterium Desulfotomaculum australicum exhibits an unusual structural idiosyncrasy
Publisher: Oxford University Press (OUP)
Date: 1992
Identification of thiosulfate- and sulfur-reducing bacteria unable to reduce sulfate in ricefield soils
Publisher: Elsevier BV
Date: 07-2001
Utilisation of starch processing wastewater for production of microbial biomass protein and fungal α-amylase by Aspergillus oryzae
Publisher: Elsevier BV
Date: 12-1998
Defluvicoccus vanus gen. nov., sp. nov., a novel Gram-negative coccus/coccobacillus in the ‘Alphaproteobacteria’ from activated sludge
Publisher: Microbiology Society
Date: 09-2005
Abstract: A novel Gram-negative coccus/coccobacillus, strain Ben 114 T , growing in tetrads, clusters or aggregates, was isolated from activated sludge by micromanipulation. 16S rRNA gene sequence analysis revealed that it belonged to the ‘ Alphaproteobacteria ’, with no close relatives among cultured bacterial isolates. On the basis of phylogenetic data, this organism is considered to belong to a new genus, Defluvicoccus , represented by the species Defluvicoccus vanus sp. nov., a name chosen because of the distinctive staining properties of this organism only the cell wall stained strongly with a wide range of stains, giving the cell a hollow and empty appearance. No intracellular polyphosphate granules could be detected after staining, but poly- β -hydroxyalkanoate inclusions were detected using Nile blue A staining. Because of its taxonomic distance from its closest relatives among the ‘ Alphaproteobacteria ’, namely members of the genera Azospirillum , Phaeospirillum , Rhodospirillum , Rhodocista , Magnetospirillum and Rhodospira , D. vanus is considered to represent a new phylogenetic lineage within subgroup 1 of the ‘ Alphaproteobacteria ’, the D. vanus subgroup. The type strain is Ben 114 T (=NCIMB 13612 T =CIP 107350 T ).
Caloramator australicus sp. nov., a thermophilic, anaerobic bacterium from the Great Artesian Basin of Australia
Publisher: Microbiology Society
Date: 2009
Abstract: A strictly anaerobic, thermophilic bacterium, designated strain RC3T, was isolated from microbial mats colonizing thermal waters of a run-off channel formed by free-flowing waters from a bore well (registered no. 17263) of the Great Artesian Basin, Australia. The slightly curved rods (2.5-4.2x0.8-1.0 microm) of strain RC3T stained Gram-positive and grew optimally in tryptone-yeast extract-glucose medium at 60 degrees C (range 45-70 degrees C) and pH 7 (range pH 5-9). Strain RC3T grew poorly on yeast extract (0.2 %) but did not grow on tryptone (0.2 %) as a sole carbon source yeast extract was required for growth on other energy sources, which included glucose, fructose, galactose, xylose, maltose, sucrose, raffinose, mannose, cellobiose, cellulose, starch, amylopectin, xylan, peptone, amyl media (Research Achievement), threonine and pyruvate but did not include arabinose, ribose, lactose, CM-cellulose, myo-inositol, mannitol, chitin, casein, formate, acetate, succinate, propionate, lactate, benzoate, glycerol, ethanol, Casamino acids, arginine, alanine, serine, glycine, glutamine, leucine, isoleucine, methionine or aspartate. The end products of glucose fermentation were ethanol and acetate. In the presence of 0.2 % yeast extract, iron(III), manganese(IV) and elemental sulfur were reduced but not sulfate, sulfite, thiosulfate, nitrate or nitrite. Iron(III) was also reduced in the presence of peptone, tryptone, amyl media, threonine and glycerol but not chitin, xylan, pectin, starch, pyruvate, acetate, benzoate, lactate, propionate, succinate, inositol, ethanol, mannitol, arginine, glutamine or serine. Strain RC3T was not able to utilize molecular hydrogen and/or carbon dioxide in the presence or absence of iron(III). In the presence of iron(III) and glycerol, increased concentrations of Fe(II) corresponded to increased cell numbers, demonstrating that strain RC3(T) was able to conserve energy to support growth from the reduction of Fe(III) to Fe(II). Chlor henicol, streptomycin, tetracycline, penicillin and icillin and NaCl concentrations greater than 2 % inhibited growth. The G+C content of the DNA was 34+/-1 mol% as determined by the thermal denaturation (Tm) method. 16S rRNA gene sequence analysis indicated that strain RC3T was affiliated to Caloramator fervidus (95.8 % similarity to the type strain) and to other Caloramator species (average similarity of 91.6 %) within the phylum Firmicutes. On the basis of phylogenetic and phenotypic characteristics, it is proposed that strain RC3T should be classified in the genus Caloramator as a representative of a novel species, Caloramator australicus sp. nov. The type strain is RC3T (=JCM 1508T =KCTC 5601T).
Phylum XX. Dictyoglomi phyl. nov.
Publisher: Springer New York
Date: 2010
Fervidicella metallireducens gen. nov., sp. nov., a thermophilic, anaerobic bacterium from geothermal waters
Publisher: Microbiology Society
Date: 06-2010
Abstract: A strictly anaerobic, thermophilic bacterium, designated strain AeB T , was isolated from microbial mats colonizing a run-off channel formed by free-flowing thermal water from a bore well (registered number 17263) of the Great Artesian Basin, Australia. Cells of strain AeB T were slightly curved rods (2.5–6.0×1.0 μm) that stained Gram-negative and formed spherical terminal to subterminal spores. The strain grew optimally in tryptone–yeast extract–Casamino acids medium at 50 °C (range 37–55 °C) and pH 7 (range pH 5–9). Strain AeB T grew poorly on yeast extract (0.2 %) and tryptone (0.2 %) as sole carbon sources, which were obligately required for growth on other energy sources. Growth of strain AeB T increased in the presence of various carbohydrates and amino acids, but not organic acids. End products detected from glucose fermentation were ethanol, acetate, CO 2 and H 2 . In the presence of 0.2 % yeast extract, iron(III), manganese(IV), vanadium(V) and cobalt(III) were reduced, but not sulfate, thiosulfate, sulfite, elemental sulfur, nitrate or nitrite. Iron(III) was also reduced in the presence of tryptone, peptone, Casamino acids and amyl media (Research Achievement), but not starch, xylan, chitin, glycerol, ethanol, pyruvate, benzoate, lactate, acetate, propionate, succinate, glycine, serine, lysine, threonine, arginine, glutamate, valine, leucine, histidine, alanine, aspartate, isoleucine or methionine. Growth was inhibited by chlor henicol, streptomycin, tetracycline, penicillin, icillin and NaCl concentrations %. The DNA G+C content was 35.4±1 mol%, as determined by the thermal denaturation method. 16S rRNA gene sequence analysis indicated that strain AeB T is a member of the family Clostridiaceae , class Clostridia, phylum ‘ Firmicutes ’, and is positioned approximately equidistantly between the genera Sarcina , Anaerobacter , Caloramator and Clostridium (16S rRNA gene similarity values of 87.8–90.9 %). On the basis of 16S rRNA gene sequence comparisons and physiological characteristics, strain AeB T is considered to represent a novel species in a new genus, for which the name Fervidicella metallireducens gen. nov., sp. nov. is proposed the type strain is AeB T (=JCM 15555 T =KCTC 5667 T ).
Desulfovibrio mexicanus sp. nov., a sulfate-reducing bacterium isolated from an upflow anaerobic sludge blanket (UASB) reactor treating cheese wastewaters
Publisher: Elsevier BV
Date: 10-2000
Fervidicola ferrireducens gen. nov., sp. nov., a thermophilic anaerobic bacterium from geothermal waters of the Great Artesian Basin, Australia
Publisher: Microbiology Society
Date: 30-04-2009
Abstract: A strictly anaerobic, thermophilic bacterium, designated strain Y170(T), was isolated from a microbial mat colonizing thermal waters of a run-off channel created by the free-flowing waters of a Great Artesian Basin (GAB) bore well (New Lorne bore registered number 17263). Cells of strain Y170(T) were slightly curved rods (1.2-12x0.8-1.1 mum) and stained Gram-negative. The strain grew optimally in tryptone-yeast extract-glucose medium at 70 degrees C (temperature range for growth was 55-80 degrees C) and pH 7 (pH range for growth was 5-9). Strain Y170(T) grew poorly on yeast extract as a sole carbon source, but not on tryptone (0.2 %). Yeast extract could not be replaced by tryptone and was obligately required for growth on tryptone, peptone, glucose, fructose, galactose, cellobiose, mannose, sucrose, xylose, mannitol, formate, pyruvate, Casamino acids and threonine. No growth was observed on arabinose, lactose, maltose, raffinose, chitin, xylan, pectin, starch, acetate, benzoate, lactate, propionate, succinate, myo-inositol, ethanol, glycerol, amyl media, aspartate, leucine, glutamate, alanine, arginine, serine and glycine. End products detected from glucose fermentation were acetate, ethanol and presumably CO(2) and H(2). Iron(III), manganese(IV), thiosulfate and elemental sulfur, but not sulfate, sulfite, nitrate or nitrite, were used as electron acceptors in the presence of 0.2 % yeast extract. Iron(III) in the form of amorphous Fe(III) oxhydroxide and Fe(III) citrate was also reduced in the presence of tryptone, peptone and Casamino acids, but not with chitin, xylan, pectin, formate, starch, pyruvate, acetate, benzoate, threonine, lactate, propionate, succinate, inositol, ethanol, glycerol, mannitol, aspartate, leucine, glutamate, alanine, arginine, serine or glycine. Strain Y170(T) was not able to utilize molecular hydrogen and/or carbon dioxide in the presence or absence of iron(III). Chlor henicol, streptomycin, tetracycline, penicillin and icillin and NaCl concentrations greater than 2 % inhibited growth. The G+C content of the DNA was 48+/-1 mol% [sd (n=3) T(m)]. 16S rRNA gene sequence analysis indicated that strain Y170(T) is a member of the family Syntrophomonadaceae, class Clostridia, phylum Firmicutes and was most closely related to members of the genus Thermosediminibacter (mean similarity of 93.6 %). On the basis of the 16S rRNA gene sequence comparisons and physiological characteristics, strain Y170(T) is considered to represent a novel species of a new genus, for which the name Fervidicola ferrireducens gen. nov., sp. nov. is proposed. The type strain is Y170(T) (=KCTC 5610(T)=JCM 15106(T)=DSM 21121(T)).
Draft Genome Sequence of Cellulosilyticum sp. I15G10I2, a Novel Bacterium Isolated from a Coal Seam Gas Water Treatment Pond
Publisher: American Society for Microbiology
Date: 16-02-2017
Abstract: Cellulosilyticum sp. strain I15G10I2 was isolated from a coal seam gas water treatment pond at the Spring Gully water treatment facility, Roma, Queensland, Australia. Analysis of the genome of 4,489,861 bp and G+C content of 35.23% revealed that strain I15G10I2 shared limited similarity to members of the genus Cellulosilyticum , family Lachnospiraceae .
Aminobacterium colombiensegen. nov. sp. nov., an Amino Acid-degrading Anaerobe Isolated from Anaerobic Sludge
Publisher: Elsevier BV
Date: 10-1998
Abstract: A new gram-negative, non-sporulating, mesophilic, amino acid fermenting bacterium, designated strain ALA-1(T) (T = type strain), was isolated from an anaerobic lagoon of a dairy wastewater treatment plant. The strain is curved (3-4 microm x 0.2-0.3 microm) and occurs singly or in pairs. Optimum growth occurs at 37 degrees C and pH 7.3. The G+C content of the DNA is 46 mol %. The strain requires yeast extract for growth, grows poorly on casamino acids, peptones, cysteine, and alpha-ketoglutarate, but readily grows on serine, threonine, glycine and pyruvate. When cocultured with the hydrogenotrophic methanogen Methanobacterium formicicum, strain ALA-1(T) oxidized alanine, glutamate, leucine, isoleucine, valine, aspartate, and methionine. Phylogenetic analysis revealed that it forms a distinct and independent line of descent in the vicinity of Dethiosulfovibrio peptidovorans, Dictyoglomus thermophilum, and Anaerobaculum thermoterrenum which are members of the low G+C containing gram-positive bacteria. The phylogenetic results concur with the phenotypic and genomic data which reveal that it is a novel strain. Based on these findings, we designate strain ALA-1(T) as Aminobacterium colombiense (DSM 12261) gen. nov., sp. nov.
Microbiological pattern of arterial catheters in the intensive care unit
Publisher: Springer Science and Business Media LLC
Date: 2010
Dictyoglomi phyl. nov.
Publisher: Wiley
Date: 14-09-2015
DOI: 10.1002/9781118960608.PBM00013
Abstract: Dic'ty.o.glo'mi. N.L. n. Dictyoglomus type genus of the type order of the phylum − i ending to denote phylum N.L. neut. pl. n. Dictyoglomi the phylum of the order Dictyoglomales . Dictyoglomi
Amaricoccus Maszenan, Seviour, Patel, Rees and McDougall 1997, 732 VP
Publisher: Springer-Verlag
Date: 2005
FgoI, a type II restriction endonuclease from the thermoanaerobe Fervidobacterium gondwanense AB39(T)
Publisher: Elsevier BV
Date: 10-1998
Abstract: Restriction endonuclease activity was detected in 11 out of 13 Fervidobacterium isolates, including F. islandicum H21(T), F. gondwanense AB39(T), and nine other Fervidobacterium-like strains isolated from the Great Artesian Basin of Australia. The restriction endonuclease from F. gondwanense AB39(T) was partially purified and designated FgoI. FgoI recognized a 4 nucleotide sequence 5'-CTAG-3' and cleaved between nucleotides C and T to produce a 2 base 5' overhang (5'-C/TAG-3'). As predicted from the enzyme recognition and cleavage specificity, FgoI was found to cleave delta DNA 13 times, phiX174 three times, pBR322 five times, pUC18 four times, and pSK six times. FgoI exhibited a broad temperature optimum range (between 60 to 70 degrees C) and was active at pH 6.5 to 8.5, but not at pH 9.0. Manganese could replace magnesium as a cofactor for activity, but not cobalt chloride, calcium chloride, cupric chloride, or zinc chloride. The restriction endonuclease was completely inactivated by phenol/chloroform extraction and was heat inactivated at 80 degrees C for 60 min or at 100 degrees C for 15 min. FgoI has been identified as a heat stable isoschizomer of the Type II restriction endonucleases, MaeI and BfaI.
Effect of thiosulphate as electron acceptor on glucose and xylose oxidation by Thermoanaerobacter finnii and a Thermoanaerobacter sp. isolated from oil field water
Publisher: Elsevier BV
Date: 1996
DOI: 10.1016/0923-2508(96)80215-4
Abstract: During glucose and xylose fermentation, Thermoanaerobacter finnii was observed to produce lactate, acetate, H2 and CO2, with ethanol being the major end product. Thermoanaerobacter strain SEBR 5268, an isolate from an oil field, also produced a similar range of end products from glucose and xylose fermentation, with the exception that both ethanol and lactate were the major products of sugar metabolism. Both these strains were able to reduce thiosulphate to sulphide in the presence of these two substrates, with acetate being the dominant metabolite in that case. In addition, a faster growth rate and increased cell yield were obtained in the presence of thiosulphate, than in its absence. The higher concentrations of acetate produced in the presence of thiosulphate rather than without any electron acceptor indicated that more ATP was generated from substrate-level phosphorylation. These results have implications for our understanding of the breakdown of carbohydrates present in organic matter found in the natural ecological niches of Thermoanaerobacter species (sulphide-, elemental sulphur- or sulphate-rich thermal hot springs and oil fields).
Draft Genome Sequence of Microbacterium sp. TNHR37B Isolated from a Heated Aquifer Bore Well of the Great Artesian Basin, Australia
Publisher: American Society for Microbiology
Date: 27-04-2017
Abstract: Microbacterium sp. strain TNHR37B was isolated from a geothermal bore well s le (50°C) collected from a region of coal seam gas extraction activities. The 3.5-Mb genome with a G+C content of 69.9% contained unique genes, and a low similarity value for average nucleotide identity using BLAST was observed with the available 73 Microbacterium sp. genomes.
Proposal of Frondihabitans gen. nov. to replace the illegitimate genus name Frondicola Zhang et al. 2007
Publisher: Microbiology Society
Date: 02-2009
Abstract: The prokaryotic generic name Frondicola Zhang et al. 2007 is illegitimate because it is a later homonym of a fungal genus name Frondicola Hyde, 1992 (Fungi, Ascomycota, Sordariomycetes, Xylariomycetidae, Xylariales, Hyponectriaceae) [Principle 2 and Rule 51b(4) of the Bacteriological Code (1990 Revision)]. It is also questionable whether the genus name can be validly published. Therefore, a new genus name, Frondihabitans gen. nov., is proposed for this taxon. As a result, a new name is proposed for the type species, Frondihabitans australicus sp. nov., to replace the illegitimate combination Frondicola australicus Zhang et al. 2007. The type strain of Frondihabitans australicus is E1HC-02(T) (=JCM 13598(T) =DSM 17894(T)).
Isolation of an extremely thermophilic chemoorganotrophic anaerobe similar to Dictyoglomus thermophilum from new zealand hot springs
Publisher: Springer Science and Business Media LLC
Date: 1987
DOI: 10.1007/BF00492899
Bacillus subterraneus sp. nov., an iron- and manganese-reducing bacterium from a deep subsurface Australian thermal aquifer
Publisher: Microbiology Society
Date: 05-2002
Expression, purification and preliminary crystallographic analysis of the recombinant Β-glucosidase (BglA) from the halothermophile Halothermothrix orenii
Publisher: International Union of Crystallography (IUCr)
Date: 23-12-2011
A fluorescently-labelled r-RNA targeted oligonucleotide probe for the in situ detection of G-bacteria of the genus Amaricoccus in activated sludge
Publisher: Oxford University Press (OUP)
Date: 05-2000
DOI: 10.1046/J.1365-2672.2000.01022.X
Abstract: A fluorescently-labelled r-RNAtargeted oligonucleotide probe specific for members of the genus Amaricoccus, which includes one group of the Gram-negative G-Bacteria seen in activated sludge systems, is described. These organisms, previously 'identified' on their distinctive morphology of cocci in tetrads, have been associated with poor performance of biological nutrient removal (EBNR) plants, by out-competing the polyphosphate accumulating bacteria. Methods of s le preparation for probing activated sludge are detailed, and preliminary surveys of 46 plants, using this probe, show that G-Bacteria belonging to the genus Amaricoccus are seen not only in large numbers in EBNR systems but also in conventional plants. The presence of single cells of this organism was common, emphasizing the dangers of relying on morphology and cell arrangement to identify these bacteria.
Random sequence analysis of genomic DNA of an anaerobic, thermophilic, halophilic bacterium, Halothermothrix orenii
Publisher: Springer Science and Business Media LLC
Date: 02-2001
Abstract: A pBluescriptSK+ vector library consisting of 3.360 clones with an average insert size of 3.5 kb was constructed from the genome of Halothermothrix orenii, a halophilic and thermoanaerobic member of the family Haloanaerobiaceae. From both ends, 77 clones were sequenced using T3 and T7 vector primers generating 154 sequence tags, representing approximately 85 kb of the genome. Comparison of sequence tags against the Gen-Bank database using BLASTX identified 66 known proteins and 15 conserved hypothetical proteins. The putative proteins included a V-ATPase, hydrogenases, and enzymes with potential for industrial applications. The overall G + C% of the codons used was 42.9% with a third-position G + C content of 38.6%. High levels of excess acidic amino acids were not detected in the putative proteins of H. orenii as compared to the mesophilic haloanaerobes. This lack may be the result of reduced activity of acidic, halophilic enzymes at high temperatures and intermediate salt concentrations.
Culture-dependent and culture-independent microbial investigation of pine litters and soil in subtropical Australia
Publisher: Springer Science and Business Media LLC
Date: 13-02-2009
Phenylobacterium lituiforme sp. nov., a moderately thermophilic bacterium from a subsurface aquiter, and emended description of the genus Phenylobacterium
Publisher: Microbiology Society
Date: 11-2004
Abstract: A facultative anaerobic bacterium, strain FaiI3 T , was isolated from s les collected from the free-flowing waters of a bore well (Fairlea Bore, registration number 3768) which taps into the Australian Great Artesian Basin subsurface thermal aquifer. Strain FaiI3 T developed yellow to pale-yellow colonies (0·5–1·5 mm) after 48 h. The non-spore forming rods (0·5×1–3 μm) were slightly curved, occurred singly and as pairs and were motile with a single polar flagellum. Cells tended to form clumps in liquid medium and rosettes were commonly observed. The cells stained Gram-negative and electron micrographs of thin sections revealed a multi-layered complex Gram-negative cell wall structure. Strain FaiI3 T grew optimally at 40–41 °C, with growth observed at 45 °C but not at 50 °C. The pH growth range was between pH 6 and 9 and optimal growth occurred between pH 6 and 6·5. Strain FaiI3 T grew best with yeast extract as the sole carbon and energy source. Peptone, yeast extract, acetate, xylose, sucrose, glucose, glycerol, succinate, butyrate, lactate, fumarate, citrate, l -phenylalanine, cellobiose and gelatin supported growth but maltose, fructose, glycine, ethanol, benzoate and oxalate did not. Tyrosine was produced from l -phenylalanine. Strain FaiI3 T was catalase-positive and oxidase-negative and did not hydrolyse starch. Growth was inhibited by neomycin, tetracycline, streptomycin, chlor henicol, icillin, vancomycin and spectinomycin. The G+C content was determined to be 66·5±0·5 mol%. On the basis of the 16S rRNA gene sequence analysis, strain FaiI3 T was assigned as a novel species of the genus Phenylobacterium , Phenylobacterium lituiforme sp. nov. in the order Caulobacterales , subclass α - Proteobacteria , class Proteobacteria . The type strain is FaiI3 T (=ATCC BAA-294 T =DSM 14363 T ).
A simple and efficient method for preparing and dispensing anaerobic media
Publisher: Springer Science and Business Media LLC
Date: 04-1985
DOI: 10.1007/BF01042377
Anaerobic degradation of methoxylated aromatic compounds by Clostridium methoxybenzovorans and a nitrate-reducing bacterium Thauera sp. strain Cin3,4
Publisher: Elsevier BV
Date: 12-2005
Comparison of epidemiologically linked Campylobacter jejuni isolated from human and poultry sources
Publisher: Cambridge University Press (CUP)
Date: 04-05-2015
DOI: 10.1017/S0950268815000886
Abstract: C ylobacter jejuni is responsible for most foodborne bacterial infections worldwide including Australia. The aim of this study was to investigate a combination of typing methods in the characterization of C. jejuni isolated from clinical diarrhoeal s les ( n = 20) and chicken meat ( n = 26) in order to identify the source of infection and rank isolates based on their relative risk to humans. Sequencing of the flaA short variable region demonstrated that 86% of clinical isolates had genotypes that were also found in chicken meat. A polymerase chain reaction binary typing system identified 27 different codes based on the presence or absence of genes that have been reported to be associated with various aspects of C. jejuni pathogenicity, indicating that not all isolates may be of equal risk to human health. The lipooligosaccharide (LOS) of the C. jejuni isolates was classified into six classes (A, B, C, E, F, H) with 10·4% remaining unclassified. The majority (72·7%) of clinical isolates possessed sialylated LOS classes. Sialylated LOS classes were also detected in chicken isolates (80·7%). Antimicrobial tests indicated a low level of resistance, with no phenotypic resistance found to most antibiotics tested. A combination of typing approaches was useful to assign isolates to a source of infection and assess their risk to humans.
Utilization of serine, leucine, isoleucine, and valine by Thermoanaerobacter brockii in the presence of thiosulfate or Methanobacterium sp. as electron accepters
Publisher: Elsevier BV
Date: 12-1997
Abstract: Thermoanaerobacter brockii fermented serine to acetate and ethanol. It oxidized leucine to isovalerate, isoleucine to 2-methylbutyrate, and valine to isobutyrate only in the presence of thiosulfate, or when co-cultured with Methanobacterium sp. This oxidative deamination was rendered thermodynamically possible by the ability ofT. brockii to reduce thiosulfate to sulfide or the transfer of reducing equivalents to the hydrogenotrophic methanogen. The results suggest that T. brockii may be of ecological significance in thermal environments in the turnover of amino acids, especially with thiosulfate or H(2)-utilizing methanogens are present.
Caloramator quimbayensis sp. nov., an anaerobic, moderately thermophilic bacterium isolated from a terrestrial hot spring
Publisher: Microbiology Society
Date: 04-2013
Abstract: An anaerobic, moderately thermophilic, terminal-spore-forming bacterium, designated strain USBA A T , was isolated from a terrestrial hot spring located at an altitude of 2683 m in the Andean region of Colombia (04° 50′ 14.0″ N 75° 32′ 53.4″ W). Cells of strain USBA A T were Gram-stain-positive, straight to slightly curved rods (0.9×2.5 µm), that were arranged singly or in pairs, and were motile by means of flagella. Growth occurred at 37–55 °C and pH 6.0–8.0, with a doubling time of 2 h under the optimal conditions (50 °C and pH 7.0). Glucose fermentation in strain USBA A T required yeast extract or peptone (each at 0.2 %, w/v). The novel strain fermented sugars, amino acids, Casamino acids, propanol, propionate, starch and dextrin, but no growth was observed on galactose, lactose, xylose, histidine, serine, threonine, benzoate, butyrate, lactate, pyruvate, succinate, methanol, ethanol, glycerol, casein, gelatin or xylan. The end products of glucose fermentation were formate, acetate, ethanol and lactate. Strain USBA A T did not grow autotrophically (with CO 2 as carbon source and H 2 as electron donor) and did not reduce thiosulfate, sulfate, elemental sulfur, sulfite, vanadium (V) or Fe (III) citrate. Growth of strain USBA A T was inhibited by icillin, chlor henicol, kanamycin, penicillin and streptomycin (each at 10 µg ml −1 ). The predominant fatty acids were iso-C 15 : 0 , C 16 : 0 and iso-C 17 : 0 and the genomic DNA G+C content was 32.6 mol%. 16S rRNA gene sequence analysis indicated that strain USBA A T belonged in the phylum Firmicutes and that its closest relative was Caloramator viterbiensis JW/MS-VS5 T (95.0 % sequence similarity). A DNA–DNA relatedness value of only 30 % was recorded in hybridization experiments between strain USBA A T and Caloramator viterbiensis DSM 13723 T . Based on the phenotypic, chemotaxonomic and phylogenetic evidence and the results of the DNA–DNA hybridization experiments, strain USBA A T represents a novel species of the genus Caloramator , for which the name Caloramator quimbayensis sp. nov. is proposed. The type strain is USBA A T ( = CMPUJ U833 T = DSM 22093 T ).
Aminiphilus circumscriptus gen. nov., sp. nov., an anaerobic amino-acid-degrading bacterium from an upflow anaerobic sludge reactor
Publisher: Microbiology Society
Date: 08-2007
Abstract: Strain ILE-2 T was isolated from an upflow anaerobic sludge bed reactor treating brewery wastewater. The motile, non-sporulating, slightly curved cells (2–4×0.1 μm) stained Gram-negative and grew optimally at 42 °C and pH 7.1 with 0.5 % NaCl. The strain required yeast extract for growth and fermented Casamino acids, peptone, isoleucine, arginine, lysine, alanine, valine, glutamate, histidine, glutamine, methionine, malate, fumarate, glycerol and pyruvate to acetate, propionate and minor amounts of branched-chain fatty acids. Carbohydrates, formate, acetate, propionate, butyrate, isovalerate, methanol, ethanol, 1-propanol, butanol, lactate, succinate, starch, casein, gelatin, xylan and a number of other amino acids were not utilized. The DNA G+C content of strain ILE-2 T was 52.7 mol%. 16S rRNA gene sequence analysis revealed that ILE-2 T was distantly related to members of the genera Aminobacterium (83 % similarity) and Aminomonas (85 % similarity) in the family Syntrophomonadaceae , order Clostridiales , phylum Firmicutes . On the basis of the results of our polyphasic analysis, strain ILE-2 T represents a novel species and genus within the family Syntrophomonadaceae , for which the name Aminiphilus circumscriptus gen. nov., sp. nov. is proposed. The type strain of Aminiphilus circumscriptus is ILE-2 T (=DSM 16581 T =JCM 14039 T ).
Biological nitrogen fixation by two Acacia species and associated root-nodule bacteria in a suburban Australian forest subjected to prescribed burning
Publisher: Springer Science and Business Media LLC
Date: 04-09-2020
Isolation from oil reservoirs of novel thermophilic anaerobes phylogenetically related to Thermoanaerobacter subterraneus: reassignment of T. subterraneus, Thermoanaerobacter yonseiensis, Thermoanaero
Publisher: Microbiology Society
Date: 03-2004
Abstract: Novel thermophilic, anaerobic, Gram-positive, rod-shaped bacteria, strains SL9 and OCA1, were isolated from oilfields in France and Australia, respectively. Both strains, together with Thermoanaerobacter yonseiensis KB-1 T (=DSM 13777 T ), Thermoanaerobacter tengcongensis MB4 T (=DSM 15242 T ) and Carboxydibrachium pacificum JM T (=DSM 12653 T ), possessed genomic (DNA–DNA hybridization studies) and phylogenetic similarities with Thermoanaerobacter subterraneus SEBR 7858 T (=DSM 13054 T ), which was isolated recently from an oilfield reservoir in south-west France. Marked phenotypic differences exist between the three oilfield isolates ( T. subterraneus , strain OCA1 and strain SL9): they include temperature range for growth and substrates used. Differences were also observed in the DNA G+C contents of all organisms. Similarly to T. subterraneus , strains SL9 and OCA1, and also T. yonseiensis , T. tengcongensis and Carboxydibrachium pacificum , produced acetate and l -alanine as major end products of glucose metabolism [0·8–1·0 mol l -alanine produced (mol glucose consumed) −1 ] and reduced thiosulfate, but not sulfate, to sulfide. Because of these significant metabolic and phylogenetic differences between the oilfield isolates ( T. subterraneus , strain OCA1 and strain SL9), T. yonseiensis , T. tengcongensis and Carboxydibrachium pacificum and other Thermoanaerobacter species, it is proposed to reassign them as a novel genus and species, Caldanaerobacter subterraneus gen. nov., sp. nov., comb. nov., with the creation of four novel subspecies, Caldanaerobacter subterraneus subsp. subterraneus subsp. nov., comb. nov., Caldanaerobacter subterraneus subsp. yonseiensis subsp. nov., comb. nov., Caldanaerobacter subterraneus subsp. tengcongensis subsp. nov., comb. nov. and Caldanaerobacter subterraneus subsp. pacificus subsp. nov., comb. nov.
A molecular phylogenetic framework for Bacillus subtilis using genome sequences and its application to Bacillus subtilis subspecies stecoris strain D7XPN1, an isolate from a commercial food-waste degrading bioreactor
Publisher: Springer Science and Business Media LLC
Date: 28-03-2016
Eubacterium aggreganssp. nov., a New Homoacetogenic Bacterium from Olive Mill Wastewater Treatment Digestor
Publisher: Elsevier BV
Date: 12-1998
Abstract: A strictly anaerobic, homoacetogenic, gram-positive, non spore-forming bacterium, designated strain SR12(T) (T = type strain), was isolated from an anaerobic methanogenic digestor fed with olive mill wastewater. Yeast extract was required for growth but could also be used as sole carbon and energy source. Strain SR12(T) utilized a few carbohydrates (glucose, fructose and sucrose), organic compounds (lactate, crotonate, formate and betaine), alcohols (methanol), the methoxyl group of some methoxylated aromatic compounds, and H2 + CO2. The end-products of carbohydrate fermentation were acetate, formate, butyrate, H2 and CO2. End-products from lactate and methoxylated aromatic compounds were acetate and butyrate. Strain SR12(T) was non-motile, formed aggregates, had a G+C content of 55 mol % and grew optimally at 35 degrees C and pH 7.2 on a medium containing glucose. Phylogenetically, strain SR12(T) was related to Eubacterium barkeri, E. callanderi, and E. limosum with E. barkeri as the closest relative (similarity of 98%) with which it bears little phenotypic similarity or DNA homology (60%). On the basis of its phenotypic, genotypic, and phylogenetic characteristics, we propose to designate strain SR12(T) as Eubacterium aggregans sp. nov. The type strain is SR12(T) (= DSM 12183).
Related Organisations
Related Funding Activities
Linkage Projects - Grant ID: LP0454220
Start Date: 2004
End Date: 12-2007
Amount: $88,668.00
Funder: Australian Research Council
View Funded ActivityLinkage Projects - Grant ID: LP0348718
Start Date: 01-2004
End Date: 12-2011
Amount: $114,000.00
Funder: Australian Research Council
View Funded ActivityLinkage Infrastructure, Equipment And Facilities - Grant ID: LE0561013
Start Date: 2005
End Date: 12-2005
Amount: $220,000.00
Funder: Australian Research Council
View Funded ActivitySpecial Research Initiatives - Grant ID: SR0354702
Start Date: 2004
End Date: 12-2004
Amount: $10,000.00
Funder: Australian Research Council
View Funded Activity